1. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 12.7|3938383|20|NZ_CP016794|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 1, identity: 0.95
gcggtgggcagcgtcggcac CRISPR spacer
gcggtgggcagcgtcggcag Protospacer
*******************
9. spacer 1.10|336937|24|NZ_CP016794|CRT matches to AWQW01000318 (Streptomyces niveus NCIMB 11891 plasmid pSniv4, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.917
ccgttgccgatgagcccgccggcg CRISPR spacer
ccggtgcggatgagcccgccggcg Protospacer
*** *** ****************
10. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
14. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
15. spacer 5.3|1573973|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
16. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
17. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
18. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
19. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
20. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
24. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
25. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
26. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
27. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
28. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
29. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
30. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
31. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
32. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
33. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
34. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
35. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
36. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
37. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
38. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
39. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
41. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
42. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
43. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
gcgttgcggctgagcccgccggcg Protospacer
****** * **************
44. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
45. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
46. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
47. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
48. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
49. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
50. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
51. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
52. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
53. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
54. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
55. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
56. spacer 1.10|336937|24|NZ_CP016794|CRT matches to MT188704 (Mesorhizobium phage Cp1R7A-A1, complete genome) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgccgatgcgcccgccgaca Protospacer
************ ********.*.
57. spacer 1.10|336937|24|NZ_CP016794|CRT matches to KR080200 (Mycobacterium phage AlanGrant, complete genome) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
tcgttgccgatgaccccgccgccg Protospacer
.************ ******* **
58. spacer 1.10|336937|24|NZ_CP016794|CRT matches to KR080194 (Mycobacterium phage Vincenzo, complete genome) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
tcgttgccgatgaccccgccgccg Protospacer
.************ ******* **
59. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
60. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
61. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
62. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
63. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
64. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
65. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
66. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
67. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
68. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgatgccgatgatcccgccggcc Protospacer
*** ********* *********
69. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
70. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
71. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
72. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
73. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
74. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
gcgttgcggctgagcccgccggcg Protospacer
****** * **************
75. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
76. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
tcgttgccgatcagcccgcgggcg Protospacer
.********** ******* ****
77. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
78. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
79. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
80. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
81. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
82. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
83. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
84. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
85. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
86. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
87. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
88. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
89. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
90. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
91. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 4, identity: 0.833
ccgttgccgatgagcccgccggcg CRISPR spacer
gctgcgccgatgagcccgccggcg Protospacer
* .*******************
92. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
93. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
94. spacer 2.7|365252|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
95. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
96. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
97. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
98. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
99. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
100. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
101. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
102. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
103. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
104. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
105. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
106. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
107. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
108. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
109. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
110. spacer 5.14|1574789|25|NZ_CP016794|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
111. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
112. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
113. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
114. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
115. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
116. spacer 2.7|365252|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
117. spacer 2.7|365252|27|NZ_CP016794|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
118. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
119. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
120. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
121. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
122. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
123. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
124. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
125. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
126. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
127. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
128. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
129. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
130. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
131. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
132. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
133. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
134. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
135. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
136. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
137. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
138. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
139. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
140. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
141. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
142. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
143. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
144. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
145. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
146. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
147. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
148. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
149. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
150. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
151. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
152. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
153. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
154. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
155. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
156. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
157. spacer 5.13|1574723|34|NZ_CP016794|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
158. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.848
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cggcgccggcggcagcgccggcgccggcagtat Protospacer
*** **********.*************.*. *
159. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 5, identity: 0.848
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cgctgccggccgcaacgacggcgccggcggccg Protospacer
** ****** ****** **************
160. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
161. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
162. spacer 2.7|365252|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
163. spacer 2.9|365402|27|NZ_CP016794|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
164. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
165. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
166. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
167. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
168. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
169. spacer 3.2|629488|30|NZ_CP016794|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
170. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
171. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
172. spacer 3.2|629488|30|NZ_CP016794|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
173. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
174. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
175. spacer 3.2|629488|30|NZ_CP016794|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
176. spacer 3.2|629488|30|NZ_CP016794|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
177. spacer 3.2|629488|30|NZ_CP016794|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
178. spacer 3.2|629488|30|NZ_CP016794|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
179. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
180. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
181. spacer 3.2|629488|30|NZ_CP016794|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
182. spacer 3.2|629488|30|NZ_CP016794|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
183. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
184. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
185. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
186. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
187. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
188. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
189. spacer 5.13|1574723|34|NZ_CP016794|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
190. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.818
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
aggcaccggcggcaacggcggcggcggcggctt Protospacer
** .************ ***** *******.*
191. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ctgggccggcggcaacgtcggcgccggtgccaa Protospacer
* ***************.*********.* *
192. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.818
cggggccg-----gcggcaacgccggcgccggcggcct CRISPR spacer
-----ccgccagcgcggcaacgccggcgccgccggcct Protospacer
*** ****************** ******
193. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ctgggccggcggcaacgtcggcgccggtgccaa Protospacer
* ***************.*********.* *
194. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ctgggccggcggcaacgtcggcgccggtgccaa Protospacer
* ***************.*********.* *
195. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ctgggccggcggcaacgtcggcgccggtgccaa Protospacer
* ***************.*********.* *
196. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 6, identity: 0.818
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ccgccccggcggccacgccgccgccggcggccg Protospacer
* * ******** ****** ***********
197. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.818
cggggccggcggcaacgccggcgccggcggcct- CRISPR spacer
cggggccgggggcatcgccggcg-cgacggtcac Protospacer
********* **** ******** **.***.*
198. spacer 2.4|365051|27|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
199. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
200. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
201. spacer 3.2|629488|30|NZ_CP016794|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
202. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
203. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
204. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
205. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
206. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
207. spacer 3.2|629488|30|NZ_CP016794|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
208. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
209. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
210. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
211. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
212. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
213. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
214. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
215. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
216. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
217. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
218. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
219. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
220. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
221. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
222. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
223. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
224. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
225. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
226. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
227. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
228. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
229. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
230. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
231. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttgagatccgcgacgatgggtgtggcgccggc Protospacer
** .********.**** ***********
232. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttcccgcaggcgacggtgcgggcggcgccggc Protospacer
**..* * ********* ***.*********
233. spacer 12.6|3938320|38|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.816
accggcggagcggccggagccggcggggccggtggcgc- CRISPR spacer
cccggcggagcgggcggagccggcggcg-cagtggcagg Protospacer
************ ************ * *.*****.
234. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.788
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
aagtctcggcggaaacgccggcgccggcggccg Protospacer
.* .****** *******************
235. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.788
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cggcgccggcggcaacgtcggcgccgaatacgt Protospacer
*** *************.********. .* *
236. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 7, identity: 0.788
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
caagagcggcggcaaggccgacgccggcggcca Protospacer
*..*. ********* ****.***********
237. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788
cggggccg-----gcggcaacgccggcgccggcggcct CRISPR spacer
-----ccgccagcgcggcaacgccggcgccgcgggcct Protospacer
*** ****************** *****
238. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
239. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
240. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
241. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
242. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
243. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
244. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
245. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
246. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
247. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
248. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
249. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
250. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
251. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
252. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
253. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
254. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
255. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
256. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
257. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
258. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agcgcggccgcgtcggtgggggtggcgcccgc Protospacer
. * ***** **************** **
259. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcaccaccgcggcggtgcgggtggcgccggc Protospacer
. . *. *****.***** *************
260. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
gggcacgggcggcaacggcggcgcaggcggcgc Protospacer
** .* ********** ****** ****** .
261. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
gggcaacggcggcaacggcggcgacggcggtcg Protospacer
** . *********** ***** ******.*
262. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
tgaggccggcggcaacgcccacgccggtgaaca Protospacer
.*.**************** .******.*. *
263. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
tccgcgcggcggcaacgccggcggcggtggcca Protospacer
. * ***************** ***.****
264. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP011920 (Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
gccggctgccggcaacgccggcgccggcgtcgg Protospacer
***.* ******************** *
265. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
aagtctcggcggaaacgtcggcgccggcggccg Protospacer
.* .****** ****.**************
266. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
gcacgccgccgacaacgccggcgccggcgcgct Protospacer
. **** **.***************** **
267. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
agcacccgccggcaaagccggcgccggcgggca Protospacer
* . *** ****** ************** *
268. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
catcgccggcgtcaacgccgtcgccggctggcc Protospacer
*. ******* ******** ******* * *.
269. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccgg--cggcct CRISPR spacer
gcccgccggcggcagtgccggcgccggctcggc-- Protospacer
**********..*********** ****
270. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cggacgcgtcggcaacgccggcgctggcgggaa Protospacer
***. ** ***************.*****
271. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 8, identity: 0.758
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cgccacgggtggcaacgccggcggcggcggctc Protospacer
** .* **.************* *******..
272. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
273. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
274. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
275. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
276. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
277. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
278. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
279. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
280. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
281. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
282. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
283. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
284. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
285. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
286. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
287. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
288. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
289. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
290. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcccccggcgtgacggtggaggtggcgccggc Protospacer
...*. **.********.************
291. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
292. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
293. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
294. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gtggcggtggcggcggtgggggtggcggcggc Protospacer
* * . ***.************** ****
295. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tgcgaccgggcgacggtggaggtggcgccagc Protospacer
* . .* **********.*********.**
296. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
caacattcagcgacggtgggtgtggcggcggc Protospacer
. . *.* *********** ****** ****
297. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcacgacggcggcggtgcgggtggcgccggc Protospacer
. . * * ***.***** *************
298. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cccggccggcggcaaggccggcaccggattcaa Protospacer
* ************ ******.**** *
299. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cggtgccggcggcaaggccggcgcggagaccgc Protospacer
*** *********** ******** *. . * .
300. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
aggggccggcggccacgccggcccccacccacc Protospacer
************ ******** ** .* *.
301. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ttcggccggcggcaatgccggcggcggcgatgc Protospacer
. ************.******* *****.. .
302. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MH617086 (Microviridae sp. isolate ctcc904, complete genome) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
accaggcggcggcaccgccgccgccggcggcac Protospacer
.* ******** ***** ********** .
303. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
tcatgccggcggcaaggccggcgacggcgcctg Protospacer
. . *********** ******* ***** *.
304. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ggaagacggcggccacgcccgcgccggcggtga Protospacer
*..* ******* ***** **********.
305. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cgccctgggcggcaacgccgcggccggcggctg Protospacer
** . ************* *********.
306. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cgccctgggcggcaacgccgcggccggcggctg Protospacer
** . ************* *********.
307. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
tccgcgtggcggcaacgccggcggtggcggcca Protospacer
. * .**************** .*******
308. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
aagcagcggcggcaacaccggcgccgtcggcgc Protospacer
.* . **********.********* **** .
309. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
tccgcgtggcggcaacgccggcggtggcggcca Protospacer
. * .**************** .*******
310. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP011809 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-2, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
tggcaatggcggcaacgccggcagcggcggcag Protospacer
.** . .***************. *******
311. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ccgcgctggcggcaacgtcggcgccggccatgg Protospacer
* * **.**********.********** ..
312. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
tcgatccggcggctacaccggcgccggcgccgc Protospacer
. *. ******** **.************ * .
313. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ccgcgctggcggcaacgtcggcgccggccatgg Protospacer
* * **.**********.********** ..
314. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ggcgtccggcggcaacggcggcgcgggcgcagc Protospacer
* * ************ ****** **** .
315. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
gcggaacggcggcaacgccgacgtcggcggaac Protospacer
**. **************.**.****** .
316. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 9, identity: 0.727
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ggcgtccggcggcaacggcggcgcgggcgcagc Protospacer
* * ************ ****** **** .
317. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
318. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
319. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
320. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
321. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
322. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
323. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
324. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
325. spacer 5.13|1574723|34|NZ_CP016794|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
326. spacer 8.9|3115735|35|NZ_CP016794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
327. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
aggacggccgcggcggtggcggtggcgccgta Protospacer
* *****.****** **********
328. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ctgctggccgcgacggtgctggtggcgccgat Protospacer
.* .. *********** **********..
329. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tcgcggatcgggatggtgggggtggcgccgga Protospacer
*. . .** **.*****************
330. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcgagggcggcgacggtgggcgtgtcgccggc Protospacer
. * *********** *** *******
331. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 10, identity: 0.697
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ataccccggcggcaagggcggcgccggcgtcta Protospacer
. ********** * *********** *.
332. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 10, identity: 0.697
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
cggggcaggcggcaacgccggggccaagtatgg Protospacer
****** ************** ***.. ..
333. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 10, identity: 0.697
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
tcagttcggcggcaccgccgacgccggcggtgc Protospacer
. .* .******** *****.*********. .
334. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcagcagcgcgacggtgtcggtggcgccggt Protospacer
. . . ********** ***********.
335. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 11, identity: 0.667
-cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ccggcgccggcgccggcgctgccggcggccatc- Protospacer
*** ******* *..***.* ** **** ..*
336. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_016591 (Burkholderia sp. YI23 plasmid byi_2p, complete sequence) position: , mismatch: 11, identity: 0.667
-cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ccggcgccggcgccggcgctgccggcggccatc- Protospacer
*** ******* *..***.* ** **** ..*
337. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MH617086 (Microviridae sp. isolate ctcc904, complete genome) position: , mismatch: 11, identity: 0.667
-cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
gaaccgccggcggcggcggtgccgccggcggcg- Protospacer
. *********..** .* **********
338. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.667
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
ataccatggcggcaactccggcggcggcggcgg Protospacer
. .********* ****** *******
339. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.667
cggggccggcggcaacgccggcgccggcggcct CRISPR spacer
acctcccggcgggaccgccggcgccggcgaagc Protospacer
******* * **************. .