Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016895 Acinetobacter larvae strain BRTC-1 chromosome, complete genome 2 crisprs c2c9_V-U4,csa3,cas3,DEDDh,cas14j,WYL,TnsE_C 0 1 6 0

Results visualization

1. NZ_CP016895
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016895_1 1434808-1434875 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016895_2 1969893-1970101 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016895_1 1.1|1434831|22|NZ_CP016895|CRISPRCasFinder 1434831-1434852 22 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 293912-293933 3 0.864

1. spacer 1.1|1434831|22|NZ_CP016895|CRISPRCasFinder matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 3, identity: 0.864

agatgttcgtcagcacaataca	CRISPR spacer
agatgttcgtcagcacaatggt	Protospacer
*******************.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 841810 : 850267 12 Acinetobacter_phage(25.0%) transposase NA
DBSCAN-SWA_2 1606416 : 1673251 57 Acinetobacter_phage(33.33%) integrase,protease,transposase attL 1652098:1652112|attR 1674773:1674787
DBSCAN-SWA_3 1676451 : 1798622 157 Acinetobacter_phage(71.91%) tail,capsid,plate,transposase,integrase,coat,terminase,head attL 1715023:1715071|attR 1798771:1798819
DBSCAN-SWA_4 2435792 : 2443585 7 Acinetobacter_phage(83.33%) NA NA
DBSCAN-SWA_5 2514894 : 2554394 36 Staphylococcus_prophage(22.22%) integrase,transposase attL 2514828:2514887|attR 2549474:2551214
DBSCAN-SWA_6 3389165 : 3456436 58 Vibrio_phage(33.33%) tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage