Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016268 Woeseia oceani strain XK5, complete genome 1 crisprs WYL,csa3,DEDDh,DinG,cas3 0 1 2 0

Results visualization

1. NZ_CP016268
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016268_1 2751595-2751667 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016268_1 1.1|2751618|27|NZ_CP016268|CRISPRCasFinder 2751618-2751644 27 NZ_AP018682 Vibrio casei strain DSM 22364 plasmid 1, complete sequence 8587-8613 6 0.778

1. spacer 1.1|2751618|27|NZ_CP016268|CRISPRCasFinder matches to NZ_AP018682 (Vibrio casei strain DSM 22364 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

caaacaaaaccgcaataagcaaaccgc	CRISPR spacer
caaacagaaccgcaataagcattgcaa	Protospacer
******.**************   *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1731151 : 1738488 7 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_2 3210339 : 3221829 9 Diadromus_pulchellus_ascovirus(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage