Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016794 Mycobacterium tuberculosis strain SCAID 320.0 chromosome, complete genome 14 crisprs csa3,c2c9_V-U4,cas3,DinG,WYL,cas4,DEDDh,csm3gr7,csm2gr11,cas10,cas6 12 25 2 0

Results visualization

1. NZ_CP016794
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_1 336097-337065 Orphan NA
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_2 364823-365521 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_3 629434-629571 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_4 690172-690248 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_5 1573827-1574899 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_6 1638520-1638746 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_7 2072321-2072575 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_8 3115107-3116254 TypeIII II-B,III-A
15 spacers
csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_9 3659573-3659691 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_10 3741861-3742437 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_11 3851842-3851931 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_12 3937932-3938590 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_13 3944098-3944394 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016794_14 4105762-4105850 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP016794_9 9.1|3659603|59|NZ_CP016794|CRISPRCasFinder 3659603-3659661 59 NZ_CP016794.1 3659666-3659724 0 1.0
NZ_CP016794_3 3.1|629452|18|NZ_CP016794|CRT 629452-629469 18 NZ_CP016794.1 23824-23841 1 0.944
NZ_CP016794_3 3.1|629452|18|NZ_CP016794|CRT 629452-629469 18 NZ_CP016794.1 1411198-1411215 1 0.944
NZ_CP016794_3 3.3|629536|18|NZ_CP016794|CRT 629536-629553 18 NZ_CP016794.1 971407-971424 1 0.944
NZ_CP016794_7 7.2|2072402|18|NZ_CP016794|CRT 2072402-2072419 18 NZ_CP016794.1 399405-399422 1 0.944
NZ_CP016794_7 7.2|2072402|18|NZ_CP016794|CRT 2072402-2072419 18 NZ_CP016794.1 605585-605602 1 0.944
NZ_CP016794_7 7.4|2072492|18|NZ_CP016794|CRT 2072492-2072509 18 NZ_CP016794.1 3441493-3441510 1 0.944
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP016794.1 148584-148607 2 0.917
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP016794.1 1214931-1214954 2 0.917
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP016794.1 2422145-2422168 2 0.917
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP016794.1 2691103-2691126 2 0.917
NZ_CP016794_2 2.5|365111|42|NZ_CP016794|CRISPRCasFinder 365111-365152 42 NZ_CP016794.1 373127-373168 2 0.952
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP016794.1 371942-371974 2 0.939
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP016794.1 1210026-1210047 2 0.909
NZ_CP016794_12 12.6|3938320|38|NZ_CP016794|CRT 3938320-3938357 38 NZ_CP016794.1 3942738-3942775 2 0.947
NZ_CP016794_12 12.6|3938320|38|NZ_CP016794|CRT 3938320-3938357 38 NZ_CP016794.1 3943023-3943060 2 0.947
NZ_CP016794_12 12.6|3938320|38|NZ_CP016794|CRT 3938320-3938357 38 NZ_CP016794.1 3943294-3943331 2 0.947
NZ_CP016794_12 12.7|3938383|20|NZ_CP016794|CRT 3938383-3938402 20 NZ_CP016794.1 4206060-4206079 2 0.9
NZ_CP016794_13 13.1|3944119|69|NZ_CP016794|CRT 3944119-3944187 69 NZ_CP016794.1 3944551-3944619 9 0.87

1. spacer 9.1|3659603|59|NZ_CP016794|CRISPRCasFinder matches to position: 3659666-3659724, mismatch: 0, identity: 1.0

ctgtgagtcgagtgagcggaacgaacgaagtgagtgacgggaacgagacgaacaatccg	CRISPR spacer
ctgtgagtcgagtgagcggaacgaacgaagtgagtgacgggaacgagacgaacaatccg	Protospacer
***********************************************************

2. spacer 3.1|629452|18|NZ_CP016794|CRT matches to position: 23824-23841, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acgacgtcggcgacgacg	Protospacer
** ***************

3. spacer 3.1|629452|18|NZ_CP016794|CRT matches to position: 1411198-1411215, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acctcgtcggcgacgacg	Protospacer
*** **************

4. spacer 3.3|629536|18|NZ_CP016794|CRT matches to position: 971407-971424, mismatch: 1, identity: 0.944

accacgccgccaacgacg	CRISPR spacer
accacgccgcccacgacg	Protospacer
*********** ******

5. spacer 7.2|2072402|18|NZ_CP016794|CRT matches to position: 399405-399422, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

6. spacer 7.2|2072402|18|NZ_CP016794|CRT matches to position: 605585-605602, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

7. spacer 7.4|2072492|18|NZ_CP016794|CRT matches to position: 3441493-3441510, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

8. spacer 1.10|336937|24|NZ_CP016794|CRT matches to position: 148584-148607, mismatch: 2, identity: 0.917

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgccgatcagcccaccggcg	Protospacer
*********** *****.******

9. spacer 1.10|336937|24|NZ_CP016794|CRT matches to position: 1214931-1214954, mismatch: 2, identity: 0.917

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgccgatcagcccggcggcg	Protospacer
*********** ****** *****

10. spacer 1.10|336937|24|NZ_CP016794|CRT matches to position: 2422145-2422168, mismatch: 2, identity: 0.917

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgccgatcagcccggcggcg	Protospacer
*********** ****** *****

11. spacer 1.10|336937|24|NZ_CP016794|CRT matches to position: 2691103-2691126, mismatch: 2, identity: 0.917

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgatgccgaagagcccgccggcg	Protospacer
*** ****** *************

12. spacer 2.5|365111|42|NZ_CP016794|CRISPRCasFinder matches to position: 373127-373168, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

13. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to position: 371942-371974, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

14. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to position: 1210026-1210047, mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gttgccgatcagcccggcggca	Protospacer
**.********* *********

15. spacer 12.6|3938320|38|NZ_CP016794|CRT matches to position: 3942738-3942775, mismatch: 2, identity: 0.947

accggcggagcggccggagccggcggggccggtggcgc	CRISPR spacer
accggcggagcggccggagccggcggggccggcggagc	Protospacer
********************************.** **

16. spacer 12.6|3938320|38|NZ_CP016794|CRT matches to position: 3943023-3943060, mismatch: 2, identity: 0.947

accggcggagcggccggagccggcggggccggtggcgc	CRISPR spacer
accggcggagcggccggagccggcggggccggcggagc	Protospacer
********************************.** **

17. spacer 12.6|3938320|38|NZ_CP016794|CRT matches to position: 3943294-3943331, mismatch: 2, identity: 0.947

accggcggagcggccggagccggcggggccggtggcgc	CRISPR spacer
accggcggagcggccggagccggcggggccggcggagc	Protospacer
********************************.** **

18. spacer 12.7|3938383|20|NZ_CP016794|CRT matches to position: 4206060-4206079, mismatch: 2, identity: 0.9

gcggtgggcagcgtcggcac	CRISPR spacer
gcggtggtcagcgacggcac	Protospacer
******* ***** ******

19. spacer 13.1|3944119|69|NZ_CP016794|CRT matches to position: 3944551-3944619, mismatch: 9, identity: 0.87

cggcgccggcggggccggcggacaaggcggcgccgggggtgctggcatcagcttcagcaa	CRISPR spacer
cggcgccggcggggccggcggacaaggcggcgccgggggtgctggcatcagcttcagcaa	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1975819-1975840 1 0.955
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1109892-1109913 1 0.955
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP016457 Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence 87869-87890 1 0.955
NZ_CP016794_5 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder 1574846-1574867 22 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 362668-362689 1 0.955
NZ_CP016794_5 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder 1574846-1574867 22 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2289382-2289403 1 0.955
NZ_CP016794_5 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder 1574846-1574867 22 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 81656-81677 1 0.955
NZ_CP016794_5 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder 1574846-1574867 22 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 56160-56181 1 0.955
NZ_CP016794_12 12.7|3938383|20|NZ_CP016794|CRT 3938383-3938402 20 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 948840-948859 1 0.95
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 AWQW01000318 Streptomyces niveus NCIMB 11891 plasmid pSniv4, complete sequence, whole genome shotgun sequence 14614-14637 2 0.917
NZ_CP016794_5 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder 1573919-1573940 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 881140-881161 2 0.909
NZ_CP016794_5 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder 1573919-1573940 22 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 225972-225993 2 0.909
NZ_CP016794_5 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder 1573919-1573940 22 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 451168-451189 2 0.909
NZ_CP016794_5 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder 1573919-1573940 22 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 234992-235013 2 0.909
NZ_CP016794_5 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder 1573919-1573940 22 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 597449-597470 2 0.909
NZ_CP016794_5 5.3|1573973|22|NZ_CP016794|CRISPRCasFinder 1573973-1573994 22 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 117076-117097 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 448838-448859 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 160471-160492 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 175264-175285 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 457593-457614 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 166709-166730 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 166709-166730 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 166709-166730 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 166709-166730 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 164465-164486 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 97458-97479 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP012698 Microbacterium sp. No. 7 plasmid A, complete sequence 53118-53139 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 100830-100851 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 307854-307875 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 23841-23862 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 279961-279982 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 359201-359222 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 606826-606847 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 411558-411579 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 300111-300132 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 483830-483851 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 68146-68167 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 175112-175133 2 0.909
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 314082-314103 2 0.909
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 402883-402907 2 0.92
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 416172-416196 2 0.92
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 472935-472959 2 0.92
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 360034-360057 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_009339 Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence 151456-151479 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 361748-361771 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 71374-71397 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP023153 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence 59010-59033 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 427571-427594 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1611953-1611976 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP019224 Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence 6848-6871 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 42933-42956 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1261102-1261125 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1313840-1313863 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 569757-569780 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 357298-357321 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 360034-360057 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 MT188704 Mesorhizobium phage Cp1R7A-A1, complete genome 40680-40703 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 KR080200 Mycobacterium phage AlanGrant, complete genome 26194-26217 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 KR080194 Mycobacterium phage Vincenzo, complete genome 26194-26217 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 1386530-1386553 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_LT703507 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3 36742-36765 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP015273 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence 28965-28988 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 1347296-1347319 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 938156-938179 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1309275-1309298 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1366753-1366776 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP029333 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence 32147-32170 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1978453-1978476 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 364121-364144 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 43684-43707 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1554638-1554661 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1274874-1274897 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 490650-490673 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1543298-1543321 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 104903-104926 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 1375160-1375183 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 71148-71171 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP045964 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence 20208-20231 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NC_022654 Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence 121555-121578 3 0.875
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 9264-9285 3 0.864
NZ_CP016794_5 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder 1574027-1574048 22 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 13233-13254 3 0.864
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 937294-937318 3 0.88
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1470762-1470786 3 0.88
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 MN586053 Arthrobacter phage BeatusComedenti, complete genome 26689-26713 3 0.88
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NC_031254 Arthrobacter phage Kitkat, complete genome 26809-26833 3 0.88
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NC_031231 Arthrobacter phage KellEzio, complete genome 26691-26715 3 0.88
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 633177-633201 3 0.88
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 74124-74148 3 0.88
NZ_CP016794_5 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder 1574846-1574867 22 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 380879-380900 3 0.864
NZ_CP016794_7 7.5|2072531|24|NZ_CP016794|CRT 2072531-2072554 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
NZ_CP016794_7 7.5|2072531|24|NZ_CP016794|CRT 2072531-2072554 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
NZ_CP016794_1 1.10|336937|24|NZ_CP016794|CRT 336937-336960 24 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 866930-866953 4 0.833
NZ_CP016794_2 2.1|364856|27|NZ_CP016794|CRISPRCasFinder 364856-364882 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
NZ_CP016794_2 2.1|364856|27|NZ_CP016794|CRISPRCasFinder 364856-364882 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
NZ_CP016794_2 2.7|365252|27|NZ_CP016794|CRISPRCasFinder 365252-365278 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 603744-603773 4 0.867
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 818773-818800 4 0.857
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 420542-420569 4 0.857
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 77799-77826 4 0.857
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 176640-176664 4 0.84
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 29428-29452 4 0.84
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 38191-38215 4 0.84
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 MT553342 Microbacterium phage Kelcole, complete genome 51573-51597 4 0.84
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NC_048068 Microbacterium phage OneinaGillian, complete genome 50894-50918 4 0.84
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 MT310894 Microbacterium phage Tempo, complete genome 51697-51721 4 0.84
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 42080-42104 4 0.84
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 67777-67801 4 0.84
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 MN034284 Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence 624-648 4 0.84
NZ_CP016794_5 5.14|1574789|25|NZ_CP016794|CRISPRCasFinder 1574789-1574813 25 MN582064 Podoviridae sp. ctka020, complete genome 29274-29298 4 0.84
NZ_CP016794_7 7.5|2072531|24|NZ_CP016794|CRT 2072531-2072554 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
NZ_CP016794_7 7.5|2072531|24|NZ_CP016794|CRT 2072531-2072554 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
NZ_CP016794_7 7.5|2072531|24|NZ_CP016794|CRT 2072531-2072554 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
NZ_CP016794_2 2.1|364856|27|NZ_CP016794|CRISPRCasFinder 364856-364882 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
NZ_CP016794_2 2.1|364856|27|NZ_CP016794|CRISPRCasFinder 364856-364882 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
NZ_CP016794_2 2.7|365252|27|NZ_CP016794|CRISPRCasFinder 365252-365278 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
NZ_CP016794_2 2.7|365252|27|NZ_CP016794|CRISPRCasFinder 365252-365278 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 94483-94510 5 0.821
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 KU728633 Mycobacterium phage Bipper, complete genome 41992-42019 5 0.821
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 MK977701 Mycobacterium phage Cracklewink, complete genome 41985-42012 5 0.821
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 100320-100347 5 0.821
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 614111-614135 5 0.8
NZ_CP016794_5 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder 1574081-1574105 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 92705-92729 5 0.8
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 45440-45470 5 0.839
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 123562-123592 5 0.839
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 72551-72581 5 0.839
NZ_CP016794_5 5.13|1574723|34|NZ_CP016794|CRISPRCasFinder 1574723-1574756 34 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 89410-89443 5 0.853
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350534-350566 5 0.848
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_047958 Burkholderia phage vB_BmuP_KL4, complete genome 28570-28602 5 0.848
NZ_CP016794_2 2.1|364856|27|NZ_CP016794|CRISPRCasFinder 364856-364882 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
NZ_CP016794_2 2.7|365252|27|NZ_CP016794|CRISPRCasFinder 365252-365278 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
NZ_CP016794_2 2.9|365402|27|NZ_CP016794|CRISPRCasFinder 365402-365428 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
NZ_CP016794_2 2.10|365462|27|NZ_CP016794|CRISPRCasFinder 365462-365488 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1565268-1565297 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 KX620751 Propionibacterium phage Doucette, complete genome 8876-8905 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NC_041891 Propionibacterium phage B22, complete genome 8817-8846 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NC_041894 Propionibacterium phage E6, complete genome 8927-8956 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 KX620754 Propionibacterium phage G4, complete genome 8865-8894 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 575683-575712 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1829167-1829196 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 MT818419 Mycobacterium phage Lolalove, complete genome 27446-27475 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 MN428050 Mycobacterium phage Apex, complete genome 27615-27644 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 MN234171 Mycobacterium phage Magpie, complete genome 27275-27304 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 KX589269 Mycobacterium phage Fortunato, complete genome 27431-27460 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NC_042035 Mycobacterium phage Zemanar, complete sequence 27435-27464 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NC_022331 Mycobacterium phage Bane1, complete genome 27108-27137 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 KF279413 Mycobacterium phage Bane2, complete genome 27087-27116 6 0.8
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 MT310870 Mycobacterium phage RawrgerThat, complete genome 27434-27463 6 0.8
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 39276-39303 6 0.786
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 76834-76861 6 0.786
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 NZ_LR594663 Variovorax sp. RA8 plasmid 2 131793-131820 6 0.786
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 27764-27794 6 0.806
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 438646-438676 6 0.806
NZ_CP016794_5 5.13|1574723|34|NZ_CP016794|CRISPRCasFinder 1574723-1574756 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 28989-29022 6 0.824
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210880-2210912 6 0.818
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 117034-117066 6 0.818
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1020953-1020985 6 0.818
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 117076-117108 6 0.818
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 117034-117066 6 0.818
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 36590-36622 6 0.818
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 162823-162855 6 0.818
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 43326-43358 6 0.818
NZ_CP016794_2 2.4|365051|27|NZ_CP016794|CRISPRCasFinder 365051-365077 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2600082-2600111 7 0.767
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2593965-2593994 7 0.767
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 110413-110442 7 0.767
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 444400-444429 7 0.767
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 741115-741144 7 0.767
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP012478 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence 144936-144965 7 0.767
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 444383-444412 7 0.767
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 66483-66512 7 0.767
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 320484-320513 7 0.767
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 26400-26429 7 0.767
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NZ_CP016794_5 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder 1573859-1573886 28 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 259627-259654 7 0.75
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 281800-281830 7 0.774
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 CP017041 Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence 68407-68437 7 0.774
NZ_CP016794_7 7.3|2072441|30|NZ_CP016794|CRT 2072441-2072470 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
NZ_CP016794_7 7.3|2072441|30|NZ_CP016794|CRT 2072441-2072470 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
NZ_CP016794_7 7.3|2072441|30|NZ_CP016794|CRT 2072441-2072470 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 922291-922322 7 0.781
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 68176-68207 7 0.781
NZ_CP016794_12 12.6|3938320|38|NZ_CP016794|CRT 3938320-3938357 38 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3050492-3050529 7 0.816
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 302495-302527 7 0.788
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 39611-39643 7 0.788
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 12586-12618 7 0.788
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1333952-1333984 7 0.788
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 437642-437671 8 0.733
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 9052-9081 8 0.733
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 349053-349083 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 336247-336277 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 262996-263026 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 336247-336277 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP018001 Rhizobium sp. Y9 plasmid pY9, complete sequence 264529-264559 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 458177-458207 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 311056-311086 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 88587-88617 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 284157-284187 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 300067-300097 8 0.742
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1510497-1510527 8 0.742
NZ_CP016794_7 7.3|2072441|30|NZ_CP016794|CRT 2072441-2072470 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
NZ_CP016794_7 7.3|2072441|30|NZ_CP016794|CRT 2072441-2072470 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 470080-470111 8 0.75
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 MG812496 Gordonia phage SallySpecial, complete genome 7676-7707 8 0.75
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211237-2211269 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466475-3466507 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 353271-353303 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 459292-459324 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP011920 Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence 132380-132412 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 282350-282382 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 884552-884584 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 546698-546730 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 132351-132383 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 536889-536921 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP040765 Paracoccus sp. 2251 plasmid unnamed1, complete sequence 232420-232452 8 0.758
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_019408 Caulobacter phage CcrRogue, complete genome 40183-40215 8 0.758
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
NZ_CP016794_3 3.2|629488|30|NZ_CP016794|CRT 629488-629517 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1695112-1695141 9 0.7
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NZ_CP016794_4 4.1|690195|31|NZ_CP016794|CRISPRCasFinder 690195-690225 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 345043-345073 9 0.71
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 245050-245080 9 0.71
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 194387-194417 9 0.71
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 MN234199 Mycobacterium phage Ekdilam, complete genome 24235-24265 9 0.71
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1145162-1145192 9 0.71
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 453136-453166 9 0.71
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP013740 Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence 2806-2836 9 0.71
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1908459-1908489 9 0.71
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172271-172302 9 0.719
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172271-172302 9 0.719
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 326579-326610 9 0.719
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68775-68806 9 0.719
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_LN868942 Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence 1614-1645 9 0.719
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP031420 Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence 7035-7066 9 0.719
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 113326-113357 9 0.719
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP024681 Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence 124358-124389 9 0.719
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 67698-67729 9 0.719
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 MH271296 Gordonia phage Emperor, complete genome 8733-8764 9 0.719
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 MG925349 Mycobacterium phage Mendokysei, complete genome 22135-22167 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1125966-1125998 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 19227-19259 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 352576-352608 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 MH617086 Microviridae sp. isolate ctcc904, complete genome 2745-2777 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 370215-370247 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 5056-5088 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 570966-570998 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1242101-1242133 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 343812-343844 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 46166-46198 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 384382-384414 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP011809 Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-2, complete sequence 5124-5156 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 275376-275408 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 146284-146316 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 275375-275407 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 MN234223 Mycobacterium phage Philly, complete genome 30945-30977 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 MH001451 Mycobacterium phage Nairb, complete genome 34736-34768 9 0.727
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 KJ194581 Mycobacterium phage Audrey, complete genome 31091-31123 9 0.727
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
NZ_CP016794_2 2.6|365186|33|NZ_CP016794|CRISPRCasFinder 365186-365218 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 425898-425928 10 0.677
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 344090-344120 10 0.677
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 68383-68413 10 0.677
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 16322-16352 10 0.677
NZ_CP016794_5 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder 1574474-1574504 31 NZ_AP014581 Burkholderia sp. RPE67 plasmid p3, complete sequence 131907-131937 10 0.677
NZ_CP016794_5 5.13|1574723|34|NZ_CP016794|CRISPRCasFinder 1574723-1574756 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1081518-1081551 10 0.706
NZ_CP016794_8 8.9|3115735|35|NZ_CP016794|PILER-CR,CRISPRCasFinder,CRT 3115735-3115769 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 1025-1056 10 0.688
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 89525-89556 10 0.688
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 684081-684112 10 0.688
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 399128-399159 10 0.688
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 KC170279 Uncultured bacterium plasmid pMBUI8, complete sequence 15926-15958 10 0.697
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52131-52163 10 0.697
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 71023-71055 10 0.697
NZ_CP016794_10 10.6|3742297|32|NZ_CP016794|CRT 3742297-3742328 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 301548-301579 11 0.656
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 1477-1509 11 0.667
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NC_016591 Burkholderia sp. YI23 plasmid byi_2p, complete sequence 221694-221726 11 0.667
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 MH617086 Microviridae sp. isolate ctcc904, complete genome 2727-2759 11 0.667
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 937012-937044 11 0.667
NZ_CP016794_13 13.4|3944341|33|NZ_CP016794|CRT 3944341-3944373 33 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 173580-173612 11 0.667

1. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

2. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

3. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcgggccggcggca	Protospacer
**********.***********

4. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

5. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

6. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

7. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

8. spacer 12.7|3938383|20|NZ_CP016794|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 1, identity: 0.95

gcggtgggcagcgtcggcac	CRISPR spacer
gcggtgggcagcgtcggcag	Protospacer
******************* 

9. spacer 1.10|336937|24|NZ_CP016794|CRT matches to AWQW01000318 (Streptomyces niveus NCIMB 11891 plasmid pSniv4, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.917

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccggtgcggatgagcccgccggcg	Protospacer
*** *** ****************

10. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

11. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

12. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

13. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

14. spacer 5.2|1573919|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

15. spacer 5.3|1573973|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909

ggtaccgtcctcgccggcggtg	CRISPR spacer
ggcaccgtcctcgccggcggtt	Protospacer
**.****************** 

16. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

17. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

18. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

19. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

20. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

21. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

22. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

23. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

24. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

25. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgggg	Protospacer
******************** .

26. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
accgccgatcaggccggcggca	Protospacer
..********************

27. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ctcggcgatcaggccggcggca	Protospacer
 *** *****************

28. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

29. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

30. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

31. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

32. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcg	Protospacer
***************** ***.

33. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ggcgccgatcaggccggcggcc	Protospacer
* ******************* 

34. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggcctgcggcg	Protospacer
*************** *****.

35. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

36. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgccg	Protospacer
******************* *.

37. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgagcaggccggcggcc	Protospacer
******** ************ 

38. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

39. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

40. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

41. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

42. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

43. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
gcgttgcggctgagcccgccggcg	Protospacer
 ****** * **************

44. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

45. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgtggccgaggagcccgccggcc	Protospacer
**** ***** ************ 

46. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgtggccgaggagcccgccggcc	Protospacer
**** ***** ************ 

47. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

48. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

49. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgtggccgaggagcccgccggcc	Protospacer
**** ***** ************ 

50. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

51. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

52. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

53. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

54. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

55. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

56. spacer 1.10|336937|24|NZ_CP016794|CRT matches to MT188704 (Mesorhizobium phage Cp1R7A-A1, complete genome) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgccgatgcgcccgccgaca	Protospacer
************ ********.*.

57. spacer 1.10|336937|24|NZ_CP016794|CRT matches to KR080200 (Mycobacterium phage AlanGrant, complete genome) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
tcgttgccgatgaccccgccgccg	Protospacer
.************ ******* **

58. spacer 1.10|336937|24|NZ_CP016794|CRT matches to KR080194 (Mycobacterium phage Vincenzo, complete genome) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
tcgttgccgatgaccccgccgccg	Protospacer
.************ ******* **

59. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

60. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgtggccgaggagcccgccggcc	Protospacer
**** ***** ************ 

61. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgtggccgaggagcccgccggcc	Protospacer
**** ***** ************ 

62. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

63. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

64. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

65. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

66. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgtggccgaggagcccgccggcc	Protospacer
**** ***** ************ 

67. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

68. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgatgccgatgatcccgccggcc	Protospacer
*** ********* ********* 

69. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

70. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

71. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

72. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

73. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

74. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
gcgttgcggctgagcccgccggcg	Protospacer
 ****** * **************

75. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgttgaggatgagcccgccggcc	Protospacer
******  *************** 

76. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
tcgttgccgatcagcccgcgggcg	Protospacer
.********** ******* ****

77. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgtggccgaggagcccgccggcc	Protospacer
**** ***** ************ 

78. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 3, identity: 0.875

ccgttgccgatgagcccgccggcg	CRISPR spacer
ccgtggccgaggagcccgccggcc	Protospacer
**** ***** ************ 

79. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgcgg	Protospacer
*******************  .

80. spacer 5.4|1574027|22|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
ttcgccgatcaggccggcggtg	Protospacer
 *******************..

81. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
ctcgccgaacacgcggaagccgtct	Protospacer
**.*********** ********* 

82. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
attgtcgaacacgcggaagccgtcg	Protospacer
 ***.********* **********

83. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

84. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

85. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

86. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
catgcggaacacgccgaatccgtcg	Protospacer
* *** ************ ******

87. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgatcacgccgtagccgttg	Protospacer
******** ******* ******.*

88. spacer 5.15|1574846|22|NZ_CP016794|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864

caatccggcggcgccgccggca	CRISPR spacer
gaatccggcggcgccgccgggc	Protospacer
 *******************  

89. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

90. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

91. spacer 1.10|336937|24|NZ_CP016794|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 4, identity: 0.833

ccgttgccgatgagcccgccggcg	CRISPR spacer
gctgcgccgatgagcccgccggcg	Protospacer
 *  .*******************

92. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

93. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

94. spacer 2.7|365252|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

95. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

96. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

97. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867

accacgccggtgaccacgccg-ccaacgacg	CRISPR spacer
accacgccggtggccacgccgaccagcggc-	Protospacer
************.******** ***.**.* 

98. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

99. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

100. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

101. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
tccgccgaacgcgccgaagccgtcg	Protospacer
...*******.**************

102. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

103. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

104. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

105. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

106. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

107. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacacgccgatgccctgc	Protospacer
***************** *** *  

108. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
aatgccgaattcgccgaagccgtcg	Protospacer
  *******. **************

109. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cccgtagaacacgccgaagccgtcg	Protospacer
*..*. *******************

110. spacer 5.14|1574789|25|NZ_CP016794|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgccaccgacccccccttgc	CRISPR spacer
ttttccgacaccgacccccccttga	Protospacer
.** *** **************** 

111. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

112. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

113. spacer 7.5|2072531|24|NZ_CP016794|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

114. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

115. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

116. spacer 2.7|365252|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

117. spacer 2.7|365252|27|NZ_CP016794|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

118. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

119. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

120. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

121. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

122. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

123. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

124. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

125. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

126. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

127. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

128. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

129. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

130. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

131. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

132. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

133. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

134. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

135. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

136. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

137. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

138. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

139. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

140. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

141. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

142. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

143. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

144. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

145. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

146. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

147. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

148. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gctgccgtgggtgccatcgttgccgagt	Protospacer
*.***** *****************. .

149. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

150. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

151. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gttgccgcgggtgccctcgttgcggacg	Protospacer
******* ******* ******* *.* 

152. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gccgccgaacacgccgaagccgttt	Protospacer
 ..********************. 

153. spacer 5.5|1574081|25|NZ_CP016794|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaacacgccgacgccgcgc	Protospacer
 **************** ****.  

154. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

155. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

156. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

157. spacer 5.13|1574723|34|NZ_CP016794|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853

gtcgccgtgcagccagccaccaccgcca-ccggcg	CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc-	Protospacer
 *************.********* *** ** ** 

158. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.848

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cggcgccggcggcagcgccggcgccggcagtat	Protospacer
*** **********.*************.*. *

159. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 5, identity: 0.848

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cgctgccggccgcaacgacggcgccggcggccg	Protospacer
**  ****** ****** ************** 

160. spacer 2.1|364856|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

161. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

162. spacer 2.7|365252|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

163. spacer 2.9|365402|27|NZ_CP016794|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

164. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

165. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

166. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

167. spacer 2.10|365462|27|NZ_CP016794|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

168. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gcgccgccggtgactacgccgccagcgaca	Protospacer
.*  **********.*********.****.

169. spacer 3.2|629488|30|NZ_CP016794|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

170. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

171. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

172. spacer 3.2|629488|30|NZ_CP016794|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

173. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tccacgccggtgaccacgccgaccaccttg	Protospacer
 ******************** * **  .*

174. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
aagaggccggcgagcacgccgccaacgaag	Protospacer
*  * *****.** ************** *

175. spacer 3.2|629488|30|NZ_CP016794|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

176. spacer 3.2|629488|30|NZ_CP016794|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

177. spacer 3.2|629488|30|NZ_CP016794|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

178. spacer 3.2|629488|30|NZ_CP016794|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

179. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

180. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

181. spacer 3.2|629488|30|NZ_CP016794|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

182. spacer 3.2|629488|30|NZ_CP016794|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

183. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

184. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

185. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

186. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccggcggtgccatcggtgccgagg	Protospacer
* ****** ********** *****.  

187. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

188. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

189. spacer 5.13|1574723|34|NZ_CP016794|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824

--gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca	Protospacer
  ****.*  *****  ******************.

190. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.818

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
aggcaccggcggcaacggcggcggcggcggctt	Protospacer
 ** .************ ***** *******.*

191. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ctgggccggcggcaacgtcggcgccggtgccaa	Protospacer
* ***************.*********.* *  

192. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.818

cggggccg-----gcggcaacgccggcgccggcggcct	CRISPR spacer
-----ccgccagcgcggcaacgccggcgccgccggcct	Protospacer
     ***     ****************** ******

193. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ctgggccggcggcaacgtcggcgccggtgccaa	Protospacer
* ***************.*********.* *  

194. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ctgggccggcggcaacgtcggcgccggtgccaa	Protospacer
* ***************.*********.* *  

195. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ctgggccggcggcaacgtcggcgccggtgccaa	Protospacer
* ***************.*********.* *  

196. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 6, identity: 0.818

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ccgccccggcggccacgccgccgccggcggccg	Protospacer
* *  ******** ****** *********** 

197. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.818

cggggccggcggcaacgccggcgccggcggcct-	CRISPR spacer
cggggccgggggcatcgccggcg-cgacggtcac	Protospacer
********* **** ******** **.***.*  

198. spacer 2.4|365051|27|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

199. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
taggcgccggtgaccccgccgccgacgatg	Protospacer
   .*********** *******.****.*

200. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg	Protospacer
  *..* ******************.*.**

201. spacer 3.2|629488|30|NZ_CP016794|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atagcgccggtcaccgcgccgccaacgata	Protospacer
*. .******* ***.************..

202. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

203. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

204. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

205. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

206. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag	Protospacer
 * .***********.********* *  *

207. spacer 3.2|629488|30|NZ_CP016794|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggcccgccgatggccacgccgccaacggca	Protospacer
. * *****.**.**************.*.

208. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg	Protospacer
..*. * ****************. *****

209. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

210. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

211. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

212. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

213. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

214. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

215. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

216. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

217. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

218. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

219. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

220. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

221. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

222. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

223. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

224. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

225. spacer 5.1|1573859|28|NZ_CP016794|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
agcacccggggtgccgtcgttgccggcg	Protospacer
. ..** ********.*********** 

226. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc	Protospacer
. *  **** *********.********** 

227. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg	Protospacer
**. ***.************ ******. *.

228. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

229. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

230. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

231. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
ttgagatccgcgacgatgggtgtggcgccggc	Protospacer
**    .********.**** ***********

232. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
ttcccgcaggcgacggtgcgggcggcgccggc	Protospacer
**..* *  ********* ***.*********

233. spacer 12.6|3938320|38|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.816

accggcggagcggccggagccggcggggccggtggcgc-	CRISPR spacer
cccggcggagcgggcggagccggcggcg-cagtggcagg	Protospacer
 ************ ************ * *.*****.  

234. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.788

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
aagtctcggcggaaacgccggcgccggcggccg	Protospacer
 .*  .****** ******************* 

235. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.788

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cggcgccggcggcaacgtcggcgccgaatacgt	Protospacer
*** *************.********.  .* *

236. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 7, identity: 0.788

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
caagagcggcggcaaggccgacgccggcggcca	Protospacer
*..*. ********* ****.*********** 

237. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.788

cggggccg-----gcggcaacgccggcgccggcggcct	CRISPR spacer
-----ccgccagcgcggcaacgccggcgccgcgggcct	Protospacer
     ***     ******************  *****

238. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

239. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

240. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

241. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

242. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

243. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cagacctcggtgaccacgccggcaacgatc	Protospacer
   ** .************** ******. 

244. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggttggccggtgaccactccgccagcgatg	Protospacer
. .  ************ ******.***.*

245. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc	Protospacer
.   ********.******.*********  

246. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

247. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

248. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

249. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

250. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

251. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

252. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc	Protospacer
.   **************** *.***** * 

253. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

254. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgc--gccttgcccgccgttgccgccggca	CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg	Protospacer
  ..**  **********  *********** .

255. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
attgccgccctggccgccgttgccgccgatc	Protospacer
* *  ****.** ***************.. 

256. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

257. spacer 7.3|2072441|30|NZ_CP016794|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

258. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agcgcggccgcgtcggtgggggtggcgcccgc	Protospacer
  . *  ***** **************** **

259. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 8, identity: 0.75

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cgcaccaccgcggcggtgcgggtggcgccggc	Protospacer
. . *. *****.***** *************

260. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
gggcacgggcggcaacggcggcgcaggcggcgc	Protospacer
 ** .* ********** ****** ****** .

261. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
gggcaacggcggcaacggcggcgacggcggtcg	Protospacer
 ** . *********** ***** ******.* 

262. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
tgaggccggcggcaacgcccacgccggtgaaca	Protospacer
.*.**************** .******.*. * 

263. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
tccgcgcggcggcaacgccggcggcggtggcca	Protospacer
.  *  ***************** ***.**** 

264. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP011920 (Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
gccggctgccggcaacgccggcgccggcgtcgg	Protospacer
   ***.* ******************** *  

265. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
aagtctcggcggaaacgtcggcgccggcggccg	Protospacer
 .*  .****** ****.************** 

266. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
gcacgccgccgacaacgccggcgccggcgcgct	Protospacer
  . **** **.*****************  **

267. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
agcacccgccggcaaagccggcgccggcgggca	Protospacer
 * . *** ****** ************** * 

268. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
catcgccggcgtcaacgccgtcgccggctggcc	Protospacer
*.  ******* ******** ******* * *.

269. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccgg--cggcct	CRISPR spacer
gcccgccggcggcagtgccggcgccggctcggc--	Protospacer
    **********..***********  ****  

270. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cggacgcgtcggcaacgccggcgctggcgggaa	Protospacer
***.  ** ***************.*****   

271. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 8, identity: 0.758

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cgccacgggtggcaacgccggcggcggcggctc	Protospacer
**  .* **.************* *******..

272. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

273. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

274. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

275. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

276. spacer 3.2|629488|30|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cccacgccggtcaccacgccgctgcccggc	Protospacer
 ********** **********.. * .  

277. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

278. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

279. spacer 4.1|690195|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

280. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg	Protospacer
.... ****.***************** .*.

281. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
tggcccgccttgccctccattgccgccggac	Protospacer
 . . ********** **.**********  

282. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
atccttgccttgaccgccgttgccgccgctg	Protospacer
* .. .****** *************** ..

283. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accccagccctgcccgccgttgccgccgctc	Protospacer
* ..  ***.****************** . 

284. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc	Protospacer
. ******** ********* ****   .* 

285. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accggcaccttgcccgccattgccgccatgt	Protospacer
* . **.***********.********.   

286. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc	Protospacer
 .   *******.******* *******.* 

287. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
agcgtggccttggccgccgttgccggcggtc	Protospacer
*..   ****** ************ ***. 

288. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag	Protospacer
   .* *******.** *************. 

289. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag	Protospacer
   .* *******.** *************. 

290. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
gcccccggcgtgacggtggaggtggcgccggc	Protospacer
 ...*.  **.********.************

291. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag	Protospacer
   .* *******.** *************. 

292. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc	Protospacer
... *. * ******* ** ************

293. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc	Protospacer
... *. * ******* ** ************

294. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
gtggcggtggcggcggtgggggtggcggcggc	Protospacer
 *  *  . ***.************** ****

295. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
tgcgaccgggcgacggtggaggtggcgccagc	Protospacer
* .  .*  **********.*********.**

296. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
caacattcagcgacggtgggtgtggcggcggc	Protospacer
.  . *.* *********** ****** ****

297. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 9, identity: 0.719

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cgcacgacggcggcggtgcgggtggcgccggc	Protospacer
. . *  * ***.***** *************

298. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cccggccggcggcaaggccggcaccggattcaa	Protospacer
*  ************ ******.****   *  

299. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cggtgccggcggcaaggccggcgcggagaccgc	Protospacer
*** *********** ******** *. . * .

300. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
aggggccggcggccacgccggcccccacccacc	Protospacer
 ************ ******** ** .*   *.

301. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ttcggccggcggcaatgccggcggcggcgatgc	Protospacer
.  ************.******* *****.. .

302. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MH617086 (Microviridae sp. isolate ctcc904, complete genome) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
accaggcggcggcaccgccgccgccggcggcac	Protospacer
   .* ******** ***** ********** .

303. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
tcatgccggcggcaaggccggcgacggcgcctg	Protospacer
. . *********** ******* ***** *. 

304. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ggaagacggcggccacgcccgcgccggcggtga	Protospacer
 *..* ******* ***** **********.  

305. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cgccctgggcggcaacgccgcggccggcggctg	Protospacer
**   . *************  *********. 

306. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cgccctgggcggcaacgccgcggccggcggctg	Protospacer
**   . *************  *********. 

307. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
tccgcgtggcggcaacgccggcggtggcggcca	Protospacer
.  *  .**************** .******* 

308. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
aagcagcggcggcaacaccggcgccgtcggcgc	Protospacer
 .* . **********.********* **** .

309. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
tccgcgtggcggcaacgccggcggtggcggcca	Protospacer
.  *  .**************** .******* 

310. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP011809 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-2, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
tggcaatggcggcaacgccggcagcggcggcag	Protospacer
.** . .***************. *******  

311. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ccgcgctggcggcaacgtcggcgccggccatgg	Protospacer
* * **.**********.********** ..  

312. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
tcgatccggcggctacaccggcgccggcgccgc	Protospacer
. *. ******** **.************ * .

313. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ccgcgctggcggcaacgtcggcgccggccatgg	Protospacer
* * **.**********.********** ..  

314. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ggcgtccggcggcaacggcggcgcgggcgcagc	Protospacer
 * * ************ ****** ****   .

315. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
gcggaacggcggcaacgccgacgtcggcggaac	Protospacer
  **. **************.**.******  .

316. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 9, identity: 0.727

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ggcgtccggcggcaacggcggcgcgggcgcagc	Protospacer
 * * ************ ****** ****   .

317. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

318. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

319. spacer 2.6|365186|33|NZ_CP016794|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

320. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

321. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg	Protospacer
  .. ****** *******.********  .

322. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggccagaacttccccgctgttgccgccggca	Protospacer
..... . *** *****.*************

323. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

324. spacer 5.10|1574474|31|NZ_CP016794|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc	Protospacer
...   ****** ************ ***. 

325. spacer 5.13|1574723|34|NZ_CP016794|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706

gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca	Protospacer
 . .. .*******.***************.**.

326. spacer 8.9|3115735|35|NZ_CP016794|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

327. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
aggacggccgcggcggtggcggtggcgccgta	Protospacer
    *  *****.****** **********  

328. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
ctgctggccgcgacggtgctggtggcgccgat	Protospacer
.* ..  ***********  **********..

329. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
tcgcggatcgggatggtgggggtggcgccgga	Protospacer
*. .   .** **.***************** 

330. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
gcgagggcggcgacggtgggcgtgtcgccggc	Protospacer
 .     * *********** *** *******

331. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 10, identity: 0.697

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ataccccggcggcaagggcggcgccggcgtcta	Protospacer
  .  ********** * *********** *. 

332. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 10, identity: 0.697

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
cggggcaggcggcaacgccggggccaagtatgg	Protospacer
****** ************** ***..  ..  

333. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 10, identity: 0.697

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
tcagttcggcggcaccgccgacgccggcggtgc	Protospacer
. .* .******** *****.*********. .

334. spacer 10.6|3742297|32|NZ_CP016794|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656

ttttctcccgcgacggtgggggtggcgccggc	CRISPR spacer
cgcagcagcgcgacggtgtcggtggcgccggt	Protospacer
. .  .  **********  ***********.

335. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 11, identity: 0.667

-cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ccggcgccggcgccggcgctgccggcggccatc-	Protospacer
 *** ******* *..***.* ** **** ..* 

336. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NC_016591 (Burkholderia sp. YI23 plasmid byi_2p, complete sequence) position: , mismatch: 11, identity: 0.667

-cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ccggcgccggcgccggcgctgccggcggccatc-	Protospacer
 *** ******* *..***.* ** **** ..* 

337. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to MH617086 (Microviridae sp. isolate ctcc904, complete genome) position: , mismatch: 11, identity: 0.667

-cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
gaaccgccggcggcggcggtgccgccggcggcg-	Protospacer
  .  *********..** .* **********  

338. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.667

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
ataccatggcggcaactccggcggcggcggcgg	Protospacer
  .   .********* ****** *******  

339. spacer 13.4|3944341|33|NZ_CP016794|CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.667

cggggccggcggcaacgccggcgccggcggcct	CRISPR spacer
acctcccggcgggaccgccggcgccggcgaagc	Protospacer
     ******* * **************.  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2937310 : 2976650 47 Mycobacterium_phage(30.0%) terminase,capsid,tRNA,integrase,protease,head attL 2966111:2966138|attR 2976803:2976830
DBSCAN-SWA_2 3709792 : 3799886 56 Burkholderia_virus(28.57%) tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage