Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015114 Staphylococcus condimenti strain DSM 11674 chromosome, complete genome 2 crisprs cas3,cas14j,c2c9_V-U4,DinG,DEDDh,csa3,WYL 0 1 7 0

Results visualization

1. NZ_CP015114
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015114_1 1484734-1484812 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015114_2 1487141-1487227 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015114_1 1.1|1484759|29|NZ_CP015114|CRISPRCasFinder 1484759-1484787 29 NC_007021 Staphylococcus phage Twort, complete genome 81319-81347 7 0.759
NZ_CP015114_1 1.1|1484759|29|NZ_CP015114|CRISPRCasFinder 1484759-1484787 29 MT151386 Staphylococcus virus Twort, complete genome 123848-123876 7 0.759

1. spacer 1.1|1484759|29|NZ_CP015114|CRISPRCasFinder matches to NC_007021 (Staphylococcus phage Twort, complete genome) position: , mismatch: 7, identity: 0.759

taattattcatcaaactatatccttaatt	CRISPR spacer
aacccactcatcgaactatatccttaata	Protospacer
 * ..*.*****.*************** 

2. spacer 1.1|1484759|29|NZ_CP015114|CRISPRCasFinder matches to MT151386 (Staphylococcus virus Twort, complete genome) position: , mismatch: 7, identity: 0.759

taattattcatcaaactatatccttaatt	CRISPR spacer
aacccactcatcgaactatatccttaata	Protospacer
 * ..*.*****.*************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 81816 : 113323 32 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_2 226435 : 235576 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_3 351424 : 360001 11 Staphylococcus_phage(28.57%) transposase NA
DBSCAN-SWA_4 685238 : 754580 94 uncultured_Caudovirales_phage(43.64%) protease,holin,tRNA,plate,integrase,capsid,terminase,portal,tail attL 702981:702996|attR 754896:754911
DBSCAN-SWA_5 834183 : 920632 101 Staphylococcus_virus(45.28%) protease,holin,transposase,plate,capsid,terminase,head,portal,tail NA
DBSCAN-SWA_6 1139155 : 1148012 7 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_7 2159541 : 2220082 52 Bacillus_phage(30.0%) protease,holin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage