Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012729 Bacillus anthracis strain Parent2 chromosome, complete genome 5 crisprs cas3,csa3,WYL,c2c9_V-U4,cas14k,DinG,DEDDh,cas14j 0 1 10 0

Results visualization

1. NZ_CP012729
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012729_1 1064104-1064197 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012729_2 1176608-1176716 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012729_3 2720368-2720565 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012729_4 3098888-3099022 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012729_5 3267245-3267347 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012729_4 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder 3098915-3098941 27 KJ094023 Listeria phage LP-101, complete genome 3876-3902 4 0.852
NZ_CP012729_4 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder 3098915-3098941 27 NC_022766 Bacillus phage Glittering, complete genome 9024-9050 5 0.815
NZ_CP012729_4 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder 3098915-3098941 27 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1229260-1229286 6 0.778
NZ_CP012729_4 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder 3098915-3098941 27 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 438058-438084 6 0.778
NZ_CP012729_4 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder 3098915-3098941 27 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 127169-127195 6 0.778
NZ_CP012729_4 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder 3098915-3098941 27 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1227597-1227623 6 0.778
NZ_CP012729_4 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder 3098915-3098941 27 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 850854-850880 6 0.778
NZ_CP012729_4 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder 3098915-3098941 27 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 513839-513865 6 0.778
NZ_CP012729_4 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder 3098915-3098941 27 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 498252-498278 6 0.778

1. spacer 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 4, identity: 0.852

cgtctttggctcttctggtttctcttc	CRISPR spacer
catttctggctcttctggtttcttttc	Protospacer
*.*.*.*****************.***

2. spacer 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder matches to NC_022766 (Bacillus phage Glittering, complete genome) position: , mismatch: 5, identity: 0.815

cgtctttggctcttctggtttctcttc	CRISPR spacer
gttcaatggctcttctggtttctcatc	Protospacer
  **  ****************** **

3. spacer 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

4. spacer 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

5. spacer 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctgt	Protospacer
*.   ******************** .

6. spacer 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

7. spacer 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

8. spacer 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

9. spacer 4.1|3098915|27|NZ_CP012729|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctgt	Protospacer
*.   ******************** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 258555 : 266504 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 297184 : 305561 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 445989 : 476659 46 Bacillus_phage(67.5%) integrase,terminase,protease,head,tail,capsid attL 450331:450346|attR 464995:465010
DBSCAN-SWA_4 480547 : 484415 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 1838274 : 1847007 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_6 2156143 : 2163267 9 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_7 3432913 : 3483677 52 Bacillus_phage(33.33%) holin,terminase,protease,head,portal,tail,capsid NA
DBSCAN-SWA_8 3496015 : 3507569 20 Bacillus_phage(66.67%) integrase attL 3490108:3490124|attR 3513904:3513920
DBSCAN-SWA_9 3713974 : 3790163 90 Bacillus_phage(92.45%) tRNA,holin,integrase,terminase,protease,head,portal,tail,capsid attL 3747372:3747388|attR 3791954:3791970
DBSCAN-SWA_10 4817211 : 4859445 47 Staphylococcus_phage(26.67%) tRNA,holin,integrase,terminase,protease,head,portal,capsid attL 4807588:4807603|attR 4861896:4861911
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage