1. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH271302 (Gordonia phage Margaret, complete genome) position: , mismatch: 1, identity: 0.96
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttggcg Protospacer
************************
2. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 2, identity: 0.92
ggccttcttggccggggccttggcg CRISPR spacer
aggcttcttggccggggccttggcg Protospacer
.* **********************
3. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG652450 (Ralstonia phage RsoP1IDN, complete genome) position: , mismatch: 2, identity: 0.92
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggcctttgcc Protospacer
********************* **
4. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 2, identity: 0.92
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcctcggccttggcg Protospacer
************* **********
5. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 2, identity: 0.92
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcctcggccttggcg Protospacer
************* **********
6. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.92
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcctcggccttggcg Protospacer
************* **********
7. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.92
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcctcggccttggcg Protospacer
************* **********
8. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_028914 (Mycobacterium phage Sheen, complete genome) position: , mismatch: 2, identity: 0.92
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttctcg Protospacer
********************* **
9. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 2, identity: 0.92
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcctcggccttggcg Protospacer
************* **********
10. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT553346 (Mycobacterium phage Scamp, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
11. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH536817 (Mycobacterium phage Druantia, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
12. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JX307703 (Mycobacterium phage Sabertooth, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
13. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JQ896627 (Mycobacterium phage ICleared, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
14. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH020249 (Mycobacterium phage Skipitt, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
15. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH697588 (Mycobacterium phage Jaykayelowell, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
16. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH479911 (Mycobacterium phage Eapen, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
17. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KF024733 (Mycobacterium phage Medusa, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
18. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY204251 (Mycobacterium phage Thanksgivukkah, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
19. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JF792674 (Mycobacterium phage Shaka, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
20. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY204245 (Mycobacterium phage Camperdownii, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
21. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK494088 (Mycobacterium phage Mazhar510, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
22. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK359340 (Mycobacterium phage Phontbonne, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
23. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG944217 (Mycobacterium phage Phacado, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
24. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK494101 (Mycobacterium phage Connomayer, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
25. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH825710 (Mycobacterium phage Ruin, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
26. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KT716493 (Mycobacterium phage Caelakin, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
27. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG944224 (Mycobacterium phage Wander, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
28. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK359301 (Mycobacterium phage Kingmustik0402, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
29. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK494126 (Mycobacterium phage PeterPeter, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
30. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY083058 (Mycobacterium phage Abdiel, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
31. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT889390 (Mycobacterium phage Bartimeaus, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
32. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX808130 (Mycobacterium phage Broseidon, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
33. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK494097 (Mycobacterium phage Lorenzo, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
34. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN813696 (Mycobacterium phage Cintron, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
35. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK359323 (Mycobacterium phage Baby16, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
36. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY083060 (Mycobacterium phage Bruiser, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
37. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX557234 (Mycobacterium phage Florean, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
38. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KT365397 (Mycobacterium phage Maverick, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
39. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JN243856 (Mycobacterium phage MeeZee, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
40. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK494125 (Mycobacterium phage Kyee, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
41. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH509443 (Mycobacterium phage Avle17, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
42. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH155879 (Mycobacterium phage Relief, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
43. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK310145 (Mycobacterium phage Lemur, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
44. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY204247 (Mycobacterium phage Funston, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
45. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to HM152766 (Mycobacterium phage Eagle, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
46. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH479909 (Mycobacterium phage Commander, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
47. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG099942 (Mycobacterium phage Blackmoor, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
48. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT889386 (Mycobacterium phage CentreCat, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
49. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX619651 (Mycobacterium phage Roosevelt, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
50. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY549155 (Mycobacterium phage Tinybot, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
51. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY083062 (Mycobacterium phage Millski, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
52. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX648373 (Mycobacterium phage Cocoaberry, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
53. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK279902 (Mycobacterium phage Citius, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
54. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KP027198 (Mycobacterium phage Gadost, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
55. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK878905 (Mycobacterium phage TygerBlood, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
56. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK359325 (Mycobacterium phage Eros, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
57. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_024141 (Mycobacterium phage Kampy, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
58. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_028687 (Mycobacterium phage Iracema64, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
59. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT889382 (Mycobacterium phage TroyPia, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
60. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY471266 (Mycobacterium phage TinaFeyge, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
61. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JN561150 (Mycobacterium phage TiroTheta9, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
62. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY083063 (Mycobacterium phage Eris, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
63. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH727563 (Mycobacterium phage Wizard007, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
64. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY204249 (Mycobacterium phage KFPoly, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
65. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT818417 (Mycobacterium phage Maxo, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
66. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY083061 (Mycobacterium phage Palestino, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
67. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY204244 (Mycobacterium phage BubbleTrouble, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
68. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT723939 (Mycobacterium phage Bombshell, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
69. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH051247 (Mycobacterium phage Annyong, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
70. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KF954506 (Mycobacterium phage Nyxis, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
71. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH399777 (Mycobacterium phage Houdini22, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
72. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX817174 (Mycobacterium phage LittleB, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
73. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX550441 (Mycobacterium phage LittleGuy, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
74. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KU985092 (Mycobacterium phage Holli, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
75. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KP057620 (Mycobacterium phage HamSlice, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
76. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH399785 (Mycobacterium phage NotAPhaseMom, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
77. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KU985094 (Mycobacterium phage Burger, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
78. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY006473 (Mycobacterium phage LeoAvram, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
79. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT553338 (Mycobacterium phage Deano, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
80. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX817175 (Mycobacterium phage Albee, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
81. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY204248 (Mycobacterium phage JoongJeon, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
82. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JQ809701 (Mycobacterium phage Flux, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
83. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH077581 (Mycobacterium phage Nemo27, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
84. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttggtc Protospacer
************ **********.
85. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttggtc Protospacer
************ **********.
86. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggtcttcgcg Protospacer
.****************.*** ***
87. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK061410 (Gordonia phage Eyes, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
88. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK967377 (Gordonia phage MagicMan, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
89. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_031255 (Gordonia phage Schwabeltier, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttg Protospacer
********************* .*
90. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccgcgggcttggcg Protospacer
.************* ** *******
91. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccgcgggcttggcg Protospacer
.************* ** *******
92. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK620901 (Microbacterium phage PrincePhergus, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccgtggccttgggg Protospacer
************* ******** *
93. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK814762 (Microbacterium phage Bustleton, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccgtggccttgggg Protospacer
************* ******** *
94. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK937602 (Microbacterium phage Sinatra, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccgtggccttgggg Protospacer
************* ******** *
95. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK620904 (Microbacterium phage Pherbot, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccgtggccttgggg Protospacer
************* ******** *
96. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX557278 (Gordonia phage Ghobes, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttctttgccggggccttgcgg Protospacer
********* ************ *
97. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccgcgggcttggcg Protospacer
.************* ** *******
98. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccgcggtcttggcc Protospacer
************** **.******
99. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggcgccttgccg Protospacer
************** ****** **
100. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP049320 (Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccgcggtcttggcc Protospacer
************** **.******
101. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggcctcggccttggcg Protospacer
************ **********
102. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccgcgggcttggcg Protospacer
.************* ** *******
103. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP043439 (Cupriavidus campinensis strain MJ1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccgcgggcttggcg Protospacer
.************* ** *******
104. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK814748 (Mycobacterium phage XianYue, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggtgccttgcgg Protospacer
*************** ****** *
105. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcccgggcctcgggg Protospacer
************* ******.** *
106. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
gaccttcttcgccggagccttggcg Protospacer
*.******* *****.*********
107. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT316461 (Streptomyces phage Galactica, complete genome) position: , mismatch: 3, identity: 0.88
ggccttcttggccggggccttggcg CRISPR spacer
gaccttcttggcctggggcttggcg Protospacer
*.*********** *** *******
108. spacer 1.1|3119235|25|NZ_CP016022|CRT matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 4, identity: 0.84
aggcttggcagcagccttcttcgta CRISPR spacer
gggcttggcagcggccttcttcgcg Protospacer
.***********.**********..
109. spacer 1.1|3119235|25|NZ_CP016022|CRT matches to JX901189 (Mycobacterium phage vB_MapS_FF47, complete genome) position: , mismatch: 4, identity: 0.84
aggcttggcagcagccttcttcgta CRISPR spacer
acgcttggcaggagccttcttcgcc Protospacer
* ********* ***********.
110. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttggcc Protospacer
.*********** *************.
111. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttggcc Protospacer
.*********** *************.
112. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttggcc Protospacer
.*********** *************.
113. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttggcc Protospacer
.*********** *************.
114. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
115. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
116. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
117. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
118. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
119. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
120. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
121. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
122. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
123. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
124. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
125. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
126. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
aaccttcttcacgccggccttcttgacc Protospacer
************ ***********.*.
127. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
agccttcttcgccgcggccttcttggca Protospacer
*.********.*.**************
128. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_042080 (Pseudomonas phage vB_PaeM_E215, complete genome) position: , mismatch: 4, identity: 0.857
aaccttcttcactgcggccttcttggct CRISPR spacer
agccttcttctcttcggccttcttggcg Protospacer
*.******** ** *************
129. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MF919496 (Mycobacterium phage Cerulean, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
130. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT553337 (Mycobacterium phage DroogsArmy, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
131. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MF919509 (Mycobacterium phage JetBlade, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
132. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH155875 (Mycobacterium phage Pipcraft, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
133. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT490373 (Mycobacterium phage OKaNui, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
134. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH020246 (Mycobacterium phage SchoolBus, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
135. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KC661271 (Mycobacterium phage Dhanush, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
136. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH230877 (Mycobacterium phage NorthStar, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
137. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK359356 (Mycobacterium phage Nebs, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
138. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG793454 (Mycobacterium phage SWU2, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
139. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG099943 (Mycobacterium phage Familton, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
140. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KF841476 (Mycobacterium phage Melvin, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
141. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_023562 (Mycobacterium phage BellusTerra, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
142. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN728684 (Mycobacterium phage Ohfah, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
143. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KC661275 (Mycobacterium phage HINdeR, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
144. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT498056 (Mycobacterium phage Chaph, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
145. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_013694 (Mycobacterium virus Peaches, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
146. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JN699015 (Mycobacterium virus LHTSCC, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
147. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
148. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KY204246 (Mycobacterium phage Clarenza, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
149. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT114158 (Mycobacterium phage Polymorphads, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
150. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH651170 (Mycobacterium phage ChampagnePapi, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
151. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_023577 (Mycobacterium phage Obama12, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
152. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
153. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK878895 (Mycobacterium phage SheldonCooper, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
154. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JF957060 (Mycobacterium phage Timshel, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
155. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG962373 (Mycobacterium phage Morrow, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
156. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggcgggggccttggtc Protospacer
.*********** **********.
157. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggccttcttg Protospacer
.******************** .*
158. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggccttcttc Protospacer
********************* .
159. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggcgccttcttg Protospacer
*************** ***** .*
160. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JF937105 (Mycobacterium phage Rey, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggccttgcgt Protospacer
.*********************
161. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggccttcttg Protospacer
.******************** .*
162. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN813697 (Mycobacterium phage Noelle, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggccttcttg Protospacer
.******************** .*
163. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX458236 (Mycobacterium phage Wilbur, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggccttcttg Protospacer
.******************** .*
164. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KU867906 (Mycobacterium phage Romney, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggccttcttg Protospacer
.******************** .*
165. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to AP018486 (Mycobacterium phage PP DNA, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttg Protospacer
******************** .*
166. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KU998235 (Gordonia phage Bowser, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttg Protospacer
******************** .*
167. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggggtcttcttg Protospacer
*****************.*** .*
168. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT889377 (Microbacterium phage Zayuliv, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
gggcttcttggccggtgccttgggt Protospacer
** ************ *******
169. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN224564 (Streptomyces phage Araceli, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggcctccgcc Protospacer
*******************. **
170. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK878901 (Gordonia phage HannahD, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggcgccttcttg Protospacer
*************** ***** .*
171. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT522006 (Gordonia phage BBQValindra, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggcgccttcttg Protospacer
*************** ***** .*
172. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN813694 (Gordonia phage Opie, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggcgccttcttg Protospacer
*************** ***** .*
173. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to AY576796 (Actinoplanes phage phiAsp2, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttcttg Protospacer
************ ******** .*
174. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH229865 (Streptomyces phage LazerLemon, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggcctccgcc Protospacer
*******************. **
175. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH229864 (Streptomyces phage UNTPL, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
gcccttcttggccggggccttcttg Protospacer
* ******************* .*
176. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH229863 (Streptomyces phage JackieB, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggcctccgcc Protospacer
*******************. **
177. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH479915 (Gordonia phage GEazy, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggcgccttcttg Protospacer
*************** ***** .*
178. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH229862 (Streptomyces phage Henoccus, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggcctccgcc Protospacer
*******************. **
179. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KF024728 (Mycobacterium phage Muddy, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggcaggggccttgcgg Protospacer
.*********** ********* *
180. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JX901189 (Mycobacterium phage vB_MapS_FF47, complete genome) position: , mismatch: 4, identity: 0.84
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggcgggggccttgcgg Protospacer
.*********** ********* *
181. spacer 1.1|3119235|25|NZ_CP016022|CRT matches to MK284521 (Gordonia phage Kiko, complete genome) position: , mismatch: 5, identity: 0.8
aggcttggcagcagccttcttcgta CRISPR spacer
gcgcttggcagcggccttcttcgcc Protospacer
. **********.**********.
182. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttcaccgcgtccttcttggcc Protospacer
..**********.*** **********.
183. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttcaccgcgtccttcttggcc Protospacer
..**********.*** **********.
184. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttcaccgcgtccttcttggcc Protospacer
..**********.*** **********.
185. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MK837010 (Pseudomonas virus Pa204, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
186. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871485 (UNVERIFIED: Pseudomonas phage PaSz-8_45_66k, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
187. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871467 (UNVERIFIED: Pseudomonas phage Pa-P, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
188. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_041902 (Pseudomonas phage PA5, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
189. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871457 (UNVERIFIED: Pseudomonas phage Pa-F, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
190. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to LC102730 (Pseudomonas phage S12-1 DNA, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
191. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to LC472883 (Pseudomonas phage S12-3 DNA, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
192. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871454 (UNVERIFIED: Pseudomonas phage Pa-A, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
193. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to KP340288 (Pseudomonas phage phiKTN6, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
194. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to LQ277707 (Sequence 2 from Patent WO2016071503) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
195. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MT118303 (Pseudomonas phage Epa39, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
196. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to LC472881 (Pseudomonas phage R12 DNA, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
197. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MT108727 (Pseudomonas phage Epa11, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
198. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MT119363 (Pseudomonas phage debbie, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
199. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MT119370 (Pseudomonas phage steven, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
200. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871459 (UNVERIFIED: Pseudomonas phage Pa-H, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
201. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871509 (UNVERIFIED: Pseudomonas phage pasz5, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
202. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MT108726 (Pseudomonas phage Epa6, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
203. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_019935 (Pseudomonas phage KPP12 DNA, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
204. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to LZ998055 (JP 2017534684-A/2: Phage Therapy) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
205. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to LZ998059 (JP 2017534684-A/6: Phage Therapy) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
206. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to LQ277711 (Sequence 6 from Patent WO2016071503) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
207. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871460 (UNVERIFIED: Pseudomonas phage Pa-I, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
208. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_028745 (Pseudomonas phage DL60, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
209. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MT119365 (Pseudomonas phage goodold, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
210. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871487 (UNVERIFIED: Pseudomonas phage PaSz-9_45_65k, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
211. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to JQ067083 (UNVERIFIED: Pseudomonas phage PaMx13, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
212. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MK317959 (Pseudomonas phage EPa61, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
213. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
cgccttcttcgcggcggccttcttggcc Protospacer
.********.* **************.
214. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to LC472884 (Pseudomonas phage S50 DNA, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
215. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_048745 (Pseudomonas phage vB_PaeM_SCUT-S1, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
216. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871508 (UNVERIFIED: Pseudomonas phage pasz2, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
217. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MF623055 (Pseudomonas phage BrSP1, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
218. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MG897799 (Pseudomonas phage vB_PaeM_LS1, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
219. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MN871466 (UNVERIFIED: Pseudomonas phage Pa-O, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
220. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_050148 (Pseudomonas virus Pa193, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
ggccttcttctcttcggccttcttggcg Protospacer
..******** ** *************
221. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
222. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
223. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
224. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
225. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
226. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
227. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
228. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
229. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
230. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
231. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
232. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
caccttcttctcagcggccttcttgccg Protospacer
********* * ************ *
233. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
234. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
235. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
236. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
237. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
238. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
239. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
240. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
241. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
242. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
243. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
244. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
245. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
246. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
247. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
248. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
249. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
250. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
251. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
252. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
253. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
254. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
255. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
256. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
257. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
258. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
259. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
260. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
261. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
262. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
263. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
264. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
265. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
266. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
267. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
268. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
269. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
270. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
271. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
272. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
273. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
274. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
275. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
276. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
277. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
278. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
279. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
280. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
281. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
282. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
283. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
284. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
285. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
286. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
287. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
288. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
289. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
290. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
291. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
292. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
293. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
294. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcttcacgccggccttcttgacc Protospacer
.*********** ***********.*.
295. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to KC292029 (Halovirus HCTV-1, complete genome) position: , mismatch: 5, identity: 0.821
aaccttcttcactgcggccttcttggct CRISPR spacer
gaccttcgtcactgcggcgttcttgccc Protospacer
.****** ********** ****** *.
296. spacer 1.6|3119499|34|NZ_CP016022|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 5, identity: 0.853
cggagcagccttctttgcagcgaccttcttagcg CRISPR spacer
cgatgcagccttcttggcagcgaccttcttgacg Protospacer
**. *********** **************..**
297. spacer 1.6|3119499|34|NZ_CP016022|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 5, identity: 0.853
cggagcagccttctttgcagcgaccttcttagcg CRISPR spacer
cgatgcagccttcttggcagcgaccttcttgacg Protospacer
**. *********** **************..**
298. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggccttcttc Protospacer
.******************** .
299. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggtcttcttggccggggccttcttc Protospacer
**.****************** .
300. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH020248 (Mycobacterium phage Panamaxus, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
301. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG925355 (Mycobacterium phage OlanP, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggccttcttc Protospacer
.******************** .
302. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN497953 (Mycobacterium phage GtownJaz, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
303. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK494117 (Mycobacterium phage Miramae, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
304. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN062712 (Mycobacterium phage Pocahontas, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
305. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG925341 (Mycobacteriophage EpicPhail, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
306. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX808129 (Mycobacterium phage Sabinator, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
307. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK359341 (Mycobacterium phage GingkoMaracino, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
308. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JF704114 (Mycobacterium phage Vix, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
309. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN234187 (Mycobacterium phage DyoEdafos, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggcctttttc Protospacer
******************** .
310. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK279913 (Mycobacterium phage PotatoSplit, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
311. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG757161 (Mycobacterium phage LugYA, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
312. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG812492 (Mycobacterium phage Lambert1, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
313. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH536825 (Mycobacterium phage Ollie, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
314. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH020238 (Mycobacterium phage Lilith, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
315. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK284519 (Mycobacterium phage Norbert, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
316. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH077583 (Mycobacterium phage PGHhamlin, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
317. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT897907 (Mycobacterium phage Grif, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
318. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH155864 (Mycobacterium phage Beauxregard13, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
319. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH727554 (Mycobacterium phage MuchMore, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
320. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH338240 (Mycobacterium phage Sabia, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
321. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN813699 (Mycobacterium phage P28Green, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
322. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK279903 (Mycobacterium phage Zetzy, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
323. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN284900 (Mycobacterium phage JeppNRM, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
324. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to HM755814 (Mycobacterium phage Wonder, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
325. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KU578077 (Mycobacterium phage Marie, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
326. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK524496 (Mycobacterium phage Veracruz, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
327. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KT381277 (Mycobacterium phage Wooldri, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
328. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK494129 (Mycobacterium phage AvatarAhPeg, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
329. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK875800 (Mycobacterium phage MoneyMay, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
330. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX664448 (Mycobacterium phage Watson, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
331. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX507362 (Mycobacterium phage Aglet, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
332. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN586048 (Mycobacterium phage Fernando, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
333. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH976517 (Mycobacterium phage Popcicle, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
334. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KU985091 (Mycobacterium phage Hercules11, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
335. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_042310 (Mycobacterium virus JHC117, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
336. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH576949 (Mycobacterium phage BreSam8, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
337. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KP027202 (Mycobacterium phage Taurus, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
338. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH399776 (Mycobacterium phage Grum1, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
339. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN585969 (Mycobacterium phage Dieselweasel, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
340. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KU255188 (Mycobacterium phage JenCasNa, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
341. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX458237 (Mycobacterium phage Penny1, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
342. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_021535 (Mycobacterium phage Jobu08, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
343. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH536813 (Mycobacterium phage AugsMagnumOpus, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
344. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH450126 (Mycobacterium phage PhishRPhriends, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
agccttcttggccggggccttcttc Protospacer
.******************** .
345. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MF185733 (Mycobacterium phage StepMih, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
346. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KT326767 (Mycobacterium phage Texage, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
347. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MF185732 (Mycobacterium phage Stagni, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
348. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK494096 (Mycobacterium phage Mainiac, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
349. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KU984914 (Mycobacterium phage Malinsilva, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
350. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JF704101 (Mycobacterium virus Microwolf, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
351. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KM592966 (Mycobacterium phage QuinnKiro, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
352. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_028757 (Mycobacterium phage Tiffany, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
353. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH316563 (Mycobacterium phage Hookmount, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
354. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN062718 (Mycobacterium phage SoilDragon, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
355. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX579975 (Mycobacterium phage Mundrea, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
356. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KT359365 (Mycobacterium phage DaHudson, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
357. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH651179 (Mycobacterium phage MadMarie, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
358. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX670828 (Mycobacterium phage Todacoro, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
359. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KF279418 (Mycobacterium phage Anubis, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
360. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MK494127 (Mycobacterium phage Noella, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
tgccttcttggccggggccttcttc Protospacer
******************** .
361. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_028798 (Mycobacterium phage MarQuardt, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cgccttcttggccggggccttcttc Protospacer
******************** .
362. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ctgctccttggccggggccttggcc Protospacer
**.******************
363. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ctgctccttggccggggccttggcc Protospacer
**.******************
364. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG757157 (Gordonia phage Flapper, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcaggggccttcttc Protospacer
************ ******** .
365. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KT281796 (Mycobacterium phage Zakhe101, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttcttc Protospacer
************ ******** .
366. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH744424 (Gordonia phage Turuncu, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttcttc Protospacer
************ ******** .
367. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN428058 (Mycobacterium phage Krili, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggagccttcttc Protospacer
***************.***** .
368. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT818418 (Mycobacterium phage Shida, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggagccttcttc Protospacer
***************.***** .
369. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttcttc Protospacer
************ ******** .
370. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH926062 (Mycobacterium phage Vorrps, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggagccttcttc Protospacer
***************.***** .
371. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG872838 (Mycobacterium phage JangDynasty, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggagccttcttc Protospacer
***************.***** .
372. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG944216 (Microbacterium phage Pajaza, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggagccttcttc Protospacer
***************.***** .
373. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG944226 (Microbacterium phage Casey, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggagccttcttc Protospacer
***************.***** .
374. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH590592 (Mycobacterium phage Ryadel, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggagccttcttc Protospacer
***************.***** .
375. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MT818425 (Mycobacterium phage NiebruSaylor, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggagccttcttc Protospacer
***************.***** .
376. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_022325 (Mycobacterium phage Dylan, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttcttc Protospacer
************ ******** .
377. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MG944218 (Microbacterium phage Pikmin, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggagccttcttc Protospacer
***************.***** .
378. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttcttc Protospacer
************ ******** .
379. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to JF923796 (Gordonia phage GTE5, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttcttc Protospacer
************ ******** .
380. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NC_016435 (Gordonia phage GRU1, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggcgggggccttcttc Protospacer
************ ******** .
381. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ctgctccttggccggggccttggcc Protospacer
**.******************
382. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to NZ_CP033584 (Streptomyces sp. ADI95-16 plasmid pADI95-16c, complete sequence) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
cttcttcttggcgggggccttggcc Protospacer
.********* ***********
383. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX641266 (Mycobacterium phage Terror, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggcgccttcttc Protospacer
*************** ***** .
384. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MN224565 (Streptomyces phage Intolerant, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ttccttcttggccggggccttcttg Protospacer
******************* .*
385. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX641265 (Mycobacterium phage Taheera, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ggccttcttggccggcgccttcttc Protospacer
*************** ***** .
386. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to MH825706 (Streptomyces phage Microdon, complete genome) position: , mismatch: 5, identity: 0.8
ggccttcttggccggggccttggcg CRISPR spacer
ttccttcttggccggggccttcttg Protospacer
******************* .*
387. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 6, identity: 0.786
aaccttcttcactgcggccttcttggct CRISPR spacer
ggtcttcttcgccgcggccttcttggcc Protospacer
...*******.*.**************.
388. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 6, identity: 0.786
aaccttcttcactgcggccttcttggct CRISPR spacer
tccccgcttcacggcggccttcttggcg Protospacer
**. ****** **************
389. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to NZ_CP030365 (Salinibacter ruber strain M1 plasmid pSR116, complete sequence) position: , mismatch: 6, identity: 0.786
aaccttcttcactgcggccttcttggct CRISPR spacer
caccctcttcactgcggccttcattccg Protospacer
***.***************** * *
390. spacer 1.7|3119553|25|NZ_CP016022|CRT matches to KX640831 (Mycobacterium phage Margo, complete genome) position: , mismatch: 6, identity: 0.76
ggccttcttggccggggccttggcg CRISPR spacer
taccttcttggccggggccttcttc Protospacer
.******************* .
391. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to MT553337 (Mycobacterium phage DroogsArmy, complete genome) position: , mismatch: 7, identity: 0.75
aaccttcttcactgcggccttcttggct CRISPR spacer
ggtcaccttcgctgcggccttcttggcc Protospacer
...* .****.****************.
392. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to KC661275 (Mycobacterium phage HINdeR, complete genome) position: , mismatch: 7, identity: 0.75
aaccttcttcactgcggccttcttggct CRISPR spacer
ggtcaccttcgctgcggccttcttggcc Protospacer
...* .****.****************.
393. spacer 1.4|3119391|28|NZ_CP016022|CRT matches to JF957060 (Mycobacterium phage Timshel, complete genome) position: , mismatch: 7, identity: 0.75
aaccttcttcactgcggccttcttggct CRISPR spacer
ggtcaccttcgctgcggccttcttggcc Protospacer
...* .****.****************.
394. spacer 1.6|3119499|34|NZ_CP016022|CRT matches to MG962366 (Rhodococcus phage Finch, complete genome) position: , mismatch: 8, identity: 0.765
cggagcagccttctttgcagcgaccttcttagcg CRISPR spacer
ggctggagccttcttggcagcggccttcttcacg Protospacer
* * ********* ******.******* .**
395. spacer 1.5|3119439|40|NZ_CP016022|CRT matches to NC_049851 (Burkholderia phage BcepSauron, complete genome) position: , mismatch: 11, identity: 0.725
gaccttcttagctgcaaccttcttggcagcaaccttcttt CRISPR spacer
ttccttctttactgcaaccttcttggcagcaggtttggcc Protospacer
******* .********************. .** ..
