Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014903 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014904 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014902 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014901 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-2, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP014906 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-7, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014900 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-1, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP014905 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-6, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014899 Lactobacillus backii strain TMW 1.2002 chromosome, complete genome 0 crisprs csa3,cas3,DEDDh,DinG,cas14j 0 0 11 0

Results visualization

1. NZ_CP014899
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 185860 : 257904 55 Acinetobacter_phage(40.0%) transposase NA
DBSCAN-SWA_2 476628 : 485152 9 Cyanophage(33.33%) NA NA
DBSCAN-SWA_3 641806 : 709523 54 Lactobacillus_phage(27.27%) transposase,tRNA NA
DBSCAN-SWA_4 1099225 : 1213319 119 Lactobacillus_phage(52.17%) transposase,tRNA,protease,head,plate,terminase,tail,integrase,portal,capsid attL 1109025:1109041|attR 1184330:1184346
DBSCAN-SWA_5 1507078 : 1557533 48 Bacillus_phage(23.08%) protease,transposase NA
DBSCAN-SWA_6 1606467 : 1642109 35 Streptococcus_phage(30.0%) transposase,tRNA NA
DBSCAN-SWA_7 1657650 : 1666629 8 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_8 1722923 : 1786808 55 Bacillus_phage(55.56%) transposase,tRNA NA
DBSCAN-SWA_9 1817964 : 1876459 58 Leptospira_phage(17.65%) transposase,tRNA NA
DBSCAN-SWA_10 2077153 : 2146893 57 Streptomyces_phage(11.76%) protease,transposase,tRNA NA
DBSCAN-SWA_11 2149941 : 2273870 112 Bacillus_phage(25.71%) transposase,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014901
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11053 12 Staphylococcus_phage(40.0%) transposase NA
DBSCAN-SWA_2 15436 : 20209 5 Streptococcus_phage(66.67%) integrase attL 11836:11849|attR 17372:17385
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP014900
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014900_1 28798-28899 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP027191 Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence 29360-29389 0 1.0
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP027195 Lactobacillus sp. CBA3606 plasmid pCBA3606-1, complete sequence 30410-30439 0 1.0
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP014874 Lactobacillus backii strain TMW 1.1989 plasmid pL11989-1, complete sequence 6853-6882 0 1.0
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP014900 Lactobacillus backii strain TMW 1.2002 plasmid pL12002-1, complete sequence 28834-28863 0 1.0
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP014920 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence 12633-12662 1 0.967
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP019982 Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence 10406-10435 1 0.967
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP019982 Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence 86925-86954 1 0.967
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NC_017017 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence 5386-5415 1 0.967
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP014928 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence 6823-6852 1 0.967
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NC_017468 Lactobacillus helveticus H10 plasmid pH10, complete sequence 15843-15872 1 0.967
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 5236-5265 1 0.967
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP033891 Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence 3329-3358 1 0.967
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NZ_CP031200 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence 39623-39652 1 0.967
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NC_015421 Lactobacillus buchneri NRRL B-30929 plasmid pLBUC03, complete sequence 1006-1035 2 0.933
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NC_006529 Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence 4741-4770 2 0.933
NZ_CP014900_1 1.1|28834|30|NZ_CP014900|CRISPRCasFinder 28834-28863 30 NC_008498 Lactobacillus brevis ATCC 367 plasmid 1, complete sequence 8761-8790 2 0.933

1. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP027191 (Lactobacillus sp. CBA3605 plasmid pCBA3605-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgttgtcaacgaactttcgcgaa	Protospacer
******************************

2. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP027195 (Lactobacillus sp. CBA3606 plasmid pCBA3606-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgttgtcaacgaactttcgcgaa	Protospacer
******************************

3. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP014874 (Lactobacillus backii strain TMW 1.1989 plasmid pL11989-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgttgtcaacgaactttcgcgaa	Protospacer
******************************

4. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP014900 (Lactobacillus backii strain TMW 1.2002 plasmid pL12002-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgttgtcaacgaactttcgcgaa	Protospacer
******************************

5. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP014920 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence) position: , mismatch: 1, identity: 0.967

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgtcgtcaacgaactttcgcgaa	Protospacer
**********.*******************

6. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP019982 (Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence) position: , mismatch: 1, identity: 0.967

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggagtgttgtcaacgaactttcgcgaa	Protospacer
*****.************************

7. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP019982 (Pediococcus inopinatus strain DSM 20285 plasmid pLDW-12, complete sequence) position: , mismatch: 1, identity: 0.967

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggagtgttgtcaacgaactttcgcgaa	Protospacer
*****.************************

8. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NC_017017 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence) position: , mismatch: 1, identity: 0.967

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgtcgtcaacgaactttcgcgaa	Protospacer
**********.*******************

9. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP014928 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence) position: , mismatch: 1, identity: 0.967

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgtcgtcaacgaactttcgcgaa	Protospacer
**********.*******************

10. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NC_017468 (Lactobacillus helveticus H10 plasmid pH10, complete sequence) position: , mismatch: 1, identity: 0.967

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgtcgtcaacgaactttcgcgaa	Protospacer
**********.*******************

11. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 1, identity: 0.967

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgtcgtcaacgaactttcgcgaa	Protospacer
**********.*******************

12. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP033891 (Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence) position: , mismatch: 1, identity: 0.967

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgtcgtcaacgaactttcgcgaa	Protospacer
**********.*******************

13. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NZ_CP031200 (Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence) position: , mismatch: 1, identity: 0.967

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgtcgtcaacgaactttcgcgaa	Protospacer
**********.*******************

14. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NC_015421 (Lactobacillus buchneri NRRL B-30929 plasmid pLBUC03, complete sequence) position: , mismatch: 2, identity: 0.933

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcgggttgtcgtcaacgaactttcgcgaa	Protospacer
****** ***.*******************

15. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NC_006529 (Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence) position: , mismatch: 2, identity: 0.933

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgcggggtgtcgtcaacggactttcgcgaa	Protospacer
**********.*******.***********

16. spacer 1.1|28834|30|NZ_CP014900|CRISPRCasFinder matches to NC_008498 (Lactobacillus brevis ATCC 367 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.933

tgcggggtgttgtcaacgaactttcgcgaa	CRISPR spacer
tgtggggtgtcgtcaacgaactttcgcgaa	Protospacer
**.*******.*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage