1. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 1, identity: 0.963
gtgccctcaccccagccctctcccaca CRISPR spacer
gtgccctcaccccggccctctcccaca Protospacer
*************.*************
2. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 1, identity: 0.963
gtgccctcaccccagccctctcccaca CRISPR spacer
gtgccctcaccccggccctctcccaca Protospacer
*************.*************
3. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 1, identity: 0.963
gtgccctcaccccagccctctcccaca CRISPR spacer
gtgccctcaccccggccctctcccaca Protospacer
*************.*************
4. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
5. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_KT935446 (Klebsiella pneumoniae strain Kp2964 plasmid 2964TF, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
6. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccggccctctcccaca Protospacer
.************.*************
7. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
8. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
9. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
10. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
11. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
12. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
13. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccggccctctcccaca Protospacer
.************.*************
14. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccggccctctcccaca Protospacer
.************.*************
15. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccggccctctcccaca Protospacer
.************.*************
16. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
17. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
18. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
19. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
20. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
21. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP019841 (Enterobacter roggenkampii strain R11 plasmid pASM2, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
22. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
23. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP010365 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-70.092kb, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
24. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
25. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
26. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP017452 (Klebsiella sp. LTGPAF-6F plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
27. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
28. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 2, identity: 0.926
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccaaccctctcccaca Protospacer
.*************.************
29. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 3, identity: 0.889
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccgaccctctcccaca Protospacer
.************..************
30. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.889
gtgccctcaccccagccctctcccaca CRISPR spacer
tttccctcaccccatccctctcccaca Protospacer
* *********** ************
31. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
atgccctcaccccgaccctctcccacg Protospacer
.************..***********.
32. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
tggccctcacccccgccctctcccgca Protospacer
*********** **********.**
33. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
tggccctcacccctgccctctcccgca Protospacer
*********** **********.**
34. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
tggccctcacccctgccctctcccgca Protospacer
*********** **********.**
35. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
tggccctcacccctgccctctcccgca Protospacer
*********** **********.**
36. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
tggccctcacccctgccctctcccgca Protospacer
*********** **********.**
37. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
tggccctcacccctgccctctcccgca Protospacer
*********** **********.**
38. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
tggccctcacccctgccctctcccgca Protospacer
*********** **********.**
39. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
cagccctcaccccaaccctctcccgca Protospacer
************.*********.**
40. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
gatccctcaccccaaccctctcccgca Protospacer
* ***********.*********.**
41. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP035936 (Acinetobacter cumulans strain WCHAc060092 plasmid p1_060092, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
aagccctcactccaaccctctcccaca Protospacer
. ********.***.************
42. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
gtgc-cctcaccccagccctctcccaca CRISPR spacer
-tgcgcctcaccccagccctctccccgc Protospacer
*** ********************
43. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
ttcccctcaccccaaccctctcccaaa Protospacer
* ***********.********** *
44. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 4, identity: 0.852
gtgccctcaccccagccctctcccaca CRISPR spacer
gccccctcaccccggccctctccccca Protospacer
*. **********.********** **
45. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ttcccctcaccccggccctctccccaa Protospacer
* **********.********** *
46. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctcacccctgccctctcccgca Protospacer
********** **********.**
47. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
48. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
49. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
50. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
51. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
52. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
53. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
54. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
55. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
56. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
57. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
58. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
gccccctcaccccagccctctccccgg Protospacer
*. ********************* .
59. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
60. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctagccctctccccgt Protospacer
***********.***********
61. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
tcaccctctccccagccctctcccacc Protospacer
..***** *****************
62. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
gccccctctccccggccctctcccacg Protospacer
*. ***** ****.************.
63. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
gccccctctccccggccctctcccacg Protospacer
*. ***** ****.************.
64. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
gccccctctccccggccctctcccacg Protospacer
*. ***** ****.************.
65. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ttgcccccaccccggccctctcccgct Protospacer
*****.******.**********.*
66. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
atgcccccaccccagccctcccccgcc Protospacer
.*****.*************.***.*
67. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ttgcccccaccccagccctcccccgct Protospacer
*****.*************.***.*
68. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ttgcccccaccccagccctcccccgct Protospacer
*****.*************.***.*
69. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP024150 (Escherichia coli strain 14EC033 plasmid p14EC033c, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ttcccctcaccctacccctctcccact Protospacer
* *********.* ***********
70. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ttgcccccaccccagccctcccccgcc Protospacer
*****.*************.***.*
71. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
gtgccctcaccccagccctctcccaca CRISPR spacer
ttgcccccaccccagccctcccccgct Protospacer
*****.*************.***.*
72. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccccggccctctccccaa Protospacer
**********.********** *
73. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccccggccctctccccaa Protospacer
**********.********** *
74. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccccggccctctccccaa Protospacer
**********.********** *
75. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccagccctctccccag Protospacer
.. ********************* .
76. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctcaccccagccctctccccgc Protospacer
*********************
77. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
cccccctcaccccagccctctccccag Protospacer
. ********************* .
78. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccccagccctctccccgc Protospacer
*********************
79. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccagccctctccccag Protospacer
.. ********************* .
80. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctcaccccagccctctccccgc Protospacer
*********************
81. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccccagccctctccccgc Protospacer
*********************
82. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctctccccagccctctcccatg Protospacer
***** ****************..
83. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_022739 (Pseudomonas sp. VLB120 plasmid pSTY, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctctccccagccctctcccatg Protospacer
***** ****************..
84. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
ctgccctcaccctaaccctctccccgc Protospacer
***********.*.*********
85. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctcccgta Protospacer
*********.***********..*
86. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgtccctcaccccagccttctcccgcg Protospacer
**************.******.*.
87. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
ggcccctcaccctagccctctccccgt Protospacer
* *********.***********
88. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctcccgta Protospacer
*********.***********..*
89. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctcccgta Protospacer
*********.***********..*
90. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctcccgta Protospacer
*********.***********..*
91. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctcccgta Protospacer
*********.***********..*
92. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
ttcccctcaccccggccctctccccgg Protospacer
* **********.********** .
93. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to MF417867 (Uncultured Caudovirales phage clone 3F_7, partial genome) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
agcccctcaccctagccctctcccgaa Protospacer
. *********.***********. *
94. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 6, identity: 0.778
gtgccctcaccccagccctctcccaca CRISPR spacer
ttcccctcaccccggccctctccccgg Protospacer
* **********.********** .
95. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccctagccctctccccgg Protospacer
. *********.*********** .
96. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
97. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
agcccctcaccccaaccctctccccgc Protospacer
. ***********.*********
98. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccgg Protospacer
.. ***********.********* .
99. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccgg Protospacer
.. ***********.********* .
100. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctcccggg Protospacer
.. ***********.*********. .
101. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgg Protospacer
*********.*********** .
102. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
103. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
104. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
105. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctcaccctagccctctccccgc Protospacer
*********.***********
106. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccaaccctctccccag Protospacer
. ***********.********* .
107. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
108. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
cccccctcaccctagccctctccccgg Protospacer
. *********.*********** .
109. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccgc Protospacer
.. ***********.*********
110. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
cccccctcaccccaaccctctccccgg Protospacer
. ***********.********* .
111. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctcaccccaaccctctccccgc Protospacer
***********.*********
112. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
113. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
114. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
115. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
116. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
actccctcaccccggccctctccccag Protospacer
.. **********.********** .
117. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccgc Protospacer
.. ***********.*********
118. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
119. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
120. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
121. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
122. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
123. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
124. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
125. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccaaccctctccccgg Protospacer
. ***********.********* .
126. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccggccctctccccgg Protospacer
. **********.********** .
127. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
128. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
129. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccggccctctccccgg Protospacer
. **********.********** .
130. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
131. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
132. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_013545 (Sinorhizobium meliloti plasmid pSmeSM11a, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
agcccctcaccctagccctctccccgc Protospacer
. *********.***********
133. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
134. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
135. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccaaccctctccccag Protospacer
. ***********.********* .
136. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccag Protospacer
.. ***********.********* .
137. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccag Protospacer
.. ***********.********* .
138. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccaaccctctccccag Protospacer
. ***********.********* .
139. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
140. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
141. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
142. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
143. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
144. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
145. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
146. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
147. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
148. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
149. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
150. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
151. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccggccctctccccag Protospacer
. **********.********** .
152. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccaaccctctccccgg Protospacer
. ***********.********* .
153. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccctagccctctccccgg Protospacer
. *********.*********** .
154. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
155. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
156. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
157. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
158. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccag Protospacer
.. ***********.********* .
159. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccaaccctctccccag Protospacer
. ***********.********* .
160. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccag Protospacer
.. ***********.********* .
161. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccaaccctctccccag Protospacer
. ***********.********* .
162. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccaaccctctccccgg Protospacer
. ***********.********* .
163. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
164. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
165. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
166. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
cccccctcaccccaaccctctccccag Protospacer
. ***********.********* .
167. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccaaccctctccccgg Protospacer
. ***********.********* .
168. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
169. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
170. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccag Protospacer
.. ***********.********* .
171. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccag Protospacer
.. ***********.********* .
172. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
173. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
174. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctcaccctagccctctccccgc Protospacer
*********.***********
175. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
176. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
177. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tccccctcaccccggccctctccccgg Protospacer
. **********.********** .
178. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
179. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctcaccctagccctctccccgc Protospacer
*********.***********
180. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
181. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgt Protospacer
*********.***********
182. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
183. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
184. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
185. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
186. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP021215 (Sinorhizobium meliloti RU11/001 plasmid pSmeRU11c, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
agcccctcaccctagccctctccccgc Protospacer
. *********.***********
187. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
cccccctcaccccggccctctccccgg Protospacer
. **********.********** .
188. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccgg Protospacer
.. ***********.********* .
189. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
accccctcaccccaaccctctccccag Protospacer
.. ***********.********* .
190. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
191. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
192. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
193. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
tgcccctcaccctagccctctccccgc Protospacer
*********.***********
194. spacer 7.1|4275739|27|NZ_CP015774|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.741
gtgccctcaccccagccctctcccaca CRISPR spacer
cgcccctcaccccagccgtctccccgc Protospacer
************** ******