Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016511 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP016513 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_6, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP016510 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome 3 crisprs WYL,DinG,cas3,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 22 10 0

Results visualization

1. NZ_CP016510
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016510_1 2813303-2813412 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016510_2 3004425-3005166 TypeI-E I-E
12 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016510_3 3021424-3022551 TypeI-E I-E
18 spacers
cas3,cas8e,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016510_2 2.15|3004881|28|NZ_CP016510|PILER-CR 3004881-3004908 28 NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 337987-338014 5 0.821
NZ_CP016510_2 2.18|3005058|34|NZ_CP016510|PILER-CR 3005058-3005091 34 MT774487 Salmonella phage MG40, complete genome 21744-21777 6 0.824
NZ_CP016510_2 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder 3005045-3005076 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
NZ_CP016510_2 2.7|3004820|32|NZ_CP016510|CRISPRCasFinder,CRT 3004820-3004851 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
NZ_CP016510_2 2.7|3004820|32|NZ_CP016510|CRISPRCasFinder,CRT 3004820-3004851 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
NZ_CP016510_2 2.7|3004820|32|NZ_CP016510|CRISPRCasFinder,CRT 3004820-3004851 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
NZ_CP016510_2 2.18|3005058|34|NZ_CP016510|PILER-CR 3005058-3005091 34 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39485 7 0.794
NZ_CP016510_2 2.18|3005058|34|NZ_CP016510|PILER-CR 3005058-3005091 34 MH370364 Salmonella phage S107, complete genome 29957-29990 7 0.794
NZ_CP016510_2 2.18|3005058|34|NZ_CP016510|PILER-CR 3005058-3005091 34 MH370382 Salmonella phage S135, complete genome 29957-29990 7 0.794
NZ_CP016510_2 2.18|3005058|34|NZ_CP016510|PILER-CR 3005058-3005091 34 MH370383 Salmonella phage S137, complete genome 29957-29990 7 0.794
NZ_CP016510_2 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder 3005045-3005076 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
NZ_CP016510_2 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder 3005045-3005076 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
NZ_CP016510_2 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder 3005045-3005076 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
NZ_CP016510_2 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder 3005045-3005076 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
NZ_CP016510_3 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022185-3022216 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 208454-208485 7 0.781
NZ_CP016510_3 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022185-3022216 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 449563-449594 7 0.781
NZ_CP016510_3 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022185-3022216 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 167100-167131 7 0.781
NZ_CP016510_3 3.19|3022433|31|NZ_CP016510|PILER-CR 3022433-3022463 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 406309-406339 7 0.774
NZ_CP016510_3 3.19|3022433|31|NZ_CP016510|PILER-CR 3022433-3022463 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1840543-1840573 7 0.774
NZ_CP016510_3 3.19|3022433|31|NZ_CP016510|PILER-CR 3022433-3022463 31 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1220925-1220955 7 0.774
NZ_CP016510_3 3.19|3022433|31|NZ_CP016510|PILER-CR 3022433-3022463 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 718851-718881 7 0.774
NZ_CP016510_3 3.19|3022433|31|NZ_CP016510|PILER-CR 3022433-3022463 31 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 911450-911480 7 0.774
NZ_CP016510_2 2.2|3004515|32|NZ_CP016510|CRISPRCasFinder,CRT 3004515-3004546 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
NZ_CP016510_2 2.6|3004759|32|NZ_CP016510|CRISPRCasFinder,CRT 3004759-3004790 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
NZ_CP016510_2 2.6|3004759|32|NZ_CP016510|CRISPRCasFinder,CRT 3004759-3004790 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
NZ_CP016510_2 2.13|3004759|34|NZ_CP016510|PILER-CR 3004759-3004792 34 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8895 8 0.765
NZ_CP016510_2 2.13|3004759|34|NZ_CP016510|PILER-CR 3004759-3004792 34 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151598-151631 8 0.765
NZ_CP016510_3 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021697-3021728 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1098771-1098802 8 0.75
NZ_CP016510_3 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021697-3021728 32 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 160189-160220 8 0.75
NZ_CP016510_3 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021697-3021728 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156443-156474 8 0.75
NZ_CP016510_3 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021697-3021728 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 137983-138014 8 0.75
NZ_CP016510_3 3.7|3021819|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021819-3021850 32 LQ277707 Sequence 2 from Patent WO2016071503 12422-12453 8 0.75
NZ_CP016510_3 3.7|3021819|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021819-3021850 32 LZ998055 JP 2017534684-A/2: Phage Therapy 12422-12453 8 0.75
NZ_CP016510_3 3.8|3021880|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021880-3021911 32 CP001770 Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence 145771-145802 8 0.75
NZ_CP016510_3 3.18|3022490|32|NZ_CP016510|CRISPRCasFinder,CRT 3022490-3022521 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462005-462036 8 0.75
NZ_CP016510_3 3.19|3022433|31|NZ_CP016510|PILER-CR 3022433-3022463 31 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353299-353329 8 0.742
NZ_CP016510_2 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder 3005045-3005076 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
NZ_CP016510_3 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021697-3021728 32 NZ_CP045722 Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence 332-363 9 0.719
NZ_CP016510_3 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021697-3021728 32 NZ_CP022519 Pantoea vagans strain FBS135 plasmid pPant3, complete sequence 62976-63007 9 0.719
NZ_CP016510_3 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021697-3021728 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144976-145007 9 0.719
NZ_CP016510_3 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021941-3021972 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
NZ_CP016510_3 3.10|3022002|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022002-3022033 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
NZ_CP016510_3 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022185-3022216 32 DQ674738 Aeromonas phage phiO18P, complete genome 15707-15738 9 0.719
NZ_CP016510_3 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022185-3022216 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 380725-380756 9 0.719
NZ_CP016510_3 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022185-3022216 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 153785-153816 9 0.719
NZ_CP016510_3 3.14|3022246|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022246-3022277 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
NZ_CP016510_3 3.14|3022246|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022246-3022277 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
NZ_CP016510_3 3.17|3022429|32|NZ_CP016510|CRISPRCasFinder,CRT 3022429-3022460 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
NZ_CP016510_3 3.17|3022429|32|NZ_CP016510|CRISPRCasFinder,CRT 3022429-3022460 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
NZ_CP016510_3 3.17|3022429|32|NZ_CP016510|CRISPRCasFinder,CRT 3022429-3022460 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
NZ_CP016510_3 3.19|3022433|31|NZ_CP016510|PILER-CR 3022433-3022463 31 AM749121 Streptococcus phage M102 complete genome 7893-7923 9 0.71
NZ_CP016510_3 3.19|3022433|31|NZ_CP016510|PILER-CR 3022433-3022463 31 NC_012884 Streptococcus phage M102, complete genome 7893-7923 9 0.71
NZ_CP016510_2 2.1|3004454|32|NZ_CP016510|CRISPRCasFinder,CRT 3004454-3004485 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP016510_2 2.1|3004454|32|NZ_CP016510|CRISPRCasFinder,CRT 3004454-3004485 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP016510_2 2.9|3004515|34|NZ_CP016510|PILER-CR 3004515-3004548 34 MN855803 Bacteriophage sp. isolate 108, partial genome 10055-10088 10 0.706
NZ_CP016510_3 3.1|3021453|32|NZ_CP016510|CRISPRCasFinder,CRT 3021453-3021484 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
NZ_CP016510_3 3.4|3021636|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021636-3021667 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
NZ_CP016510_3 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021941-3021972 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
NZ_CP016510_3 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021941-3021972 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
NZ_CP016510_3 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021941-3021972 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
NZ_CP016510_3 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021941-3021972 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
NZ_CP016510_3 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021941-3021972 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
NZ_CP016510_3 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021941-3021972 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
NZ_CP016510_3 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021941-3021972 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
NZ_CP016510_3 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3021941-3021972 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
NZ_CP016510_3 3.16|3022368|32|NZ_CP016510|CRISPRCasFinder,CRT 3022368-3022399 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
NZ_CP016510_3 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022185-3022216 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 234768-234799 11 0.656
NZ_CP016510_3 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR 3022185-3022216 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 299431-299462 11 0.656

1. spacer 2.15|3004881|28|NZ_CP016510|PILER-CR matches to NC_009927 (Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence) position: , mismatch: 5, identity: 0.821 

gatcgagtaacgtgcgctggaacgcgtc	CRISPR spacer
gattgaggaacgtgcgctggaacgatta	Protospacer
***.*** ****************  *

2. spacer 2.18|3005058|34|NZ_CP016510|PILER-CR matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.824 

ccagaaagtgccggtagtgcctgatgaacgaccg	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatggcg	Protospacer
****  **********************  . **

3. spacer 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatgg	Protospacer
****  **********************  .

4. spacer 2.7|3004820|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***

5. spacer 2.7|3004820|32|NZ_CP016510|CRISPRCasFinder,CRT matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***

6. spacer 2.7|3004820|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***

7. spacer 2.18|3005058|34|NZ_CP016510|PILER-CR matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.794 

ccagaaagtgccggtagtgcctgatgaacgaccg	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatggcg	Protospacer
 ***  **********************  . **

8. spacer 2.18|3005058|34|NZ_CP016510|PILER-CR matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.794 

ccagaaagtgccggtagtgcctgatgaacgaccg	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatggcg	Protospacer
 ***  **********************  . **

9. spacer 2.18|3005058|34|NZ_CP016510|PILER-CR matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.794 

ccagaaagtgccggtagtgcctgatgaacgaccg	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatggcg	Protospacer
 ***  **********************  . **

10. spacer 2.18|3005058|34|NZ_CP016510|PILER-CR matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.794 

ccagaaagtgccggtagtgcctgatgaacgaccg	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatggcg	Protospacer
 ***  **********************  . **

11. spacer 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

12. spacer 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

13. spacer 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

14. spacer 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

15. spacer 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781 

---gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ttcgagc---atgaccggatcggcgctggtgccga	Protospacer
   *.**   **** *************.*****.

16. spacer 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781 

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ggcggcggtgaaaggatcggcggtgatgccgg	Protospacer
**  .* .**** ********* *********

17. spacer 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781 

---gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
ttcgagc---atgaccggatcggcgctggtgccga	Protospacer
   *.**   **** *************.*****.

18. spacer 3.19|3022433|31|NZ_CP016510|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

19. spacer 3.19|3022433|31|NZ_CP016510|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

20. spacer 3.19|3022433|31|NZ_CP016510|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

21. spacer 3.19|3022433|31|NZ_CP016510|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

22. spacer 3.19|3022433|31|NZ_CP016510|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.774 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ctcggcggacgaggagttgctcaaccgcgcc	Protospacer
*   *.************.*********  *

23. spacer 2.2|3004515|32|NZ_CP016510|CRISPRCasFinder,CRT matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75 

gcgaaatagtggggaaaaacccctggttaacc	CRISPR spacer
tttcaatattggggaaaaacccctcgttacct	Protospacer
 .  **** *************** **** *.

24. spacer 2.6|3004759|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75 

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

25. spacer 2.6|3004759|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

tatccacatatacccgcaatcatattcaagaa	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagag	Protospacer
 .*  *. ** ********************.

26. spacer 2.13|3004759|34|NZ_CP016510|PILER-CR matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.765 

tatccacatatacccgcaatcatattcaagaacg	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagagcg	Protospacer
 .*  *. ** ********************.**

27. spacer 2.13|3004759|34|NZ_CP016510|PILER-CR matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765 

tatccacatatacccgcaatcatattcaagaacg	CRISPR spacer
ggtaaatctaaacccgcaatcatattcaagagcg	Protospacer
 .*  *. ** ********************.**

28. spacer 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75 

-gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
cagcggatcc-ttgccggtatagaccagcgtat	Protospacer
 . ** .*.* ********************

29. spacer 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gaattttacgttgccggtgtagaccagtgtca	Protospacer
*   . * **********.********.****

30. spacer 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gaattttacgttgccggtgtagaccagtgtca	Protospacer
*   . * **********.********.****

31. spacer 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
gatccggacgttgccggtattgaacagcgtcc	Protospacer
* . **  ************ ** *******

32. spacer 3.7|3021819|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to LQ277707 (Sequence 2 from Patent WO2016071503) position: , mismatch: 8, identity: 0.75 

----gctcatgtcaaacgccatcagcgttccggcat	CRISPR spacer
aaaggct----gcaaacgccaatagcgttccggcaa	Protospacer
    ***     ********* .************

33. spacer 3.7|3021819|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to LZ998055 (JP 2017534684-A/2: Phage Therapy) position: , mismatch: 8, identity: 0.75 

----gctcatgtcaaacgccatcagcgttccggcat	CRISPR spacer
aaaggct----gcaaacgccaatagcgttccggcaa	Protospacer
    ***     ********* .************

34. spacer 3.8|3021880|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to CP001770 (Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence) position: , mismatch: 8, identity: 0.75 

aatcgccagcctcggaaatattccatcctccg	CRISPR spacer
ggttgccagccccggaagtattccatctccca	Protospacer
..*.*******.*****.*********..**.

35. spacer 3.18|3022490|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

taatggccacagtaagtcaaacggttctggaa	CRISPR spacer
cggtggccacagtaaggcacacggttcggcag	Protospacer
...************* ** ******* * *.

36. spacer 3.19|3022433|31|NZ_CP016510|PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 8, identity: 0.742 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttcagtggacgaggagttcctcacccgcacc	Protospacer
.   ************** **** ****  *

37. spacer 2.22|3005045|32|NZ_CP016510|CRT,CRISPRCasFinder matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcatccagcgccggtagtgccggatgaactca	Protospacer
 **   **.************ *******

38. spacer 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaacttgacgttgccggtatagatcagcgtca	Protospacer
.   .   ***************.********

39. spacer 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaacttgacgttgccggtatagatcagcgtca	Protospacer
.   .   ***************.********

40. spacer 3.5|3021697|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcgcgttcgttgccggtatagaccagcgtca	CRISPR spacer
aaattttacgttgccggtgtagaccagtgtca	Protospacer
.   . * **********.********.****

41. spacer 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
tcctcctggacaggctgaccgttgacgatctg	Protospacer
     **..**** *********** ******

42. spacer 3.10|3022002|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719 

accggacaaatcttttttttcctgttcctgtt	CRISPR spacer
gcatcattaatcctttttttcctgttactgta	Protospacer
.*   *. ****.************* ****

43. spacer 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to DQ674738 (Aeromonas phage phiO18P, complete genome) position: , mismatch: 9, identity: 0.719 

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cagtttgctgaactgctcggcgctgatgccgg	Protospacer
 .*. .  ***** * ****************

44. spacer 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719 

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cctgacggtgaaccggtcggcgctgatgccgc	Protospacer
    ** .***** *.***************

45. spacer 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719 

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
cagggcgtcgaactgatcggcgctcatgccgg	Protospacer
 .* .*  .**** ********** *******

46. spacer 3.14|3022246|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719 

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******...

47. spacer 3.14|3022246|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719 

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******...

48. spacer 3.17|3022429|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
gttcagtggacgaggagttcctcacccgcacc	Protospacer
 .   ************** **** ****  *

49. spacer 3.17|3022429|32|NZ_CP016510|CRISPRCasFinder,CRT matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719 

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

50. spacer 3.17|3022429|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719 

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

51. spacer 3.19|3022433|31|NZ_CP016510|PILER-CR matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.71 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
tgggctggaccaggagttactccaccgcctt	Protospacer
.*.  ***** *********** *****. .

52. spacer 3.19|3022433|31|NZ_CP016510|PILER-CR matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.71 

cgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
tgggctggaccaggagttactccaccgcctt	Protospacer
.*.  ***** *********** *****. .

53. spacer 2.1|3004454|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688 

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****

54. spacer 2.1|3004454|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688 

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****

55. spacer 2.9|3004515|34|NZ_CP016510|PILER-CR matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 10, identity: 0.706 

gcgaaatagtggggaaaaacccctggttaacccg	CRISPR spacer
tttcaatattggggaaaaacccctcgttacctga	Protospacer
 .  **** *************** **** *. .

56. spacer 3.1|3021453|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

atcttcatattgcgtgacgctgccgatgaacg	CRISPR spacer
tgccggatatggcgtgacgatgccgatgatgt	Protospacer
  *.  **** ******** *********

57. spacer 3.4|3021636|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tgcccgttctgcctcttcgcactctcgatcaa	CRISPR spacer
tgcccgttctgtctcttggcactgccaccttc	Protospacer
***********.***** ***** .*. ..

58. spacer 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

59. spacer 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

60. spacer 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

61. spacer 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

62. spacer 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

63. spacer 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

64. spacer 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

65. spacer 3.9|3021941|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688 

aggaactaaacagcctgaccgttgaggatctg	CRISPR spacer
ggtttaccgacagcctgacggttgacgatctg	Protospacer
.*    . .********** ***** ******

66. spacer 3.16|3022368|32|NZ_CP016510|CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688 

gtggtggcctcaaataaattcgagcgctggag	CRISPR spacer
aaacttgcctcaaataaattcgcgcggtgttc	Protospacer
. . * **************** *** **

67. spacer 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 11, identity: 0.656 

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
atagactaggagcggatcggcgctgatcggaa	Protospacer
. . **** **.***************   ..

68. spacer 3.13|3022185|32|NZ_CP016510|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 11, identity: 0.656 

gggcactatgaacggatcggcgctgatgccgg	CRISPR spacer
atagactaggagcggatcggcgctgatcggaa	Protospacer
. . **** **.***************   ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 371624 : 415220 67 Enterobacteria_phage(44.62%) protease,terminase,coat,portal,lysis,integrase attL 375471:375516|attR 414736:414781
DBSCAN-SWA_2 1019446 : 1027469 10 Dickeya_phage(14.29%) protease,transposase NA
DBSCAN-SWA_3 1078078 : 1176037 108 Salmonella_phage(45.76%) tail,protease,terminase,transposase,portal,lysis,tRNA NA
DBSCAN-SWA_4 1963897 : 1972517 17 Salmonella_phage(28.57%) integrase attL 1960573:1960595|attR 1970286:1970308
DBSCAN-SWA_5 2075160 : 2085761 13 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_6 2171756 : 2182262 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_7 2250538 : 2259709 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 2331759 : 2345510 14 Salmonella_phage(38.46%) protease,holin,tail,head NA
DBSCAN-SWA_9 3138836 : 3145185 8 uncultured_Caudovirales_phage(33.33%) tRNA NA
DBSCAN-SWA_10 4333036 : 4353933 26 Burkholderia_phage(45.0%) plate,tail NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP016512
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016512_1 23661-23780 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 63874-63907 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 64169-64202 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 38215-38248 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 37006-37039 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP010164 Escherichia coli strain H2 plasmid A, complete sequence 20751-20784 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 239581-239614 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP022964 Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence 30266-30299 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP024467 Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence 17630-17663 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 16611-16644 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 53074-53107 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 32601-32634 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 1762-1795 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 23725-23758 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 35337-35370 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 26770-26803 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 41390-41423 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 60962-60995 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 39391-39424 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032389 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence 9889-9922 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_LT904873 Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2 5696-5729 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_KT754163 Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence 12265-12298 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 7366-7399 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP020836 Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence 20407-20440 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 93494-93527 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP043216 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence 32193-32226 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 25537-25570 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP031361 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence 27033-27066 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 25749-25782 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 2187-2220 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP033386 Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence 34721-34754 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 4942-4975 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 47580-47613 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 14631-14664 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP047339 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence 28949-28982 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_010860 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence 32623-32656 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP022453 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence 5893-5926 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 53536-53569 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 39815-39848 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP005994 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence 30028-30061 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 29110-29143 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 14497-14530 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 58667-58700 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP029061 Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence 10786-10819 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 29459-29492 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 79278-79311 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 54169-54202 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 29459-29492 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 61147-61180 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 99797-99830 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 88012-88045 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 41949-41982 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 53619-53652 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 32551-32584 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP010127 Escherichia coli strain C8 plasmid B, complete genome 33248-33281 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 85971-86004 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP022072 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence 18650-18683 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 20398-20431 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 147056-147089 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 35339-35372 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032394 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence 32800-32833 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 2112-2145 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 16816-16849 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 68260-68293 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 90-123 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 33434-33467 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 96892-96925 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 63333-63366 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 238663-238696 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 37880-37913 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 22155-22188 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 28203-28236 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 18380-18413 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 118004-118037 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 151970-152003 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 243053-243086 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 241163-241196 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP025558 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence 11939-11972 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 90443-90476 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 43726-43759 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 48918-48951 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 33352-33385 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 58347-58380 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 61256-61289 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 61256-61289 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 27964-27997 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 61256-61289 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 43736-43769 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 80789-80822 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT219822 Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence 38970-39003 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 73817-73850 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 18865-18898 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 14942-14975 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP016575 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence 296-329 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 30572-30605 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032994 Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence 10049-10082 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MN783746 Escherichia coli plasmid pIncX1_p1, complete sequence 5290-5323 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 40397-40430 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_KU254580 Escherichia coli strain YD786 plasmid pYD786-3, complete sequence 25507-25540 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 38916-38949 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 67739-67772 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 35028-35061 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 69102-69135 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP037995 Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281 7255-7288 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 9971-10004 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP016580 Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence 23703-23736 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 49989-50022 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 56470-56503 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP029182 Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence 2302-2335 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 90173-90206 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP053047 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence 9874-9907 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP014974 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence 295-328 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 220331-220364 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 12757-12790 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP044182 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence 25543-25576 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP042608 Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence 7171-7204 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 45261-45294 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_019046 Escherichia coli plasmid pNMEC31_31, complete sequence 31361-31394 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 89191-89224 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 30748-30781 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 28493-28526 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 5878-5911 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_024961 Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence 905-938 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_021842 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence 4017-4050 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_LT985261 Escherichia coli strain 657 plasmid RCS50_p, complete sequence 42585-42618 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_AP019678 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence 49115-49148 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP009074 Escherichia coli ATCC 25922 plasmid unnamed, complete sequence 21137-21170 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 25682-25715 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_010378 Escherichia coli plasmid pOLA52, complete sequence 34562-34595 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 23704-23737 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP016529 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence 23704-23737 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP016518 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence 23705-23738 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 50710-50743 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 23885-23918 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP012922 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence 23704-23737 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP033093 Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence 19532-19565 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 37369-37402 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP023360 Escherichia coli strain 1943 plasmid p54, complete sequence 52726-52759 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 37807-37840 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP039600 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence 32872-32905 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 49947-49980 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 70648-70681 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_017624 Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence 23689-23722 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 15569-15602 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP024290 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence 33653-33686 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 1446-1479 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 4799-4832 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050773 Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence 30707-30740 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 38005-38038 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 24566-24599 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050765 Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence 6593-6626 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 59434-59467 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050759 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence 5734-5767 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_AP022652 Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence 295-328 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP024136 Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence 79478-79511 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_LT985315 Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence 47119-47152 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MN436006 Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence 27492-27525 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MN436007 Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence 27131-27164 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 44664-44697 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 48284-48317 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 12454-12487 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 43402-43435 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT197111 Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence 12897-12930 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 59284-59317 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 118931-118964 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 MT219821 Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence 3734-3767 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 29004-29037 0 1.0
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 159-192 1 0.971
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 78450-78483 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP050780 Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence 203947-203980 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP022061 Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence 1711-1744 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 CP048927 Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence 45611-45644 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 98434-98467 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP028313 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence 41569-41602 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP018662 Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence 41992-42025 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 CP049987 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence 41386-41419 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 CP049982 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence 42740-42773 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NC_010421 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence 27662-27695 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_MK625201 Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence 41824-41857 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP023476 Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence 33473-33506 2 0.941
NZ_CP016512_1 1.1|23704|34|NZ_CP016512|CRISPRCasFinder 23704-23737 34 NZ_CP044292 Escherichia coli strain P43A plasmid pP43A-1, complete sequence 44259-44292 4 0.882

1. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

2. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

3. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

4. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

5. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP010164 (Escherichia coli strain H2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

6. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

7. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP022964 (Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

8. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP024467 (Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

9. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

10. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

11. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

12. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

13. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

14. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

15. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

16. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

17. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

18. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

19. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032389 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

20. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_LT904873 (Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

21. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_KT754163 (Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

22. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

23. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP020836 (Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

24. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

25. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP043216 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

26. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

27. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP031361 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

28. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

29. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

30. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP033386 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

31. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

32. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

33. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

34. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP047339 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

35. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_010860 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

36. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP022453 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

37. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

38. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

39. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP005994 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

40. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

41. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

42. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

43. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP029061 (Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

44. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

45. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

46. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

47. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

48. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

49. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

50. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

51. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

52. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

53. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

54. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP010127 (Escherichia coli strain C8 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

55. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

56. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP022072 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

57. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

58. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

59. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

60. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032394 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

61. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

62. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

63. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

64. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

65. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

66. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

67. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

68. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

69. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

70. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

71. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

72. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

73. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

74. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

75. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

76. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

77. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP025558 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

78. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

79. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

80. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

81. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

82. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

83. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

84. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

85. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

86. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

87. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

88. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

89. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT219822 (Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

90. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

91. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

92. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

93. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP016575 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

94. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

95. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032994 (Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

96. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MN783746 (Escherichia coli plasmid pIncX1_p1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

97. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

98. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_KU254580 (Escherichia coli strain YD786 plasmid pYD786-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

99. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

100. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

101. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

102. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

103. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP037995 (Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

104. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP053740 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

105. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP016580 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

106. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

107. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

108. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP029182 (Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

109. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

110. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

111. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP014974 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

112. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

113. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

114. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP044182 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

115. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP042608 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

116. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

117. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_019046 (Escherichia coli plasmid pNMEC31_31, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

118. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

119. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

120. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP035315 (Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

121. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050748 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

122. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_024961 (Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

123. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_021842 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

124. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_LT985261 (Escherichia coli strain 657 plasmid RCS50_p, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

125. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_AP019678 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

126. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP009074 (Escherichia coli ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

127. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

128. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_010378 (Escherichia coli plasmid pOLA52, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

129. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to CP016512 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

130. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP016529 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

131. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP016518 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

132. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

133. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

134. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP012922 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

135. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP033093 (Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

136. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP012926 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

137. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP023360 (Escherichia coli strain 1943 plasmid p54, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

138. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

139. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP039600 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

140. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

141. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

142. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_017624 (Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

143. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

144. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP024290 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

145. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

146. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

147. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050773 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

148. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

149. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

150. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050765 (Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

151. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

152. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050759 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

153. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_AP022652 (Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

154. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP024136 (Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

155. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_LT985315 (Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

156. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

157. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

158. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

159. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

160. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

161. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

162. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

163. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

164. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

165. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

166. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

167. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP030195 (Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence) position: , mismatch: 1, identity: 0.971 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtgattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

168. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

169. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
******************************* .*

170. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP022061 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

171. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to CP048927 (Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

172. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

173. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP028313 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

174. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP018662 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

175. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to CP049987 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

176. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to CP049982 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

177. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NC_010421 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

178. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_MK625201 (Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

179. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP023476 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence) position: , mismatch: 2, identity: 0.941 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatgggtacgcac	Protospacer
************************** *.*****

180. spacer 1.1|23704|34|NZ_CP016512|CRISPRCasFinder matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 4, identity: 0.882 

ctgtaattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgttcga	Protospacer
*****************************. *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage