Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 0 crisprs PrimPol 0 0 3 0
NZ_CP013854 Pseudonocardia sp. HH130630-07, complete genome 8 crisprs csa3,WYL,cas6e,cas5,cas7,cas3,DEDDh,DinG,RT 0 3 17 0

Results visualization

1. NZ_CP013855
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14 : 217601 103 Tupanvirus(14.81%) transposase NA
DBSCAN-SWA_2 241104 : 278347 42 Mycobacterium_phage(38.46%) integrase,transposase attL 233926:233942|attR 276664:276680
DBSCAN-SWA_3 294386 : 359803 53 Mycobacterium_phage(16.67%) protease,transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP013854
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013854_1 316352-316451 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013854_2 1333943-1334214 Orphan I-C,I-E,II-B
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013854_3 2005583-2005681 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013854_4 2724048-2724251 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013854_5 2943069-2943171 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013854_6 3492214-3492321 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013854_7 4266650-4266746 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013854_8 5273173-5273261 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NC_014035 Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence 92082-92113 6 0.812
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP048421 Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence 121819-121850 7 0.781
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_AP022338 Mameliella alba strain KU6B plasmid pKUB257, complete sequence 75208-75239 7 0.781
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NZ_CP044987 Deinococcus sp. AJ005 plasmid p96k, complete sequence 24903-24933 7 0.774
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NC_013852 Allochromatium vinosum DSM 180 plasmid pALVIN01, complete sequence 48973-49003 7 0.774
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1138325-1138356 8 0.75
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 135679-135710 8 0.75
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 MK660713 Microbacterium phage Theresita, complete genome 10954-10985 8 0.75
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 658587-658617 8 0.742
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 437975-438005 8 0.742
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 957938-957969 9 0.719
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 121246-121277 9 0.719
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 284344-284375 9 0.719
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 413010-413041 9 0.719
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2141921-2141952 9 0.719
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 567862-567893 9 0.719
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 205685-205715 9 0.71
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2281089-2281119 9 0.71
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 471309-471339 9 0.71
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 634405-634435 9 0.71
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 487153-487183 9 0.71
NZ_CP013854_2 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder 1334094-1334124 31 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 543741-543771 9 0.71
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 891952-891983 10 0.688
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 951030-951061 10 0.688
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1395359-1395390 10 0.688
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1395303-1395334 10 0.688
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 883291-883322 10 0.688
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 51836-51867 10 0.688
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 179093-179124 10 0.688
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5898309-5898340 10 0.688
NZ_CP013854_2 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1333972-1334003 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 270865-270896 10 0.688
NZ_CP013854_2 2.2|1334033|32|NZ_CP013854|PILER-CR,CRISPRCasFinder 1334033-1334064 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 359072-359103 10 0.688

1. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NC_014035 (Rhodobacter capsulatus SB 1003 plasmid pRCB133, complete sequence) position: , mismatch: 6, identity: 0.812 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
gggcggccaggccgacgaagccgatcaggcca	Protospacer
  ***************  ********** *.

2. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP048421 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
cccggaagagggcgacgtcgccgatcagggcg	Protospacer
**  *.  *** ******.*************

3. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
cgacggccaggacgaccttgccgatctgttcg	Protospacer
* .******** **** ********* *  **

4. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NZ_CP044987 (Deinococcus sp. AJ005 plasmid p96k, complete sequence) position: , mismatch: 7, identity: 0.774 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
aggtctgctgggcgagcccgcgcagcgtggg	Protospacer
.*.** . *** ******************

5. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NC_013852 (Allochromatium vinosum DSM 180 plasmid pALVIN01, complete sequence) position: , mismatch: 7, identity: 0.774 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
gtccccattggtcgagctcgcgcagcatggc	Protospacer
*  .* * *********.********.****

6. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
agttggcctggccgaggttgccgatcaggccc	Protospacer
   .**** ****** ************* *

7. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tcatggcaaggccgacattgccgatcatgccc	Protospacer
.*..*** ********.********** * *

8. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to MK660713 (Microbacterium phage Theresita, complete genome) position: , mismatch: 8, identity: 0.75 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
cgaccacctggccgatgttgccgatcaggccc	Protospacer
* .* .** ******.************* *

9. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
acagggagtagtcgagcccgcacagcgtcgt	Protospacer
. *  ****.***********.****** *.

10. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
acagggagtagtcgagcccgcacagcgtcgt	Protospacer
. *  ****.***********.****** *.

11. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
cgacggccacgccgaccttgccgatcctgcgc	Protospacer
* .****** ****** *********  *

12. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tgtccttcaggccgccgttgccggtcagggtg	Protospacer
.  *  .******* ********.******.*

13. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tgtccttcaggccgccgttgccggtcagggtg	Protospacer
.  *  .******* ********.******.*

14. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tgtccttcaggccgccgttgccggtcagggtg	Protospacer
.  *  .******* ********.******.*

15. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tgccatgcaggccgccgctgccgatcaggggg	Protospacer
.  *.  ******* **.************ *

16. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 9, identity: 0.719 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tcttggccaggctggcgttgccgatcacgtgc	Protospacer
.* .********.*.************ *

17. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 9, identity: 0.71 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
ccggcagctgggccagcccgcgcagcgtggc	Protospacer
  . *.. *** * *****************

18. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
cgcgggagtggtcgaccgcgcgcagcgtccg	Protospacer
 *   ********** * **********

19. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.71 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
ccggcagctgggccagcccgcgcagcgtggc	Protospacer
  . *.. *** * *****************

20. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
ccggcagctgggccagcccgcgcagcgtggc	Protospacer
  . *.. *** * *****************

21. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
ccggcagctgggccagcccgcgcagcgtggc	Protospacer
  . *.. *** * *****************

22. spacer 2.5|1334094|31|NZ_CP013854|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.71 

ggatcgagtggtcgagcccgcgcagcgtggc	CRISPR spacer
ccggcagctgggccagcccgcgcagcgtggc	Protospacer
  . *.. *** * *****************

23. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tttcggccaggccggcgttgccgctcgctcct	Protospacer
.. ***********.******** **.   *

24. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tttcggccaggccggcgttgccgctcgctcct	Protospacer
.. ***********.******** **.   *

25. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tttcggccaggccggcgttgccgctcgctcct	Protospacer
.. ***********.******** **.   *

26. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tttcggccaggccggcgttgccgctcgctcct	Protospacer
.. ***********.******** **.   *

27. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tttcggccaggccggcgttgccgctcgctcct	Protospacer
.. ***********.******** **.   *

28. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
agagcgccaggtcgacgttgcggatcagttcc	Protospacer
  .  ******.********* ******  *

29. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tgttcttcaggccgccgttgccggtcagggtg	Protospacer
.  .  .******* ********.******.*

30. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
ggtggaccaggccggcgttggcgatcaggagc	Protospacer
    *.********.***** ********.

31. spacer 2.1|1333972|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ccgcggccaggccgacgttgccgatcagggcg	CRISPR spacer
tgttcttcaggccgccgttgccggtcagggtg	Protospacer
.  .  .******* ********.******.*

32. spacer 2.2|1334033|32|NZ_CP013854|PILER-CR,CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcccgtacagcgtgtgtacgaggagcggcac	CRISPR spacer
gcgccgtgcagcgggtgtacgaggagtacgcc	Protospacer
   ****.***** ************..   *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 986819 : 1099499 85 Paenibacillus_phage(16.67%) transposase,protease,tRNA NA
DBSCAN-SWA_2 1139502 : 1163598 15 Paenibacillus_phage(50.0%) transposase NA
DBSCAN-SWA_3 1765581 : 1865892 91 Paenibacillus_phage(27.27%) transposase,tRNA,integrase attL 1823861:1823877|attR 1852894:1852910
DBSCAN-SWA_4 2015576 : 2070247 55 Paenibacillus_phage(28.57%) transposase,protease NA
DBSCAN-SWA_5 2221381 : 2283769 56 Paenibacillus_phage(12.5%) transposase,protease NA
DBSCAN-SWA_6 2600351 : 2672504 59 Paenibacillus_phage(21.05%) transposase,protease,tRNA NA
DBSCAN-SWA_7 2686845 : 2727430 38 Tupanvirus(33.33%) holin,transposase,protease,tRNA NA
DBSCAN-SWA_8 3029711 : 3057857 28 Paenibacillus_phage(25.0%) holin,transposase,protease NA
DBSCAN-SWA_9 3320333 : 3374814 54 Bacillus_phage(18.18%) transposase,protease,tRNA NA
DBSCAN-SWA_10 3469676 : 3566380 48 Streptomyces_phage(28.57%) transposase,protease NA
DBSCAN-SWA_11 3599375 : 3647189 39 Mycobacterium_phage(40.0%) transposase,integrase attL 3599069:3599087|attR 3639275:3639293
DBSCAN-SWA_12 3665303 : 3703108 29 Shigella_phage(33.33%) transposase NA
DBSCAN-SWA_13 3943648 : 3984811 36 Streptococcus_phage(14.29%) transposase,protease NA
DBSCAN-SWA_14 4067384 : 4287849 175 Bacillus_phage(17.5%) transposase,protease NA
DBSCAN-SWA_15 4291108 : 4326527 32 Paenibacillus_phage(40.0%) transposase,protease,tRNA NA
DBSCAN-SWA_16 4974035 : 5091213 97 Paenibacillus_phage(16.67%) transposase,protease,tRNA NA
DBSCAN-SWA_17 5116286 : 5179857 59 Shigella_phage(22.22%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage