Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015117 Pseudomonas aeruginosa strain ATCC 27853, complete genome 5 crisprs DEDDh,PD-DExK,RT,WYL,DinG,csa3,cas3 0 1 7 3

Results visualization

1. NZ_CP015117
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015117_1 2036347-2036509 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015117_2 2787913-2788007 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015117_3 3513085-3513243 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015117_4 3943323-3943436 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015117_5 5441445-5441546 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015117_5 5.1|5441470|52|NZ_CP015117|CRISPRCasFinder 5441470-5441521 52 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63842 0 1.0

1. spacer 5.1|5441470|52|NZ_CP015117|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	CRISPR spacer
tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	Protospacer
****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1824201 : 1904342 91 Pseudomonas_virus(54.72%) holin,plate,portal,head,capsid,transposase,terminase,integrase,tail attL 1858528:1858546|attR 1908465:1908483
DBSCAN-SWA_2 2494876 : 2550012 46 Pseudomonas_phage(52.94%) tRNA,integrase,coat attL 2522323:2522339|attR 2554073:2554154
DBSCAN-SWA_3 4237649 : 4290429 55 uncultured_Caudovirales_phage(28.0%) tRNA,tail,plate NA
DBSCAN-SWA_4 4388363 : 4431750 56 Pseudomonas_phage(94.55%) transposase,integrase,head attL 4393927:4393943|attR 4397514:4397530
DBSCAN-SWA_5 4929027 : 4971636 64 Pseudomonas_phage(93.1%) lysis,protease,portal,terminase,integrase,holin attL 4926411:4926429|attR 4977553:4977571
DBSCAN-SWA_6 5014944 : 5023973 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_7 6082082 : 6151095 81 Pseudomonas_phage(65.67%) protease,head,tRNA,terminase,integrase,holin attL 6072129:6072148|attR 6113691:6113710
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP015117.1|WP_003158163.1|2315064_2315439_+|hypothetical-protein 2315064_2315439_+ 124 aa aa 27 NA NA No NA
NZ_CP015117.1|WP_003158160.1|2317180_2317573_+|hypothetical-protein 2317180_2317573_+ 130 aa aa 3 NA NA No NA
NZ_CP015117.1|WP_003158159.1|2317591_2317915_+|hypothetical-protein 2317591_2317915_+ 107 aa aa 15 NA NA No NA