1. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 7.15|1576710|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 7.15|1576710|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 7.15|1576710|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 7.15|1576710|22|NZ_CP016888|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 2.10|336936|24|NZ_CP016888|CRT matches to AWQW01000318 (Streptomyces niveus NCIMB 11891 plasmid pSniv4, complete sequence, whole genome shotgun sequence) position: , mismatch: 2, identity: 0.917
ccgttgccgatgagcccgccggcg CRISPR spacer
ccggtgcggatgagcccgccggcg Protospacer
*** *** ****************
9. spacer 7.2|1575783|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 7.2|1575783|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 7.2|1575783|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 7.2|1575783|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 7.2|1575783|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
14. spacer 7.3|1575837|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
15. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
16. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
17. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
18. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
19. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
24. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
25. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
26. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
27. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
28. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
29. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
30. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
31. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
32. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
33. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
34. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
35. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
36. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
37. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
38. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
41. spacer 1.14|332485|27|NZ_CP016888|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
42. spacer 1.14|332485|27|NZ_CP016888|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
43. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
44. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
gcgttgcggctgagcccgccggcg Protospacer
****** * **************
45. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
46. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
47. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
48. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
49. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
50. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
51. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
52. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
53. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
54. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
55. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
56. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
57. spacer 2.10|336936|24|NZ_CP016888|CRT matches to MT188704 (Mesorhizobium phage Cp1R7A-A1, complete genome) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgccgatgcgcccgccgaca Protospacer
************ ********.*.
58. spacer 2.10|336936|24|NZ_CP016888|CRT matches to KR080200 (Mycobacterium phage AlanGrant, complete genome) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
tcgttgccgatgaccccgccgccg Protospacer
.************ ******* **
59. spacer 2.10|336936|24|NZ_CP016888|CRT matches to KR080194 (Mycobacterium phage Vincenzo, complete genome) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
tcgttgccgatgaccccgccgccg Protospacer
.************ ******* **
60. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
61. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
62. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
63. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
64. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
65. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
66. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
67. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
68. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
69. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgatgccgatgatcccgccggcc Protospacer
*** ********* *********
70. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
71. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
72. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
73. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
74. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
75. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
gcgttgcggctgagcccgccggcg Protospacer
****** * **************
76. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgttgaggatgagcccgccggcc Protospacer
****** ***************
77. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
tcgttgccgatcagcccgcgggcg Protospacer
.********** ******* ****
78. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
79. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 3, identity: 0.875
ccgttgccgatgagcccgccggcg CRISPR spacer
ccgtggccgaggagcccgccggcc Protospacer
**** ***** ************
80. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
81. spacer 7.4|1575891|22|NZ_CP016888|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
82. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
83. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
84. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
85. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
86. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
87. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
88. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
89. spacer 7.15|1576710|22|NZ_CP016888|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
90. spacer 8.5|2077744|24|NZ_CP016888|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
91. spacer 8.5|2077744|24|NZ_CP016888|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
92. spacer 1.2|331876|27|NZ_CP016888|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.852
ccgaacaccccggcgtggccaccgtca CRISPR spacer
ccgaacaccccggcgttgccgccgttg Protospacer
**************** ***.****..
93. spacer 1.4|331960|27|NZ_CP016888|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.852
ccgaacaccccggcgtggccaccgtca CRISPR spacer
ccgaacaccccggcgttgccgccgttg Protospacer
**************** ***.****..
94. spacer 2.10|336936|24|NZ_CP016888|CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 4, identity: 0.833
ccgttgccgatgagcccgccggcg CRISPR spacer
gctgcgccgatgagcccgccggcg Protospacer
* .*******************
95. spacer 3.1|364855|27|NZ_CP016888|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
96. spacer 3.1|364855|27|NZ_CP016888|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
97. spacer 3.7|365251|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
98. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
99. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
100. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
101. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
102. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
103. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
104. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
105. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
106. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
107. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
108. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
109. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
110. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
111. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
112. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
113. spacer 7.14|1576653|25|NZ_CP016888|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
114. spacer 8.5|2077744|24|NZ_CP016888|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
115. spacer 8.5|2077744|24|NZ_CP016888|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
116. spacer 8.5|2077744|24|NZ_CP016888|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
117. spacer 1.5|332005|27|NZ_CP016888|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815
ccggcgcctagagcgttggcaccgctg CRISPR spacer
ctcgggcctagagcgttggcaccgtgg Protospacer
*. * *******************. *
118. spacer 1.14|332485|27|NZ_CP016888|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
ccgccgttggcgaccagtccgcaatca Protospacer
************* ******** .*..
119. spacer 1.14|332485|27|NZ_CP016888|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gggtcgtcggagaacagtccgccgttg Protospacer
*.***.** ****************
120. spacer 1.14|332485|27|NZ_CP016888|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gtggcgttgtcgaacagaccgccgttg Protospacer
.* ***** ******* *********
121. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggtcaccgccagcggggccagga Protospacer
********* ************ ***. *.
122. spacer 1.15|332530|30|NZ_CP016888|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccgatccagacaccgccagcggcgccgagg Protospacer
***..* .******************* **
123. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcg-ccgtgg CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg- Protospacer
***************** ***** **.*
124. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
125. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
126. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
127. spacer 3.1|364855|27|NZ_CP016888|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
128. spacer 3.1|364855|27|NZ_CP016888|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
129. spacer 3.7|365251|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
130. spacer 3.7|365251|27|NZ_CP016888|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
131. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
132. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
133. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
134. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
135. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
136. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
137. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
138. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
139. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
140. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
141. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
142. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
143. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
144. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
145. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
146. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
147. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
148. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
149. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
150. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
151. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
152. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
153. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
154. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
155. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
156. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
157. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
158. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
159. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
160. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
161. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
162. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
163. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
164. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
165. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
166. spacer 7.5|1575945|25|NZ_CP016888|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
167. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
168. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
169. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
170. spacer 7.13|1576587|34|NZ_CP016888|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
171. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 6, identity: 0.8
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
gtggtggtggccccggccgtgccggcgttg Protospacer
.** ***********. ***********
172. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 6, identity: 0.8
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
gtggtggtggccccggccgtgccggcgttg Protospacer
.** ***********. ***********
173. spacer 1.2|331876|27|NZ_CP016888|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
ccgaacaccccggcgtggccaccgtca CRISPR spacer
aacaacaccccggcgcggtcaccgtcg Protospacer
************.**.*******.
174. spacer 1.2|331876|27|NZ_CP016888|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 6, identity: 0.778
ccgaacaccccggcgtggccaccgtca CRISPR spacer
tggaacaccccggcgtggccgccgcgg Protospacer
. ******************.***. .
175. spacer 1.2|331876|27|NZ_CP016888|CRT matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 6, identity: 0.778
ccgaacaccccggcgtggccaccgtca CRISPR spacer
tcgaacaccccggcgtggccgacgcgg Protospacer
.*******************. **. .
176. spacer 1.4|331960|27|NZ_CP016888|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
ccgaacaccccggcgtggccaccgtca CRISPR spacer
aacaacaccccggcgcggtcaccgtcg Protospacer
************.**.*******.
177. spacer 1.4|331960|27|NZ_CP016888|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 6, identity: 0.778
ccgaacaccccggcgtggccaccgtca CRISPR spacer
tggaacaccccggcgtggccgccgcgg Protospacer
. ******************.***. .
178. spacer 1.4|331960|27|NZ_CP016888|CRT matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 6, identity: 0.778
ccgaacaccccggcgtggccaccgtca CRISPR spacer
tcgaacaccccggcgtggccgacgcgg Protospacer
.*******************. **. .
179. spacer 1.6|332050|30|NZ_CP016888|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
tcagcggagccgaagatcacgccgccgagc Protospacer
.*.************* ** ******* *
180. spacer 1.15|332530|30|NZ_CP016888|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg Protospacer
*************** ** ***** * *
181. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg---- CRISPR spacer
ccagccgggagaccgccagcggc----tggctct Protospacer
**.******* ************ ***
182. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc Protospacer
.**** ******.**************
183. spacer 3.1|364855|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
184. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
185. spacer 3.7|365251|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
186. spacer 3.9|365401|27|NZ_CP016888|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
187. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
188. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
189. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
190. spacer 3.10|365461|27|NZ_CP016888|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
191. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
192. spacer 4.2|629730|30|NZ_CP016888|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
193. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
194. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
195. spacer 4.2|629730|30|NZ_CP016888|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
196. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
197. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
198. spacer 4.2|629730|30|NZ_CP016888|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
199. spacer 4.2|629730|30|NZ_CP016888|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
200. spacer 4.2|629730|30|NZ_CP016888|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
201. spacer 4.2|629730|30|NZ_CP016888|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
202. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
203. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
204. spacer 4.2|629730|30|NZ_CP016888|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
205. spacer 4.2|629730|30|NZ_CP016888|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
206. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
207. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
208. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
209. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
210. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
211. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
212. spacer 7.13|1576587|34|NZ_CP016888|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
213. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
214. spacer 14.8|3976119|36|NZ_CP016888|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.833
tagcagcggtgccggcggcaccaacggctccggcgg- CRISPR spacer
ccgcatcggtgccggcggcaccatcggc-acggcggc Protospacer
. *** ***************** **** ******
215. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
216. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 7, identity: 0.767
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
gtggtggtggccccggccgtgccggcgttc Protospacer
.** ***********. **********
217. spacer 1.6|332050|30|NZ_CP016888|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc Protospacer
******.******** ******** .. *
218. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca Protospacer
******.******** ********* . .
219. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca Protospacer
..**** ** *****************. .
220. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc Protospacer
* ******.***************. . *
221. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc Protospacer
.** *.. *** *****************
222. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacaccga Protospacer
******.*************.**.* .*.
223. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
224. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
225. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
226. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg Protospacer
******** **.*********** .**
227. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
accgcatcgaccccgccagcggcgccgtga Protospacer
* ** *** *****************.
228. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
229. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
230. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
231. spacer 3.4|365050|27|NZ_CP016888|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
232. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
233. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
234. spacer 4.2|629730|30|NZ_CP016888|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
235. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
236. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
237. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
238. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
239. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
240. spacer 4.2|629730|30|NZ_CP016888|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
241. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
242. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
243. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
244. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
245. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
246. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
247. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
248. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
249. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
250. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
251. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
252. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
253. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
254. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
255. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
256. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
257. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
258. spacer 6.1|1452291|30|NZ_CP016888|CRT matches to MF403009 (Agrobacterium phage Atu_ph08, complete genome) position: , mismatch: 7, identity: 0.767
gcggcgggtcggcacggtttggattgggtg CRISPR spacer
ctggctggtcgccacggtttggattcagtc Protospacer
.*** ***** ************* .**
259. spacer 6.3|1452393|30|NZ_CP016888|CRT matches to MF403009 (Agrobacterium phage Atu_ph08, complete genome) position: , mismatch: 7, identity: 0.767
gcggcgggtcggcacggtttggattgggtg CRISPR spacer
ctggctggtcgccacggtttggattcagtc Protospacer
.*** ***** ************* .**
260. spacer 7.1|1575723|28|NZ_CP016888|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
261. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
262. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
263. spacer 8.3|2077654|30|NZ_CP016888|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
264. spacer 8.3|2077654|30|NZ_CP016888|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
265. spacer 8.3|2077654|30|NZ_CP016888|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
266. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttgagatccgcgacgatgggtgtggcgccggc Protospacer
** .********.**** ***********
267. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttcccgcaggcgacggtgcgggcggcgccggc Protospacer
**..* * ********* ***.*********
268. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc Protospacer
**.************************ ** ..* .
269. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt Protospacer
*********** ******.******** * ***
270. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
271. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
272. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
273. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
274. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
275. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
276. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
277. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
278. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
279. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc Protospacer
*****.****.************* . **.* *
280. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc Protospacer
*****.****.************* . **.* *
281. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
282. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
283. spacer 1.1|331828|30|NZ_CP016888|CRT matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
284. spacer 1.1|331828|30|NZ_CP016888|CRT matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
285. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
286. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
287. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
288. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
289. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
290. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
291. spacer 1.1|331828|30|NZ_CP016888|CRT matches to MN586011 (Mycobacterium phage LilMoolah, complete genome) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
gcgggtgcggccccggctttgccgaacctt Protospacer
****.*.****************. .*
292. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
293. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
294. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NC_011960 (Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
295. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
296. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.733
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
ctgggcgtgaccccggcgttgccggtccac Protospacer
*.*******.******* *******. .
297. spacer 1.6|332050|30|NZ_CP016888|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
agcacgaagccgaagagaaagccgccgatg Protospacer
.**.********** ********* *
298. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcaccctggacaccgcctgcggcgccggac Protospacer
.*. ** ********** ********* .
299. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcacgaaca Protospacer
******.******** *******.* . .
300. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga Protospacer
.** **************** ****.
301. spacer 1.15|332530|30|NZ_CP016888|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcg----gcgccgtgg CRISPR spacer
agggccgggacaccgcccgcggccagcgct---- Protospacer
*************** *** ****.
302. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
303. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
304. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
305. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
306. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
307. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
308. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
309. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
310. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
311. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
312. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
313. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
314. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
315. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
316. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
317. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
318. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
319. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
320. spacer 8.3|2077654|30|NZ_CP016888|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
321. spacer 8.3|2077654|30|NZ_CP016888|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
322. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agcgcggccgcgtcggtgggggtggcgcccgc Protospacer
. * ***** **************** **
323. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcaccaccgcggcggtgcgggtggcgccggc Protospacer
. . *. *****.***** *************
324. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga Protospacer
*.******** ******* ********.. *
325. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac Protospacer
*.. ******.***************.**. *
326. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
327. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
328. spacer 14.8|3976119|36|NZ_CP016888|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.778
tagcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gcgctgatgcgccggcgacaccaaaggctccggcgg Protospacer
** * *.*******.****** ***********
329. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga Protospacer
*.******** ******* ********.. *
330. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac Protospacer
*.. ******.***************.**. *
331. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
332. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
333. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gatcgccggcaccggcggcaccaccggccagcc Protospacer
* ******************** ****.
334. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gatcgccggcaccggcggcaccaccggccagcc Protospacer
* ******************** ****.
335. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
acccgccggcaccggcggcgccaacggatcgaa Protospacer
****************.******* ** ..
336. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
aggcggcggcaccggcggcaccaccggctggcg Protospacer
..** ***************** ***** *
337. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cgaagcctgcaccggcggcacccacggcacaaa Protospacer
*.* *** ************** ***** * ..
338. spacer 1.1|331828|30|NZ_CP016888|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 9, identity: 0.7
ccgggcgtggccccggctttgccggcgttg CRISPR spacer
agaaagatggcgccggctttgccggctttg Protospacer
... .**** ************** ***
339. spacer 1.16|332578|39|NZ_CP016888|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag Protospacer
***. *. **************** *** *******
340. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
341. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
342. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
343. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
344. spacer 4.2|629730|30|NZ_CP016888|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
345. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
346. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
347. spacer 5.1|690437|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
348. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
349. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
350. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
351. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
352. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
353. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
354. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
355. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
356. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
357. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
358. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcccccggcgtgacggtggaggtggcgccggc Protospacer
...*. **.********.************
359. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
360. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
361. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
362. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gtggcggtggcggcggtgggggtggcggcggc Protospacer
* * . ***.************** ****
363. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tgcgaccgggcgacggtggaggtggcgccagc Protospacer
* . .* **********.*********.**
364. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
caacattcagcgacggtgggtgtggcggcggc Protospacer
. . *.* *********** ****** ****
365. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcacgacggcggcggtgcgggtggcgccggc Protospacer
. . * * ***.***** *************
366. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg Protospacer
*********** ******.******* * .**
367. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc Protospacer
... *.************ *******.***. *
368. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca Protospacer
*.. ****************** ** ***..
369. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
370. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
371. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
372. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
373. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
374. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
375. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
376. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
377. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
378. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
379. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
380. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
381. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
382. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
383. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
384. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
385. spacer 14.11|3976350|36|NZ_CP016888|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
386. spacer 14.11|3976350|36|NZ_CP016888|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
387. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc Protospacer
... *.************ *******.***. *
388. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca Protospacer
*.. ****************** ** ***..
389. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
390. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
391. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
392. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
393. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
394. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
395. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
396. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
397. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
398. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
399. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
400. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
401. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
402. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
403. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
404. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
405. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
gagcgccgccaccgacggcaccaacggcctgca Protospacer
*.***** *****.*************.. .
406. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NZ_CP041197 (Pseudarthrobacter sp. NIBRBAC000502770 plasmid pMK-1, complete sequence) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
agccccctgcaccggcggaaccaacggctaagc Protospacer
. * ** ********** ********** *
407. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to MK524502 (Microbacterium phage TimoTea, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
tgacaacggccccggcggcaccaccggctcata Protospacer
..**. **** ************ ****** .
408. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NZ_CP042515 (Serratia marcescens strain E28 plasmid pE28_003) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
ctccttcggcttcggcggcaccaacggctcgct Protospacer
* * .**** .******************
409. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to KT281796 (Mycobacterium phage Zakhe101, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
410. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
411. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to MN428058 (Mycobacterium phage Krili, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
412. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
413. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
414. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
415. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
416. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to MT818425 (Mycobacterium phage NiebruSaylor, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
417. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to NC_022325 (Mycobacterium phage Dylan, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
418. spacer 14.16|3976732|33|NZ_CP016888|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcaccaacggctccgg CRISPR spacer
cttggggtccaccggcgggaccagcggctccgg Protospacer
* * ********* ****.*********
419. spacer 14.19|3976957|36|NZ_CP016888|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
420. spacer 14.19|3976957|36|NZ_CP016888|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
421. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
422. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
423. spacer 3.6|365185|33|NZ_CP016888|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
424. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
425. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
426. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
427. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
428. spacer 7.10|1576338|31|NZ_CP016888|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
429. spacer 7.13|1576587|34|NZ_CP016888|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
430. spacer 10.23|3118079|35|NZ_CP016888|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
431. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
aggacggccgcggcggtggcggtggcgccgta Protospacer
* *****.****** **********
432. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ctgctggccgcgacggtgctggtggcgccgat Protospacer
.* .. *********** **********..
433. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tcgcggatcgggatggtgggggtggcgccgga Protospacer
*. . .** **.*****************
434. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcgagggcggcgacggtgggcgtgtcgccggc Protospacer
. * *********** *** *******
435. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
436. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
437. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
438. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
439. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
440. spacer 12.6|3747306|32|NZ_CP016888|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcagcagcgcgacggtgtcggtggcgccggt Protospacer
. . . ********** ***********.
441. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
442. spacer 14.3|3975729|36|NZ_CP016888|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
443. spacer 14.5|3975882|33|NZ_CP016888|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
444. spacer 14.13|3976494|33|NZ_CP016888|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .