Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 0 crisprs WYL 0 0 0 0
NZ_CP015736 Shinella sp. HZN7 chromosome, complete genome 4 crisprs csa3,cas9,cas1,cas2,WYL,DEDDh 0 15 6 0
NZ_CP015745 Shinella sp. HZN7 plasmid pShin-09, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP015741 Shinella sp. HZN7 plasmid pShin-05, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP015740 Shinella sp. HZN7 plasmid pShin-04, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP015746 Shinella sp. HZN7 plasmid pShin-10, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP015742 Shinella sp. HZN7 plasmid pShin-06, complete sequence 0 crisprs csa3,DEDDh 0 0 1 0
NZ_CP015748 Shinella sp. HZN7 plasmid pShin-12, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP015743 Shinella sp. HZN7 plasmid pShin-07, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 2 crisprs DEDDh,csa3 0 2 0 0
NZ_CP015747 Shinella sp. HZN7 plasmid pShin-11, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP015744 Shinella sp. HZN7 plasmid pShin-08, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP015742
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 71372 : 134019 50 Salmonella_phage(15.38%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP015743
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 113907 : 125379 11 Stx2-converting_phage(25.0%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP015745
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 50939 : 107011 41 Lactococcus_phage(23.08%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP015736
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015736_1 972268-973293 TypeII NA
15 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015736_2 1121713-1121812 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015736_3 2032348-2032967 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015736_4 2089142-2089239 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1199529-1199558 5 0.833
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2565167-2565196 5 0.833
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NZ_AP014802 Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351 81430-81459 5 0.833
NZ_CP015736_1 1.2|972370|30|NZ_CP015736|CRISPRCasFinder,CRT 972370-972399 30 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 113311-113340 6 0.8
NZ_CP015736_1 1.6|972634|30|NZ_CP015736|CRISPRCasFinder,CRT 972634-972663 30 NC_020543 Sphingomonas sp. MM-1 plasmid pISP2, complete sequence 40983-41012 6 0.8
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 KT809302 Haloarcula californiae icosahedral virus 1, complete genome 17429-17458 6 0.8
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 271986-272015 6 0.8
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 214680-214709 6 0.8
NZ_CP015736_1 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973096-973125 30 NZ_CP010886 Vibrio parahaemolyticus strain CHN25 plasmid P2, complete sequence 63887-63916 6 0.8
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NZ_CP030100 Roseovarius sp. AK1035 plasmid unnamed, complete sequence 141449-141478 6 0.8
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NZ_CP045385 Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence 181773-181802 6 0.8
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NZ_CP020475 Roseovarius mucosus strain SMR3 plasmid pSMR3-1, complete sequence 135343-135372 6 0.8
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 MT657339 Gordonia phage SpeedDemon, complete genome 81672-81701 6 0.8
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NC_031074 Gordonia phage Bantam, complete genome 78578-78607 6 0.8
NZ_CP015736_1 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT 972304-972333 30 KX657793 Mycobacterium phage DarthPhader, complete genome 48364-48393 7 0.767
NZ_CP015736_1 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT 972304-972333 30 NZ_CP010856 Marinovum algicola DG 898 plasmid pMaD1, complete sequence 36397-36426 7 0.767
NZ_CP015736_1 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT 972304-972333 30 NZ_CP018081 Sulfitobacter sp. AM1-D1 plasmid unnamed5, complete sequence 230639-230668 7 0.767
NZ_CP015736_1 1.2|972370|30|NZ_CP015736|CRISPRCasFinder,CRT 972370-972399 30 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 248712-248741 7 0.767
NZ_CP015736_1 1.5|972568|30|NZ_CP015736|CRISPRCasFinder,CRT 972568-972597 30 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 79267-79296 7 0.767
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NC_014753 Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence 52837-52866 7 0.767
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 83099-83128 7 0.767
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 KY555145 Caulobacter phage Ccr29, complete genome 49406-49435 7 0.767
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 KY555143 Caulobacter phage Ccr2, complete genome 44873-44902 7 0.767
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NC_019407 Caulobacter phage CcrMagneto, complete genome 43665-43694 7 0.767
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 KY555142 Caulobacter phage Ccr10, complete genome 44398-44427 7 0.767
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NC_019411 Caulobacter phage CcrSwift, complete genome 43627-43656 7 0.767
NZ_CP015736_1 1.8|972766|30|NZ_CP015736|CRISPRCasFinder,CRT 972766-972795 30 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 7722-7751 7 0.767
NZ_CP015736_1 1.8|972766|30|NZ_CP015736|CRISPRCasFinder,CRT 972766-972795 30 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 240380-240409 7 0.767
NZ_CP015736_1 1.9|972832|30|NZ_CP015736|CRISPRCasFinder,CRT 972832-972861 30 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 380306-380335 7 0.767
NZ_CP015736_1 1.11|972964|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972964-972993 30 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 2450-2479 7 0.767
NZ_CP015736_1 1.12|973030|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973030-973059 30 NZ_CP030242 Moraxella bovis strain Epp63 (300) plasmid pMBO-1, complete sequence 3225-3254 7 0.767
NZ_CP015736_1 1.12|973030|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973030-973059 30 NC_010893 Moraxella bovis Epp63 plasmid pMBO-1, complete sequence 3224-3253 7 0.767
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 105654-105683 7 0.767
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 117580-117609 7 0.767
NZ_CP015736_1 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT 972304-972333 30 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 416492-416521 8 0.733
NZ_CP015736_1 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT 972304-972333 30 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 812591-812620 8 0.733
NZ_CP015736_1 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT 972304-972333 30 MN317029 Aeromonas phage vB_AhyS-A18P4, complete genome 2694-2723 8 0.733
NZ_CP015736_1 1.3|972436|30|NZ_CP015736|CRISPRCasFinder,CRT 972436-972465 30 MF919515 Propionibacterium phage Leviosa, complete genome 8466-8495 8 0.733
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NZ_CP042998 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence 97692-97721 8 0.733
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 84559-84588 8 0.733
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NZ_CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 132042-132071 8 0.733
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NC_007431 Streptomyces venezuelae pSVH1 plasmid 11724-11753 8 0.733
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 259258-259287 8 0.733
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 MG962371 Mycobacterium phage LaterM, complete genome 6818-6847 8 0.733
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 KM677211 Mycobacterium phage Murucutumbu, complete genome 6812-6841 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 637349-637378 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 CP026798 Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence 8555-8584 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 CP026844 Shigella boydii strain NCTC 9733 plasmid unnamed, complete sequence 6411-6440 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026767 Shigella boydii strain 59-248 plasmid unnamed 141887-141916 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026813 Shigella boydii strain 83-578 plasmid unnamed, complete sequence 85792-85821 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026794 Shigella flexneri strain 74-1170 plasmid unnamed 29995-30024 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP033511 Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence 215190-215219 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026099 Shigella flexneri strain FDAARGOS_74 plasmid unnamed 147447-147476 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026812 Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence 37322-37351 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026826 Shigella dysenteriae strain ATCC 12021 plasmid unnamed 184184-184213 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 CP046677 Escherichia coli strain 152661 plasmid p152661_pINV, complete sequence 132631-132660 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NC_017319 Shigella flexneri 2002017 plasmid pSFxv_1, complete sequence 88859-88888 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP012142 Shigella flexneri 4c strain 1205 plasmid 1205p2, complete sequence 87525-87554 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026800 Shigella flexneri strain NCTC 9728 plasmid unnamed, complete sequence 28373-28402 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NC_002698 Shigella flexneri 5a virulence plasmid pWR501, complete sequence 83444-83473 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP011417 Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence 253600-253629 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP007038 Shigella flexneri G1663 plasmid pG1663, complete sequence 89383-89412 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP030773 Shigella flexneri 1c strain Y394 plasmid pINV-Y394, complete sequence 87063-87092 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP020087 Shigella flexneri 1a strain 0670 plasmid unnamed1, complete sequence 185472-185501 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP050866 Escherichia coli strain 8-3-Ti3 plasmid unnamed1, complete sequence 115177-115206 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP050863 Escherichia coli strain 8-3-DC15 plasmid unnamed1, complete sequence 115176-115205 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP020337 Shigella flexneri 4c strain 1602 plasmid unnamed1, complete sequence 53016-53045 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NC_010660 Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence 40262-40291 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP045942 Shigella flexneri 2a strain AUSMDU00010535 plasmid pAUSMDU00010535_01, complete sequence 106100-106129 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NC_004851 Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence 90200-90229 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 CP054891 Shigella flexneri strain FDAARGOS_713 plasmid unnamed1, complete sequence 84379-84408 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026804 Shigella flexneri strain 89-141 plasmid unnamed1 43036-43065 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP034059 Shigella flexneri strain FDAARGOS_535 plasmid unnamed1, complete sequence 167410-167439 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP024476 Shigella flexneri 7b strain 94-3007 plasmid unnamed3, complete sequence 196370-196399 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_LR213456 Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 2 72580-72609 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026771 Shigella flexneri Y strain 93-3063 plasmid unnamed3, complete sequence 24803-24832 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP044157 Shigella flexneri strain AR-0424 plasmid pAR-0424-2, complete sequence 201312-201341 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026763 Shigella boydii strain NCTC 9850 plasmid unnamed 96842-96871 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026876 Shigella boydii strain ATCC 35964 plasmid unnamed, complete sequence 90613-90642 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026837 Shigella boydii strain ATCC 49812 plasmid unnamed, complete sequence 110120-110149 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026796 Shigella boydii strain ATCC BAA-1247 plasmid unnamed 148864-148893 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP044154 Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence 218320-218349 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP034933 Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-2, complete sequence 35573-35602 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP037924 Shigella flexneri 5a str. M90T plasmid pWR100, complete sequence 5825-5854 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP037924 Shigella flexneri 5a str. M90T plasmid pWR100, complete sequence 219316-219345 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NC_007608 Shigella boydii Sb227 plasmid pSB4_227, complete sequence 35651-35680 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP041512 Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence 80544-80573 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP027028 Shigella dysenteriae strain E670/74 plasmid unnamed, complete sequence 43804-43833 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NC_019197 Shigella flexneri plasmid pSF5, complete sequence 86901-86930 8 0.733
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP026830 Shigella dysenteriae strain ATCC 12039 plasmid unnamed, complete sequence 16357-16386 8 0.733
NZ_CP015736_1 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973096-973125 30 NC_013448 Nocardia aobensis plasmid pYS1, complete sequence 2694-2723 8 0.733
NZ_CP015736_1 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973096-973125 30 NC_017791 Deinococcus gobiensis I-0 plasmid P2, complete sequence 81824-81853 8 0.733
NZ_CP015736_1 1.14|973162|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973162-973191 30 NC_015708 Pseudoalteromonas sp. SANK 73390 plasmid pTML1 carrying thiomarinol biosynthesis cluster 68936-68965 8 0.733
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1221719-1221748 8 0.733
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 258336-258365 8 0.733
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 JX403939 Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome 28600-28629 8 0.733
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NC_042342 Pseudomonas virus H66, complete genome 16240-16269 8 0.733
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 KU310943 Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome 43899-43928 8 0.733
NZ_CP015736_1 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT 972304-972333 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 806585-806614 9 0.7
NZ_CP015736_1 1.3|972436|30|NZ_CP015736|CRISPRCasFinder,CRT 972436-972465 30 NC_022050 Paracoccus aminophilus JCM 7686 plasmid pAMI8, complete sequence 53110-53139 9 0.7
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 844725-844754 9 0.7
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 446494-446523 9 0.7
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 103750-103779 9 0.7
NZ_CP015736_1 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT 972700-972729 30 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 59059-59088 9 0.7
NZ_CP015736_1 1.9|972832|30|NZ_CP015736|CRISPRCasFinder,CRT 972832-972861 30 NZ_CP041074 Bacillus tropicus strain LM1212-W3 plasmid p1, complete sequence 865-894 9 0.7
NZ_CP015736_1 1.9|972832|30|NZ_CP015736|CRISPRCasFinder,CRT 972832-972861 30 NZ_CP024774 Bacillus thuringiensis LM1212 plasmid pLM3, complete sequence 68855-68884 9 0.7
NZ_CP015736_1 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973096-973125 30 NC_017771 Deinococcus gobiensis I-0 plasmid P3, complete sequence 172053-172082 9 0.7
NZ_CP015736_1 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973096-973125 30 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 20088-20117 9 0.7
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 197985-198014 9 0.7
NZ_CP015736_1 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 972898-972927 30 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 85439-85468 10 0.667
NZ_CP015736_1 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR 973228-973257 30 MK524524 Streptomyces phage Caelum, complete genome 11839-11868 10 0.667
NZ_CP015736_3 3.5|2032638|40|NZ_CP015736|CRISPRCasFinder 2032638-2032677 40 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 163068-163107 11 0.725

1. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.833 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
cctgatctcgcgcagcggcgtgccggccgg	Protospacer
  .************ ******.*******

2. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 5, identity: 0.833 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
cctgatctcgcgcagcggcgtgccggccgg	Protospacer
  .************ ******.*******

3. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014802 (Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351) position: , mismatch: 5, identity: 0.833 

gacgatctcgcgcaggggcgtgtcggccgg--	CRISPR spacer
gccgatctcgcccaggggcgtgt--gccagcc	Protospacer
* ********* ***********  ***.*

4. spacer 1.2|972370|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.8 

ttcggatgccgccccgtggcggggcggtca	CRISPR spacer
ggccgatgccgccgcctggcggggcggtga	Protospacer
  * ********* * ************ *

5. spacer 1.6|972634|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_020543 (Sphingomonas sp. MM-1 plasmid pISP2, complete sequence) position: , mismatch: 6, identity: 0.8 

acttcgctctgaaggttcgcctgagactgc	CRISPR spacer
acttcgctctcaagcttcgcctgggcccga	Protospacer
********** *** ********.* *.*

6. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to KT809302 (Haloarcula californiae icosahedral virus 1, complete genome) position: , mismatch: 6, identity: 0.8 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
ggagacggcggcctcctcggcggcgacata	Protospacer
...***** ***************** **

7. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 6, identity: 0.8 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
gatgacgcgggccccctcggcggcgaaacg	Protospacer
.* **** *****.**************.

8. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.8 

aaggacgggggcctcctcggcggcgaaatc---	CRISPR spacer
aaggccgggggcctcct---cggcgagctcccg	Protospacer
**** ************   ******. **

9. spacer 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010886 (Vibrio parahaemolyticus strain CHN25 plasmid P2, complete sequence) position: , mismatch: 6, identity: 0.8 

--aacaatgagggcgcggccttctgggagcac	CRISPR spacer
ccacca--gaaggggcggccttctgggagcaa	Protospacer
  * **  **.** *****************

10. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030100 (Roseovarius sp. AK1035 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
ggcgatctcgcgcagcggcttgtcggaatg	Protospacer
*.************* *** ******   *

11. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 6, identity: 0.8 

---gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
ttggtcgg---cgcgcaggggcgtgtcggcggg	Protospacer
   * **.   ******************* **

12. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020475 (Roseovarius mucosus strain SMR3 plasmid pSMR3-1, complete sequence) position: , mismatch: 6, identity: 0.8 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
ggcgatctcgcgcagcggcttgtcggaatg	Protospacer
*.************* *** ******   *

13. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to MT657339 (Gordonia phage SpeedDemon, complete genome) position: , mismatch: 6, identity: 0.8 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
ggagatggtgcgcaggggcgagtcggccgg	Protospacer
*. ***  .*********** *********

14. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_031074 (Gordonia phage Bantam, complete genome) position: , mismatch: 6, identity: 0.8 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
ggagatggtgcgcaggggcgagtcggccgg	Protospacer
*. ***  .*********** *********

15. spacer 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT matches to KX657793 (Mycobacterium phage DarthPhader, complete genome) position: , mismatch: 7, identity: 0.767 

caactcgccttcgagcgcctggatacggcg	CRISPR spacer
gaagtcgccttcgagcgcctggatcgagta	Protospacer
 ** ********************  .*..

16. spacer 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP010856 (Marinovum algicola DG 898 plasmid pMaD1, complete sequence) position: , mismatch: 7, identity: 0.767 

caactcgccttcgagcgcctggatacggcg	CRISPR spacer
catgacgccttcgagcacctggatatggtc	Protospacer
**   ***********.********.**.

17. spacer 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP018081 (Sulfitobacter sp. AM1-D1 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767 

caactcgccttcgagcgcctggatacggcg	CRISPR spacer
catgacgccttcgagcacctggatatggtc	Protospacer
**   ***********.********.**.

18. spacer 1.2|972370|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

ttcggatgccgccccgtggc-ggggcggtca	CRISPR spacer
cgaggatcccgccccgtggcgggggcgatt-	Protospacer
.  **** ************ ******.*.

19. spacer 1.5|972568|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.767 

ggtggaaaggctgaacatgctgtctcctaa	CRISPR spacer
ggtggaaagcctgaacgtgctgtcctcgcc	Protospacer
********* ******.*******..*

20. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 7, identity: 0.767 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
gacctcgggggcctcctcggcggtgaacgc	Protospacer
.*   ******************.***  *

21. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 7, identity: 0.767 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
agtgacgggggcgtcgtcggcggcgaggcc	Protospacer
*. ********* ** **********...*

22. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 7, identity: 0.767 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
ggcgacggcgggctcctcggcggcgacgtc	Protospacer
.. ***** ** ************** .**

23. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 7, identity: 0.767 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
ggcgacggcgggctcctcggcggcgacgtc	Protospacer
.. ***** ** ************** .**

24. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 7, identity: 0.767 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
ggcgacggcgggctcctcggcggcgacgtc	Protospacer
.. ***** ** ************** .**

25. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 7, identity: 0.767 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
ggcgacggcgggctcctcggcggcgacgtc	Protospacer
.. ***** ** ************** .**

26. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 7, identity: 0.767 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
ggcgacggcgggctcctcggcggcgacgtc	Protospacer
.. ***** ** ************** .**

27. spacer 1.8|972766|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 7, identity: 0.767 

cgggcgagcgagcaatcgctgcggccctcg	CRISPR spacer
ggggcgagggagcaatcgctgccgccgatc	Protospacer
 ******* ************* ***  .

28. spacer 1.8|972766|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgggcgagcgagcaatcgctgcggccctcg	CRISPR spacer
ggaggcggcgcgccatcgctgcggccctcg	Protospacer
 *.*  .*** ** ****************

29. spacer 1.9|972832|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 7, identity: 0.767 

ggttccaccatcgccaataggctggccctt	CRISPR spacer
atcctcaccatcgcccataggctggccctg	Protospacer
. ...********** *************

30. spacer 1.11|972964|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.767 

aaggtgaacgtcactgggacgcgcaactgg	CRISPR spacer
aaggtggacgtcactgggacggtcgacgtc	Protospacer
******.**************  *.**

31. spacer 1.12|973030|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030242 (Moraxella bovis strain Epp63 (300) plasmid pMBO-1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgggttttcattgatagtctctcctggtgc	CRISPR spacer
tgggttttcattaatagtctcttttgtgtc	Protospacer
.***********.*********..**   *

32. spacer 1.12|973030|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_010893 (Moraxella bovis Epp63 plasmid pMBO-1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgggttttcattgatagtctctcctggtgc	CRISPR spacer
tgggttttcattaatagtctcttttgtgtc	Protospacer
.***********.*********..**   *

33. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 7, identity: 0.767 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
gtcgatctcgcgcagggccgtgtagggatc	Protospacer
* *************** ***** **

34. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 7, identity: 0.767 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
ctcgatctcgcccagcggcgtgtcgtcgcg	Protospacer
  ********* *** ********* *  *

35. spacer 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 8, identity: 0.733 

caactcgccttcgagcgcctggatacggcg	CRISPR spacer
catctcgccttcgagcgcgtggagctctgg	Protospacer
** *************** ****  .   *

36. spacer 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.733 

caactcgccttcgagcgcctggatacggcg	CRISPR spacer
cacctcgccttcgagcgcgtggagctctgg	Protospacer
** *************** ****  .   *

37. spacer 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT matches to MN317029 (Aeromonas phage vB_AhyS-A18P4, complete genome) position: , mismatch: 8, identity: 0.733 

caactcgccttcgagcgcctggatacggcg	CRISPR spacer
aaactcgcctttgagcgcccggatcttggt	Protospacer
 **********.*******.**** . *

38. spacer 1.3|972436|30|NZ_CP015736|CRISPRCasFinder,CRT matches to MF919515 (Propionibacterium phage Leviosa, complete genome) position: , mismatch: 8, identity: 0.733 

tccccgccacaagcacggacacgggcgggg	CRISPR spacer
accccgccactagcacggacacgcgtcaaa	Protospacer
 ********* ************ *. ...

39. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 8, identity: 0.733 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
ccggacgggggcctcgccggcggcgaggcg	Protospacer
  ************* .*********...

40. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.733 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
atcgacgggggcctactcgacggcgagcat	Protospacer
*  *********** ****.******.  .

41. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
cggcggcggggcttcatcggcggcgaaatc	Protospacer
 .* .  *****.** **************

42. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_007431 (Streptomyces venezuelae pSVH1 plasmid) position: , mismatch: 8, identity: 0.733 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
cccggcggcggcctcctcggcggcgacctt	Protospacer
   *.*** *****************  *.

43. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
cagcggcacggcctcctcgccggcgaaatc	Protospacer
 ** .  . ********** **********

44. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to MG962371 (Mycobacterium phage LaterM, complete genome) position: , mismatch: 8, identity: 0.733 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
cccgttggtggcgtcctcggcggcgaaata	Protospacer
   * .** *** ****************

45. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to KM677211 (Mycobacterium phage Murucutumbu, complete genome) position: , mismatch: 8, identity: 0.733 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
cccgttggtggcgtcctcggcggcgaaata	Protospacer
   * .** *** ****************

46. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tatcagatcgacgaaaagggcgttggcccg	Protospacer
*.********* ********* *** ..

47. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to CP026798 (Shigella boydii strain NCTC 9353 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

48. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to CP026844 (Shigella boydii strain NCTC 9733 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

49. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026767 (Shigella boydii strain 59-248 plasmid unnamed) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

50. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026813 (Shigella boydii strain 83-578 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

51. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026794 (Shigella flexneri strain 74-1170 plasmid unnamed) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

52. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033511 (Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

53. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026099 (Shigella flexneri strain FDAARGOS_74 plasmid unnamed) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

54. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026812 (Shigella flexneri strain 64-5500 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

55. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026826 (Shigella dysenteriae strain ATCC 12021 plasmid unnamed) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

56. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to CP046677 (Escherichia coli strain 152661 plasmid p152661_pINV, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

57. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_017319 (Shigella flexneri 2002017 plasmid pSFxv_1, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

58. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012142 (Shigella flexneri 4c strain 1205 plasmid 1205p2, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

59. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026800 (Shigella flexneri strain NCTC 9728 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

60. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_002698 (Shigella flexneri 5a virulence plasmid pWR501, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

61. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011417 (Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

62. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007038 (Shigella flexneri G1663 plasmid pG1663, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

63. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030773 (Shigella flexneri 1c strain Y394 plasmid pINV-Y394, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

64. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020087 (Shigella flexneri 1a strain 0670 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

65. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050866 (Escherichia coli strain 8-3-Ti3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

66. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050863 (Escherichia coli strain 8-3-DC15 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

67. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020337 (Shigella flexneri 4c strain 1602 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

68. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_010660 (Shigella boydii CDC 3083-94 plasmid pBS512_211, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

69. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045942 (Shigella flexneri 2a strain AUSMDU00010535 plasmid pAUSMDU00010535_01, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

70. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_004851 (Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

71. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to CP054891 (Shigella flexneri strain FDAARGOS_713 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

72. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026804 (Shigella flexneri strain 89-141 plasmid unnamed1) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

73. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034059 (Shigella flexneri strain FDAARGOS_535 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

74. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024476 (Shigella flexneri 7b strain 94-3007 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

75. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR213456 (Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 2) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

76. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026771 (Shigella flexneri Y strain 93-3063 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

77. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044157 (Shigella flexneri strain AR-0424 plasmid pAR-0424-2, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

78. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026763 (Shigella boydii strain NCTC 9850 plasmid unnamed) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

79. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026876 (Shigella boydii strain ATCC 35964 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

80. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026837 (Shigella boydii strain ATCC 49812 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

81. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026796 (Shigella boydii strain ATCC BAA-1247 plasmid unnamed) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

82. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044154 (Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

83. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034933 (Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-2, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

84. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037924 (Shigella flexneri 5a str. M90T plasmid pWR100, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

85. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037924 (Shigella flexneri 5a str. M90T plasmid pWR100, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

86. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_007608 (Shigella boydii Sb227 plasmid pSB4_227, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

87. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041512 (Shigella boydii strain KCCM 41690 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

88. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027028 (Shigella dysenteriae strain E670/74 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

89. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_019197 (Shigella flexneri plasmid pSF5, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

90. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026830 (Shigella dysenteriae strain ATCC 12039 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
tgtcatttcgaggaaaagggcttggcgcgg	Protospacer
*****  **************** *. ..

91. spacer 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_013448 (Nocardia aobensis plasmid pYS1, complete sequence) position: , mismatch: 8, identity: 0.733 

aacaatgagggcgcggccttctgggagcac	CRISPR spacer
gacaacgagggcgcggcctgctggttcatc	Protospacer
.****.************* ****     *

92. spacer 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_017791 (Deinococcus gobiensis I-0 plasmid P2, complete sequence) position: , mismatch: 8, identity: 0.733 

aacaatgagggcgcggccttctgggagcac	CRISPR spacer
gccggggagggcgcggtcttctgggtgcag	Protospacer
. *.. **********.******** ***

93. spacer 1.14|973162|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_015708 (Pseudoalteromonas sp. SANK 73390 plasmid pTML1 carrying thiomarinol biosynthesis cluster) position: , mismatch: 8, identity: 0.733 

aaaatgagtaccgtcgagttctgccaaaat	CRISPR spacer
aaaatgagtgccgtcgagttccgttaccga	Protospacer
*********.***********.*..*  .

94. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.733 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
ctcgatgtcgcgcaggcgcgtgtcgccgtc	Protospacer
  **** ********* ******** *

95. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 8, identity: 0.733 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
ccacatctggcgcaggggcgtggcggctgc	Protospacer
    **** ************* ****.*

96. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to JX403939 (Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome) position: , mismatch: 8, identity: 0.733 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
gcgagcgtcgcgcaggggcttgtcggccag	Protospacer
*  ... ************ ********.*

97. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_042342 (Pseudomonas virus H66, complete genome) position: , mismatch: 8, identity: 0.733 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
gcgagcgtcgcgcaggggcttgtcggccag	Protospacer
*  ... ************ ********.*

98. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to KU310943 (Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome) position: , mismatch: 8, identity: 0.733 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
gcgagcgtcgcgcaggggcttgtcggccag	Protospacer
*  ... ************ ********.*

99. spacer 1.1|972304|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.7 

caactcgccttcgagcgcctggatacggcg	CRISPR spacer
acggaaaccttcgagcgcctggacgcggcg	Protospacer
  .   .****************..*****

100. spacer 1.3|972436|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_022050 (Paracoccus aminophilus JCM 7686 plasmid pAMI8, complete sequence) position: , mismatch: 9, identity: 0.7 

tccccgccacaagcacggacacgggcgggg	CRISPR spacer
gccccgccacaagcacggccacaatccaat	Protospacer
 ***************** ***.. * ..

101. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.7 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
cttctcgggggcctccccggcggcgaaggg	Protospacer
     ***********.**********.

102. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.7 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
cttctcgggggcctccccggcggcgaaggg	Protospacer
     ***********.**********.

103. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.7 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
cttctcgggggcctccccggcggcgaaggg	Protospacer
     ***********.**********.

104. spacer 1.7|972700|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7 

aaggacgggggcctcctcggcggcgaaatc	CRISPR spacer
gttcgcgagggccttctcggcggcgaaaat	Protospacer
.   .**.******.************* .

105. spacer 1.9|972832|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP041074 (Bacillus tropicus strain LM1212-W3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7 

ggttccaccatcgccaataggctggccctt	CRISPR spacer
tgatccaccaccgccaataggctgaaataa	Protospacer
 * *******.*************.  .

106. spacer 1.9|972832|30|NZ_CP015736|CRISPRCasFinder,CRT matches to NZ_CP024774 (Bacillus thuringiensis LM1212 plasmid pLM3, complete sequence) position: , mismatch: 9, identity: 0.7 

ggttccaccatcgccaataggctggccctt	CRISPR spacer
tgatccaccaccgccaataggctgaaataa	Protospacer
 * *******.*************.  .

107. spacer 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_017771 (Deinococcus gobiensis I-0 plasmid P3, complete sequence) position: , mismatch: 9, identity: 0.7 

aacaatgagggcgcggccttctgggagcac	CRISPR spacer
cacactgagggcgcggccttctaccgtagc	Protospacer
 *** *****************.  .  .*

108. spacer 1.13|973096|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 9, identity: 0.7 

aacaatgagggcgcggccttctgggagcac	CRISPR spacer
gttcccgagggcgcggccttctcggagaag	Protospacer
. .  .**************** **** *

109. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.7 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
gggcgcgtcgcgcagggccgtgtcggcctt	Protospacer
*.  .. ********** **********

110. spacer 1.10|972898|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 10, identity: 0.667 

tgtcagatcgaggaaaagggctttgtttac	CRISPR spacer
gccgagatcgaggaacagggctttgccatg	Protospacer
  . *********** *********..

111. spacer 1.15|973228|30|NZ_CP015736|CRISPRCasFinder,CRT,PILER-CR matches to MK524524 (Streptomyces phage Caelum, complete genome) position: , mismatch: 10, identity: 0.667 

gacgatctcgcgcaggggcgtgtcggccgg	CRISPR spacer
cgtcatctcgcgcagggacgtgtcgctgat	Protospacer
 .. *************.******* . .

112. spacer 3.5|2032638|40|NZ_CP015736|CRISPRCasFinder matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 11, identity: 0.725 

tgtcggccgcgtcgacgagatcagccgcaccgtcggcgag	CRISPR spacer
cccggcccctatcgacgagatcatccgcacggtcggcgac	Protospacer
. . * ** ..************ ****** ********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1137611 : 1150713 14 Paracoccus_phage(25.0%) portal,protease,tail,capsid,head NA
DBSCAN-SWA_2 1415192 : 1425125 6 Diachasmimorpha_longicaudata_entomopoxvirus(16.67%) protease NA
DBSCAN-SWA_3 1626191 : 1694778 58 uncultured_Mediterranean_phage(43.48%) transposase,tRNA,integrase attL 1617583:1617601|attR 1705457:1705475
DBSCAN-SWA_4 1816708 : 1827330 9 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_5 2396951 : 2419665 33 Ochrobactrum_phage(45.0%) tail,integrase,transposase attL 2400593:2400611|attR 2418218:2418236
DBSCAN-SWA_6 2828332 : 2868267 54 Rhizobium_phage(76.32%) tail,integrase,transposase,plate,terminase attL 2818448:2818465|attR 2872281:2872298

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP015738
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015738_1 193329-193406 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015738_2 193533-193609 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015738_1 1.1|193352|31|NZ_CP015738|CRISPRCasFinder 193352-193382 31 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 193352-193382 0 1.0
NZ_CP015738_2 2.1|193556|31|NZ_CP015738|CRISPRCasFinder 193556-193586 31 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 193556-193586 0 1.0
NZ_CP015738_1 1.1|193352|31|NZ_CP015738|CRISPRCasFinder 193352-193382 31 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 499114-499144 7 0.774
NZ_CP015738_2 2.1|193556|31|NZ_CP015738|CRISPRCasFinder 193556-193586 31 NC_015963 UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS01, complete sequence 124220-124250 9 0.71

1. spacer 1.1|193352|31|NZ_CP015738|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 0, identity: 1.0 

gtatggtcgcgacacgatgagtggcggcaat	CRISPR spacer
gtatggtcgcgacacgatgagtggcggcaat	Protospacer
*******************************

2. spacer 2.1|193556|31|NZ_CP015738|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 0, identity: 1.0 

caacggcaacgatcgcatgtggggccagggc	CRISPR spacer
caacggcaacgatcgcatgtggggccagggc	Protospacer
*******************************

3. spacer 1.1|193352|31|NZ_CP015738|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 7, identity: 0.774 

gtatggtcgcgacacgatgagtggcggcaat	CRISPR spacer
ccagggccgcgacacgatcagtggcggccac	Protospacer
 .* **.*********** ********* *.

4. spacer 2.1|193556|31|NZ_CP015738|CRISPRCasFinder matches to NC_015963 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS01, complete sequence) position: , mismatch: 9, identity: 0.71 

caacggcaacgatcgcatgtggggccagggc	CRISPR spacer
aacaagcaatgagcgcatgtggggccagaag	Protospacer
 *  .****.** ***************..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP015741
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 773 : 63147 57 Stx2-converting_phage(12.5%) transposase,integrase attL 29094:29108|attR 63060:63074

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage