Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP011388 Paenibacillus swuensis strain DY6, complete genome 9 crisprs DEDDh,WYL,RT,DinG,csa3,cas3 0 3 4 0

Results visualization

1. NZ_CP011388
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011388_1 562952-563070 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011388_2 680028-680213 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011388_3 1760231-1760341 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011388_4 1962047-1962157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011388_5 2342721-2342907 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011388_6 2343006-2343191 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011388_7 2802096-2802170 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011388_8 2838852-2839043 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP011388_9 4772299-4772484 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NC_004041 Rhizobium etli CFN 42 plasmid p42d, complete sequence 234791-234818 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP021027 Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence 308874-308901 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013633 Rhizobium sp. N324 plasmid pRspN324c, complete sequence 309590-309617 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 320395-320422 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 341527-341554 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 263878-263905 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 301152-301179 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013561 Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence 301055-301082 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 321929-321956 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013530 Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence 289624-289651 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 297227-297254 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013540 Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence 309123-309150 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 233805-233832 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 320108-320135 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 301074-301101 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013583 Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence 289624-289651 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 302352-302379 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 303839-303866 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 321929-321956 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP021125 Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence 297944-297971 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 306402-306429 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013514 Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence 301058-301085 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 307602-307629 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 301074-301101 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 296510-296537 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013604 Rhizobium sp. N731 plasmid pRspN731c, complete sequence 301060-301087 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 305637-305664 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 245845-245872 6 0.786
NZ_CP011388_5 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder 2342744-2342771 28 NZ_CP013550 Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence 335438-335465 6 0.786
NZ_CP011388_5 5.3|2342856|28|NZ_CP011388|CRISPRCasFinder 2342856-2342883 28 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 587415-587442 6 0.786
NZ_CP011388_5 5.3|2342856|28|NZ_CP011388|CRISPRCasFinder 2342856-2342883 28 NZ_CP053224 Sphingobium sp. RSMS plasmid pRSMS1, complete sequence 131404-131431 6 0.786
NZ_CP011388_5 5.3|2342856|28|NZ_CP011388|CRISPRCasFinder 2342856-2342883 28 NC_020542 Sphingomonas sp. MM-1 plasmid pISP0, complete sequence 255515-255542 6 0.786
NZ_CP011388_6 6.1|2343029|28|NZ_CP011388|CRISPRCasFinder 2343029-2343056 28 NC_010474 Synechococcus sp. PCC 7002 plasmid pAQ7, complete sequence 161141-161168 6 0.786
NZ_CP011388_6 6.1|2343029|28|NZ_CP011388|CRISPRCasFinder 2343029-2343056 28 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 123903-123930 7 0.75
NZ_CP011388_6 6.1|2343029|28|NZ_CP011388|CRISPRCasFinder 2343029-2343056 28 NZ_CP016482 Synechococcus sp. PCC 7117 plasmid unnamed5, complete sequence 86266-86293 7 0.75

1. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NC_004041 (Rhizobium etli CFN 42 plasmid p42d, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

2. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP021027 (Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

3. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013633 (Rhizobium sp. N324 plasmid pRspN324c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

4. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

5. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

6. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

7. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

8. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

9. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

10. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

11. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

12. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

13. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

14. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

15. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

16. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

17. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

18. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

19. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

20. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

21. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

22. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

23. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

24. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

25. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

26. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

27. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

28. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

29. spacer 5.1|2342744|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcaccttgggcgaaatctcagaaa	CRISPR spacer
atcagtaccttgggcaaaatctcccgat	Protospacer
*****.*********.*******  .* 

30. spacer 5.3|2342856|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 6, identity: 0.786

ttctgggctcctgccgctcttgagcata	CRISPR spacer
gacctggctcatgccgcccttgagcata	Protospacer
  *. ***** ******.**********

31. spacer 5.3|2342856|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP053224 (Sphingobium sp. RSMS plasmid pRSMS1, complete sequence) position: , mismatch: 6, identity: 0.786

ttctgggctcctgccgctcttgagcata	CRISPR spacer
gacctggctcatgccgcccttgagcata	Protospacer
  *. ***** ******.**********

32. spacer 5.3|2342856|28|NZ_CP011388|CRISPRCasFinder matches to NC_020542 (Sphingomonas sp. MM-1 plasmid pISP0, complete sequence) position: , mismatch: 6, identity: 0.786

ttctgggctcctgccgctcttgagcata	CRISPR spacer
gacctggctcatgccgcccttgagcata	Protospacer
  *. ***** ******.**********

33. spacer 6.1|2343029|28|NZ_CP011388|CRISPRCasFinder matches to NC_010474 (Synechococcus sp. PCC 7002 plasmid pAQ7, complete sequence) position: , mismatch: 6, identity: 0.786

atcagcccctttggcgaaatctcagaaa	CRISPR spacer
atcatcccctttggcgaaatctcgctgt	Protospacer
**** ******************.  . 

34. spacer 6.1|2343029|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.75

atcagcccctttggcgaaatctcagaaa	CRISPR spacer
atcatcccctttggcaaaatctcgccgt	Protospacer
**** **********.*******.  . 

35. spacer 6.1|2343029|28|NZ_CP011388|CRISPRCasFinder matches to NZ_CP016482 (Synechococcus sp. PCC 7117 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.75

atcagcccctttggcgaaatctcagaaa	CRISPR spacer
atcatcccctttggcaaaatctcgctgt	Protospacer
**** **********.*******.  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 561009 : 572362 9 Prochlorococcus_phage(25.0%) NA NA
DBSCAN-SWA_2 1619875 : 1627424 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 3707290 : 3714013 7 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_4 4187038 : 4196356 11 Staphylococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage