Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012731 Streptococcus suis strain 90-1330 chromosome, complete genome 2 crisprs cas2,cas1,cas9,DinG,cas3,DEDDh,csa3 1 5 9 0

Results visualization

1. NZ_CP012731
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012731_1 189953-190448 TypeII NA
7 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012731_2 2118339-2118422 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP012731_1 1.7|190384|29|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190384-190412 29 NZ_CP012731.1 1929478-1929506 0 1.0

1. spacer 1.7|190384|29|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to position: 1929478-1929506, mismatch: 0, identity: 1.0

caacatggttttgatcccacgtttggcca	CRISPR spacer
caacatggttttgatcccacgtttggcca	Protospacer
*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012731_1 1.3|190121|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190121-190150 30 MK448982 Streptococcus phage Javan554, complete genome 21889-21918 0 1.0
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 MK448365 Streptococcus satellite phage Javan212, complete genome 12488-12517 6 0.8
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 NZ_CP026119 Halobacillus litoralis strain ERB 031 plasmid pLDW-31, complete sequence 127386-127415 6 0.8
NZ_CP012731_1 1.7|190384|29|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190384-190412 29 NZ_CP012032 Leptospira borgpetersenii serovar Ballum strain 56604 plasmid lbp2, complete sequence 6830-6858 6 0.793
NZ_CP012731_2 2.1|2118367|28|NZ_CP012731|CRISPRCasFinder 2118367-2118394 28 NZ_CP043555 Vibrio cholerae strain RFB16 plasmid unnamed, complete sequence 6368-6395 6 0.786
NZ_CP012731_1 1.1|189989|30|NZ_CP012731|CRISPRCasFinder,CRT 189989-190018 30 AJ609634 Bacteriophage EJ-1 proviral DNA, complete genome 6909-6938 7 0.767
NZ_CP012731_1 1.1|189989|30|NZ_CP012731|CRISPRCasFinder,CRT 189989-190018 30 NC_005294 Streptococcus prophage EJ-1, complete genome 6909-6938 7 0.767
NZ_CP012731_1 1.1|189989|30|NZ_CP012731|CRISPRCasFinder,CRT 189989-190018 30 KY065449 Streptococcus phage IPP5, complete genome 7026-7055 7 0.767
NZ_CP012731_1 1.3|190121|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190121-190150 30 NZ_CP013208 Paenibacillus sp. IHB B 3084 plasmid pHD05, complete sequence 11448-11477 7 0.767
NZ_CP012731_1 1.3|190121|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190121-190150 30 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 56962-56991 7 0.767
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 AP019559 Escherichia phage SP15 DNA, complete genome 91136-91165 7 0.767
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 NZ_CP014221 Clostridium botulinum strain B515 plasmid pRSJ21_2, complete sequence 10259-10288 7 0.767
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 NZ_CP013852 Clostridium botulinum strain B305 plasmid pRSJ6_2, complete sequence 8743-8772 7 0.767
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 NZ_CP014172 Clostridium botulinum strain B609 plasmid pRSJ22_1, complete sequence 744-773 7 0.767
NZ_CP012731_2 2.1|2118367|28|NZ_CP012731|CRISPRCasFinder 2118367-2118394 28 NZ_CP040462 Enterococcus sp. M190262 plasmid pM190262, complete sequence 148656-148683 7 0.75
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 MT679222 Proteus phage 2, complete genome 96921-96950 8 0.733
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 MT679223 Proteus phage 1, complete genome 97178-97207 8 0.733
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 NZ_CP053952 Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence 451906-451935 8 0.733
NZ_CP012731_1 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR 190318-190347 30 NZ_CP053949 Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence 101964-101993 8 0.733

1. spacer 1.3|190121|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to MK448982 (Streptococcus phage Javan554, complete genome) position: , mismatch: 0, identity: 1.0

gacaaggtcgaaaagaaatacattgatgtt	CRISPR spacer
gacaaggtcgaaaagaaatacattgatgtt	Protospacer
******************************

2. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to MK448365 (Streptococcus satellite phage Javan212, complete genome) position: , mismatch: 6, identity: 0.8

cagtattaattgggatattatttatcttag	CRISPR spacer
tagtattaattggaatagtatttatctctt	Protospacer
.************.*** *********.  

3. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026119 (Halobacillus litoralis strain ERB 031 plasmid pLDW-31, complete sequence) position: , mismatch: 6, identity: 0.8

cagtattaattgggatattatttatcttag	CRISPR spacer
gagtattaattgggttattatttattgttc	Protospacer
 ************* **********. *  

4. spacer 1.7|190384|29|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012032 (Leptospira borgpetersenii serovar Ballum strain 56604 plasmid lbp2, complete sequence) position: , mismatch: 6, identity: 0.793

caacatggttttgatcccacgtttggcca	CRISPR spacer
aaaatcggtttttttcccacgtttggcca	Protospacer
 **  .******  ***************

5. spacer 2.1|2118367|28|NZ_CP012731|CRISPRCasFinder matches to NZ_CP043555 (Vibrio cholerae strain RFB16 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

catttctacaaaggtttggggaaacttg	CRISPR spacer
aatttctacaaagttttggggaaggtat	Protospacer
 ************ *********. *  

6. spacer 1.1|189989|30|NZ_CP012731|CRISPRCasFinder,CRT matches to AJ609634 (Bacteriophage EJ-1 proviral DNA, complete genome) position: , mismatch: 7, identity: 0.767

tacaaatgttatggggataactaccagaag	CRISPR spacer
taaaaatgttaaggggataactaaagaaac	Protospacer
** ******** ***********  ..** 

7. spacer 1.1|189989|30|NZ_CP012731|CRISPRCasFinder,CRT matches to NC_005294 (Streptococcus prophage EJ-1, complete genome) position: , mismatch: 7, identity: 0.767

tacaaatgttatggggataactaccagaag	CRISPR spacer
taaaaatgttaaggggataactaaagaaac	Protospacer
** ******** ***********  ..** 

8. spacer 1.1|189989|30|NZ_CP012731|CRISPRCasFinder,CRT matches to KY065449 (Streptococcus phage IPP5, complete genome) position: , mismatch: 7, identity: 0.767

tacaaatgttatggggataactaccagaag	CRISPR spacer
taaaaatgttaaggggataactaaagaaac	Protospacer
** ******** ***********  ..** 

9. spacer 1.3|190121|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013208 (Paenibacillus sp. IHB B 3084 plasmid pHD05, complete sequence) position: , mismatch: 7, identity: 0.767

gacaaggtcgaaaagaaatacattgatgtt	CRISPR spacer
aagcaggacgaaaagaaatccattgatgca	Protospacer
.*  *** *********** ********. 

10. spacer 1.3|190121|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 7, identity: 0.767

gacaaggtcgaaaagaaatacattgatgtt	CRISPR spacer
gatacacccgaaaagaaagacattgatgtc	Protospacer
**.* . .********** **********.

11. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to AP019559 (Escherichia phage SP15 DNA, complete genome) position: , mismatch: 7, identity: 0.767

cagtattaattgggatattatttatcttag	CRISPR spacer
cagtatttaatgggatattatttagaacaa	Protospacer
******* * **************   .*.

12. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014221 (Clostridium botulinum strain B515 plasmid pRSJ21_2, complete sequence) position: , mismatch: 7, identity: 0.767

cagtattaattgggatattatttatcttag	CRISPR spacer
taagactaattgggatagtatttttcttat	Protospacer
.*. *.*********** ***** ***** 

13. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013852 (Clostridium botulinum strain B305 plasmid pRSJ6_2, complete sequence) position: , mismatch: 7, identity: 0.767

cagtattaattgggatattatttatcttag	CRISPR spacer
taagactaattgggatagtatttttcttat	Protospacer
.*. *.*********** ***** ***** 

14. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014172 (Clostridium botulinum strain B609 plasmid pRSJ22_1, complete sequence) position: , mismatch: 7, identity: 0.767

cagtattaattgggatattatttatcttag	CRISPR spacer
taagactaattgggatagtatttttcttat	Protospacer
.*. *.*********** ***** ***** 

15. spacer 2.1|2118367|28|NZ_CP012731|CRISPRCasFinder matches to NZ_CP040462 (Enterococcus sp. M190262 plasmid pM190262, complete sequence) position: , mismatch: 7, identity: 0.75

catttctacaaaggtttggggaaacttg	CRISPR spacer
catttctacaacggtttgcggaacaaat	Protospacer
*********** ****** ****     

16. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to MT679222 (Proteus phage 2, complete genome) position: , mismatch: 8, identity: 0.733

cagtattaattgggatattatttatcttag	CRISPR spacer
tcgtattagttgggatattagttatccgta	Protospacer
. ******.*********** *****.  .

17. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to MT679223 (Proteus phage 1, complete genome) position: , mismatch: 8, identity: 0.733

cagtattaattgggatattatttatcttag	CRISPR spacer
tcgtattagttgggatattagttatccgta	Protospacer
. ******.*********** *****.  .

18. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053952 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cagtattaattgggatattatttatcttag	CRISPR spacer
agagattgattgggatattttttatcttga	Protospacer
 .. ***.*********** ********..

19. spacer 1.6|190318|30|NZ_CP012731|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053949 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cagtattaattgggatattatttatcttag	CRISPR spacer
agagattgattgggatattttttatcttga	Protospacer
 .. ***.*********** ********..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 102855 : 153464 48 Streptococcus_phage(30.0%) protease,tRNA,transposase NA
DBSCAN-SWA_2 236910 : 251450 25 Streptococcus_phage(100.0%) integrase attL 238730:238746|attR 248186:248202
DBSCAN-SWA_3 508070 : 523847 17 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_4 602434 : 638332 44 Streptococcus_phage(97.67%) portal,integrase,transposase attL 629766:629780|attR 638142:638156
DBSCAN-SWA_5 1071469 : 1089478 21 Streptococcus_phage(72.22%) integrase,transposase attL 1076349:1076367|attR 1088176:1088194
DBSCAN-SWA_6 1758035 : 1794923 36 Streptococcus_phage(93.33%) transposase,holin,protease,capsid,terminase NA
DBSCAN-SWA_7 1951334 : 1964773 9 Streptococcus_phage(71.43%) NA NA
DBSCAN-SWA_8 2007539 : 2028559 21 Streptococcus_phage(86.67%) terminase NA
DBSCAN-SWA_9 2048354 : 2058555 11 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage