1. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 7, identity: 0.781
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
ggcataatcgtcgcctgtcgaggcgatgcggg Protospacer
*.* * . ******* ****.***********
2. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 7, identity: 0.781
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gcctctgacgacgccggtcgggtcgatgccga Protospacer
* *..***** *********** ****** *.
3. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
---gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gtcggcct---ggtcgccgatctgggcgatgcggg Protospacer
*.*** *******.** ************
4. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gctgtgcccgtcgccgatcggcgcgatgcggg Protospacer
* . * ********.**** **********
5. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 8, identity: 0.75
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
ccgcttgacgtcgcgggtcgcggcgatcccga Protospacer
*********** ***** ****** * *.
6. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.75
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gcccttgacctcgccggtcgcggcggaggcgc Protospacer
* ******* ********** ****. * *
7. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to CP058906 (Micromonospora phage pMLP1, complete sequence) position: , mismatch: 8, identity: 0.75
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
ggccgcaccgccgccggtgggggcgatgcgga Protospacer
*.** .. **.******* ************.
8. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP014514 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cgccttgacgtcggcggtcgggacgacagcga Protospacer
.*********** ********.***.. *.
9. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gcgggtgaaggcgccggtcggggcgatgcata Protospacer
* *** * ******************. .
10. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
11. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
12. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
13. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
14. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
15. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
16. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
17. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
18. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
19. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
20. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
aggatcgatgttgccggtcggggcgatgccga Protospacer
.. *.**.**.***************** *.
21. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
22. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggcgtcgcgccgccgttcggggcgatgcgga Protospacer
. * * .**.***** **************.
23. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
24. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
25. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
26. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
27. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
28. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
29. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
gggatcgatgttgccggtcggggcgatgccca Protospacer
*. *.**.**.***************** .
30. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
ctgattgacgtcggcggtcgaggcgatggcaa Protospacer
********* ******.******* ..
31. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
ctgattgacgtcggcggtcgaggcgatggcaa Protospacer
********* ******.******* ..
32. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cttgttgcggtcgccggtcggggcgatggctt Protospacer
. *** *******************
33. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
ctgattgacgtcggcggtcgaggcgatggcaa Protospacer
********* ******.******* ..
34. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
35. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
ctgatcgacgttgccggtgggggcgatgccca Protospacer
*.*****.****** ********** .
36. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgacgttgccggtgggggcgatgccca Protospacer
. *.*****.****** ********** .
37. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
38. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
39. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgacgttgccggtgggggcgatgccca Protospacer
. *.*****.****** ********** .
40. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgacgttgccggtgggggcgatgccca Protospacer
. *.*****.****** ********** .
41. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgacgttgccggtgggggcgatgccca Protospacer
. *.*****.****** ********** .
42. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
43. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
44. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
45. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
46. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgacgttgccggtgggggcgatgccca Protospacer
. *.*****.****** ********** .
47. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
48. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
49. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
50. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgacgttgccggtgggggcgatgccca Protospacer
. *.*****.****** ********** .
51. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgacgttgccggtgggggcgatgccca Protospacer
. *.*****.****** ********** .
52. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgacgttgccggtgggggcgatgccca Protospacer
. *.*****.****** ********** .
53. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
54. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .
55. spacer 1.1|15262|32|NZ_CP015511|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gaccttgacgtcgccggtcggggcgatgcggg CRISPR spacer
cggatcgatgttgccggtcggggcgatgccca Protospacer
. *.**.**.***************** .