Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016852 Bacillus subtilis subsp. subtilis strain 168G, complete genome 3 crisprs csa3,cas3,DEDDh,WYL,DinG 0 1 11 0

Results visualization

1. NZ_CP016852
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016852_1 937402-937507 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016852_2 3171628-3171735 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016852_3 3714312-3714424 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016852_2 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder 3171652-3171711 60 NZ_CP024037 Bacillus aryabhattai strain K13 plasmid unnamed2 10417-10476 7 0.883
NZ_CP016852_2 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder 3171652-3171711 60 NZ_CP026740 Bacillus megaterium strain YC4-R4 plasmid unnamed4 70764-70823 7 0.883
NZ_CP016852_2 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder 3171652-3171711 60 NC_017139 Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence 1318-1377 7 0.883
NZ_CP016852_2 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder 3171652-3171711 60 NZ_CP010587 Bacillus megaterium Q3 plasmid p1, complete sequence 838-897 7 0.883
NZ_CP016852_2 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder 3171652-3171711 60 NZ_CP023319 Bacillus megaterium strain A plasmid p2, complete sequence 75825-75884 7 0.883
NZ_CP016852_2 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder 3171652-3171711 60 NC_020451 Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence 1960-2019 9 0.85
NZ_CP016852_2 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder 3171652-3171711 60 NZ_CP015440 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence 64773-64832 12 0.8
NZ_CP016852_2 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder 3171652-3171711 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 483791-483850 13 0.783
NZ_CP016852_2 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder 3171652-3171711 60 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 57361-57420 14 0.767

1. spacer 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder matches to NZ_CP024037 (Bacillus aryabhattai strain K13 plasmid unnamed2) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

2. spacer 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder matches to NZ_CP026740 (Bacillus megaterium strain YC4-R4 plasmid unnamed4) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

3. spacer 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder matches to NC_017139 (Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

4. spacer 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder matches to NZ_CP010587 (Bacillus megaterium Q3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

5. spacer 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder matches to NZ_CP023319 (Bacillus megaterium strain A plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

6. spacer 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder matches to NC_020451 (Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence) position: , mismatch: 9, identity: 0.85

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcattttagttatggcccggg	Protospacer
****************************************** ***   * ***  **. 

7. spacer 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder matches to NZ_CP015440 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence) position: , mismatch: 12, identity: 0.8

cagcttggaaggctgaggttttaccactaaactacacccgca-------atttttatttg	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcataataatatataccattg	Protospacer
******************************************       ** * .  ***

8. spacer 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.783

cagcttggaaggctgaggttttaccactaaactacacccgc--------aatttttattt	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatggttaaaagttttgcca	Protospacer
*****************************************        ** ****... 

9. spacer 2.1|3171652|60|NZ_CP016852|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 14, identity: 0.767

cagcttggaaggctgaggttttaccactaaactacacccgc---------aatttttatt	CRISPR spacer
cagcttggaaggctgtagttttaccactaaactacacccgcatagtaagtagttcttagt	Protospacer
*************** .************************         *.**.*** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 699689 : 708055 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1207274 : 1251047 48 Planktothrix_phage(25.0%) coat,tRNA NA
DBSCAN-SWA_3 1313901 : 1358732 57 Bacillus_phage(25.71%) holin,protease,terminase,portal,plate NA
DBSCAN-SWA_4 1868060 : 1874615 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_5 2059106 : 2064793 9 Bacillus_phage(100.0%) holin NA
DBSCAN-SWA_6 2151041 : 2286449 197 Bacillus_phage(97.79%) integrase,bacteriocin attL 2151464:2151479|attR 2285810:2285825
DBSCAN-SWA_7 2424643 : 2430739 8 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_8 2660473 : 2698615 55 uncultured_Caudovirales_phage(30.3%) holin,terminase,portal,tail,plate NA
DBSCAN-SWA_9 2832098 : 2885415 56 uncultured_Mediterranean_phage(12.5%) tRNA,protease,coat NA
DBSCAN-SWA_10 3459176 : 3470361 14 Organic_Lake_phycodnavirus(50.0%) holin NA
DBSCAN-SWA_11 3832969 : 3909584 78 Bacillus_phage(26.67%) protease,tRNA,bacteriocin,coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage