Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016447 Acidovorax sp. RAC01 chromosome, complete genome 2 crisprs RT,cas3,cas2,cas1,cas4,cas7,cas8c,cas5,DinG,DEDDh,WYL,PD-DExK,csa3 2 22 5 0

Results visualization

1. NZ_CP016447
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016447_1 1616855-1620003 TypeI NA
44 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3,DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016447_2 3399016-3399141 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP016447_1 1.23|1618446|35|NZ_CP016447|CRISPRCasFinder,CRT 1618446-1618480 35 NZ_CP016447.1 4188092-4188126 0 1.0
NZ_CP016447_1 1.23|1618446|35|NZ_CP016447|CRISPRCasFinder,CRT 1618446-1618480 35 NZ_CP016447.1 4254425-4254459 0 1.0
NZ_CP016447_1 1.67|1618448|35|NZ_CP016447|PILER-CR 1618448-1618482 35 NZ_CP016447.1 4188092-4188126 0 1.0
NZ_CP016447_1 1.67|1618448|35|NZ_CP016447|PILER-CR 1618448-1618482 35 NZ_CP016447.1 4254425-4254459 0 1.0

1. spacer 1.23|1618446|35|NZ_CP016447|CRISPRCasFinder,CRT matches to position: 4188092-4188126, mismatch: 0, identity: 1.0

gagctggccaccaaggcgcgcaagcgcagcaacaa	CRISPR spacer
gagctggccaccaaggcgcgcaagcgcagcaacaa	Protospacer
***********************************

2. spacer 1.23|1618446|35|NZ_CP016447|CRISPRCasFinder,CRT matches to position: 4254425-4254459, mismatch: 0, identity: 1.0

gagctggccaccaaggcgcgcaagcgcagcaacaa	CRISPR spacer
gagctggccaccaaggcgcgcaagcgcagcaacaa	Protospacer
***********************************

3. spacer 1.67|1618448|35|NZ_CP016447|PILER-CR matches to position: 4188092-4188126, mismatch: 0, identity: 1.0

gagctggccaccaaggcgcgcaagcgcagcaacaa	CRISPR spacer
gagctggccaccaaggcgcgcaagcgcagcaacaa	Protospacer
***********************************

4. spacer 1.67|1618448|35|NZ_CP016447|PILER-CR matches to position: 4254425-4254459, mismatch: 0, identity: 1.0

gagctggccaccaaggcgcgcaagcgcagcaacaa	CRISPR spacer
gagctggccaccaaggcgcgcaagcgcagcaacaa	Protospacer
***********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016447_1 1.15|1617887|33|NZ_CP016447|CRISPRCasFinder,CRT 1617887-1617919 33 JF937105 Mycobacterium phage Rey, complete genome 7462-7494 7 0.788
NZ_CP016447_1 1.31|1619012|34|NZ_CP016447|CRISPRCasFinder,CRT 1619012-1619045 34 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 363738-363771 7 0.794
NZ_CP016447_1 1.59|1617889|33|NZ_CP016447|PILER-CR 1617889-1617921 33 JF937105 Mycobacterium phage Rey, complete genome 7462-7494 7 0.788
NZ_CP016447_1 1.75|1619014|34|NZ_CP016447|PILER-CR 1619014-1619047 34 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 363738-363771 7 0.794
NZ_CP016447_1 1.16|1617956|33|NZ_CP016447|CRISPRCasFinder,CRT 1617956-1617988 33 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 298311-298343 8 0.758
NZ_CP016447_1 1.18|1618096|34|NZ_CP016447|CRISPRCasFinder,CRT 1618096-1618129 34 NZ_CP031599 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence 122862-122895 8 0.765
NZ_CP016447_1 1.60|1617958|33|NZ_CP016447|PILER-CR 1617958-1617990 33 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 298311-298343 8 0.758
NZ_CP016447_1 1.62|1618098|34|NZ_CP016447|PILER-CR 1618098-1618131 34 NZ_CP031599 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence 122862-122895 8 0.765
NZ_CP016447_1 1.4|1617110|34|NZ_CP016447|CRISPRCasFinder,CRT 1617110-1617143 34 NZ_CP007515 Rubrobacter radiotolerans strain RSPS-4 plasmid 1, complete sequence 107707-107740 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 127368-127401 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 127241-127274 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 220784-220817 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 385124-385157 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 264886-264919 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 260502-260535 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 373889-373922 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 193017-193050 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 203744-203777 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NC_007763 Rhizobium etli CFN 42 plasmid p42b, complete sequence 106123-106156 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 234940-234973 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 242564-242597 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP020907 Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence 105246-105279 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 237073-237106 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 242568-242601 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 234855-234888 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP007050 Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence 12974-13007 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 241049-241082 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 668134-668167 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 238886-238919 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 242564-242597 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NC_021906 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence 104156-104189 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 171793-171826 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 241049-241082 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 618905-618938 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 234855-234888 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 66384-66417 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 233777-233810 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 401905-401938 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 178031-178064 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP014303 Hymenobacter sp. PAMC 26628 plasmid unnamed, complete sequence 2388-2421 9 0.735
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 667152-667185 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 162172-162205 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_LS999207 Enterobacter cloacae isolate EC-TO80 plasmid 2, complete sequence 104816-104849 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 61720-61753 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 61719-61752 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 53129-53162 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 74811-74844 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 96729-96762 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 215921-215954 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 142295-142328 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 173215-173248 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP013712 Klebsiella pneumoniae strain J1 plasmid 1, complete sequence 43127-43160 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 63180-63213 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 94141-94174 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 145801-145834 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 81071-81104 9 0.735
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 278193-278226 9 0.735
NZ_CP016447_1 1.48|1617112|34|NZ_CP016447|PILER-CR 1617112-1617145 34 NZ_CP007515 Rubrobacter radiotolerans strain RSPS-4 plasmid 1, complete sequence 107707-107740 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 127368-127401 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 127241-127274 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 220784-220817 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 385124-385157 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 264886-264919 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 260502-260535 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 373889-373922 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 193017-193050 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 203744-203777 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NC_007763 Rhizobium etli CFN 42 plasmid p42b, complete sequence 106123-106156 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 234940-234973 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 242564-242597 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP020907 Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence 105246-105279 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 237073-237106 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 242568-242601 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 234855-234888 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP007050 Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence 12974-13007 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 241049-241082 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 668134-668167 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 238886-238919 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 242564-242597 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NC_021906 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence 104156-104189 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 171793-171826 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 241049-241082 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 618905-618938 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 234855-234888 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 66384-66417 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 233777-233810 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 401905-401938 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 178031-178064 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP014303 Hymenobacter sp. PAMC 26628 plasmid unnamed, complete sequence 2388-2421 9 0.735
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 667152-667185 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 162172-162205 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_LS999207 Enterobacter cloacae isolate EC-TO80 plasmid 2, complete sequence 104816-104849 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 61720-61753 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 61719-61752 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 53129-53162 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 74811-74844 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 96729-96762 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 215921-215954 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP029739 Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence 142295-142328 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 173215-173248 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP013712 Klebsiella pneumoniae strain J1 plasmid 1, complete sequence 43127-43160 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 63180-63213 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP046613 Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence 94141-94174 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 145801-145834 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP043934 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence 81071-81104 9 0.735
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 278193-278226 9 0.735
NZ_CP016447_1 1.7|1617322|34|NZ_CP016447|CRISPRCasFinder,CRT 1617322-1617355 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 976765-976798 10 0.706
NZ_CP016447_1 1.17|1618025|35|NZ_CP016447|CRISPRCasFinder,CRT 1618025-1618059 35 NC_008739 Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence 36483-36517 10 0.714
NZ_CP016447_1 1.18|1618096|34|NZ_CP016447|CRISPRCasFinder,CRT 1618096-1618129 34 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 63931-63964 10 0.706
NZ_CP016447_1 1.30|1618940|36|NZ_CP016447|CRISPRCasFinder,CRT 1618940-1618975 36 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 386382-386417 10 0.722
NZ_CP016447_1 1.30|1618940|36|NZ_CP016447|CRISPRCasFinder,CRT 1618940-1618975 36 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 215282-215317 10 0.722
NZ_CP016447_1 1.32|1619082|35|NZ_CP016447|CRISPRCasFinder,CRT 1619082-1619116 35 NZ_CP048631 Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence 155168-155202 10 0.714
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 124429-124462 10 0.706
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 237352-237385 10 0.706
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP054025 Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence 183718-183751 10 0.706
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 147074-147107 10 0.706
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 156461-156494 10 0.706
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 147817-147850 10 0.706
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 156645-156678 10 0.706
NZ_CP016447_1 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT 1619793-1619826 34 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 37125-37158 10 0.706
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP011590 Enterobacter asburiae strain CAV1043 plasmid pCAV1043-97, complete sequence 17660-17693 10 0.706
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP032834 Klebsiella pneumoniae strain INF237 plasmid pINF237_01-VP, complete sequence 16982-17015 10 0.706
NZ_CP016447_1 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT 1619934-1619967 34 NZ_CP030920 Escherichia coli strain KL53 plasmid pKL53-L, complete sequence 10056-10089 10 0.706
NZ_CP016447_1 1.51|1617324|34|NZ_CP016447|PILER-CR 1617324-1617357 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 976765-976798 10 0.706
NZ_CP016447_1 1.61|1618027|35|NZ_CP016447|PILER-CR 1618027-1618061 35 NC_008739 Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence 36483-36517 10 0.714
NZ_CP016447_1 1.62|1618098|34|NZ_CP016447|PILER-CR 1618098-1618131 34 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 63931-63964 10 0.706
NZ_CP016447_1 1.74|1618942|36|NZ_CP016447|PILER-CR 1618942-1618977 36 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 386382-386417 10 0.722
NZ_CP016447_1 1.74|1618942|36|NZ_CP016447|PILER-CR 1618942-1618977 36 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 215282-215317 10 0.722
NZ_CP016447_1 1.76|1619084|35|NZ_CP016447|PILER-CR 1619084-1619118 35 NZ_CP048631 Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence 155168-155202 10 0.714
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 124429-124462 10 0.706
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 237352-237385 10 0.706
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP054025 Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence 183718-183751 10 0.706
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 147074-147107 10 0.706
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 156461-156494 10 0.706
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 147817-147850 10 0.706
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 156645-156678 10 0.706
NZ_CP016447_1 1.86|1619795|34|NZ_CP016447|PILER-CR 1619795-1619828 34 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 37125-37158 10 0.706
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP011590 Enterobacter asburiae strain CAV1043 plasmid pCAV1043-97, complete sequence 17660-17693 10 0.706
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP032834 Klebsiella pneumoniae strain INF237 plasmid pINF237_01-VP, complete sequence 16982-17015 10 0.706
NZ_CP016447_1 1.88|1619936|34|NZ_CP016447|PILER-CR 1619936-1619969 34 NZ_CP030920 Escherichia coli strain KL53 plasmid pKL53-L, complete sequence 10056-10089 10 0.706

1. spacer 1.15|1617887|33|NZ_CP016447|CRISPRCasFinder,CRT matches to JF937105 (Mycobacterium phage Rey, complete genome) position: , mismatch: 7, identity: 0.788

-gctggggatgacgttcggcgacgcctccgtggt	CRISPR spacer
cgct-gtcatgacgttcggctacgccttcgtgcg	Protospacer
 *** *  ************ ******.****  

2. spacer 1.31|1619012|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 7, identity: 0.794

gtgttttgctcgcgcagttgagcgttttcagcgt	CRISPR spacer
tggctttgctcgcgcagttgggcgttttccactt	Protospacer
  *.****************.******** .* *

3. spacer 1.59|1617889|33|NZ_CP016447|PILER-CR matches to JF937105 (Mycobacterium phage Rey, complete genome) position: , mismatch: 7, identity: 0.788

-gctggggatgacgttcggcgacgcctccgtggt	CRISPR spacer
cgct-gtcatgacgttcggctacgccttcgtgcg	Protospacer
 *** *  ************ ******.****  

4. spacer 1.75|1619014|34|NZ_CP016447|PILER-CR matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 7, identity: 0.794

gtgttttgctcgcgcagttgagcgttttcagcgt	CRISPR spacer
tggctttgctcgcgcagttgggcgttttccactt	Protospacer
  *.****************.******** .* *

5. spacer 1.16|1617956|33|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

ggccaggctggccacctcgacgggactcacctt	CRISPR spacer
ggccaggctggcgacctcgatggggtccccgat	Protospacer
************ *******.***...* *  *

6. spacer 1.18|1618096|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 8, identity: 0.765

cgaagtaagcgcacaggcggcggtccaccttctt	CRISPR spacer
tgaaattgtcgcgcaggcggcggtccacctcctc	Protospacer
.***.* . ***.*****************.**.

7. spacer 1.60|1617958|33|NZ_CP016447|PILER-CR matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

ggccaggctggccacctcgacgggactcacctt	CRISPR spacer
ggccaggctggcgacctcgatggggtccccgat	Protospacer
************ *******.***...* *  *

8. spacer 1.62|1618098|34|NZ_CP016447|PILER-CR matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 8, identity: 0.765

cgaagtaagcgcacaggcggcggtccaccttctt	CRISPR spacer
tgaaattgtcgcgcaggcggcggtccacctcctc	Protospacer
.***.* . ***.*****************.**.

9. spacer 1.4|1617110|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP007515 (Rubrobacter radiotolerans strain RSPS-4 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

-cgtcacgaagatcctggaccgcgtggtgcaggac	CRISPR spacer
gcggt-tggagatcctggacctcctggtgcagggg	Protospacer
 ** . .*.************ * *********. 

10. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgcattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*********************.  .

11. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgcattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*********************.  .

12. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

13. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

14. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

15. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

16. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

17. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

18. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

19. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

20. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

21. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

22. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

23. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

24. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

25. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

26. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

27. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

28. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

29. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

30. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

31. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

32. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

33. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

34. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

35. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

36. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

37. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

38. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

39. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

40. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP014303 (Hymenobacter sp. PAMC 26628 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcgg---cgagtg	CRISPR spacer
cgcccgcctgcattgccctgctgcgcggacccga---	Protospacer
    ** ********** **********   ***   

41. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
ggcccgacagcattgccgcgctgcgcggtggtcg	Protospacer
*   **** *********.*********.*. .*

42. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

43. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_LS999207 (Enterobacter cloacae isolate EC-TO80 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

44. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

45. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

46. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

47. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

48. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

49. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

50. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

51. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

52. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP013712 (Klebsiella pneumoniae strain J1 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

53. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

54. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

55. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

56. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

57. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

58. spacer 1.48|1617112|34|NZ_CP016447|PILER-CR matches to NZ_CP007515 (Rubrobacter radiotolerans strain RSPS-4 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

-cgtcacgaagatcctggaccgcgtggtgcaggac	CRISPR spacer
gcggt-tggagatcctggacctcctggtgcagggg	Protospacer
 ** . .*.************ * *********. 

59. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgcattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*********************.  .

60. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgcattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*********************.  .

61. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

62. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

63. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

64. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

65. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

66. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

67. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

68. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

69. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

70. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

71. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

72. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

73. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

74. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

75. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

76. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

77. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

78. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

79. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

80. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

81. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

82. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

83. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

84. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

85. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

86. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcattgccgtgatgcgcggcggcaa	Protospacer
 * .****.*********** *********.  .

87. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

88. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 * .****.****.****************.  .

89. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP014303 (Hymenobacter sp. PAMC 26628 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcgg---cgagtg	CRISPR spacer
cgcccgcctgcattgccctgctgcgcggacccga---	Protospacer
    ** ********** **********   ***   

90. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
ggcccgacagcattgccgcgctgcgcggtggtcg	Protospacer
*   **** *********.*********.*. .*

91. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

92. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_LS999207 (Enterobacter cloacae isolate EC-TO80 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

93. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

94. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

95. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

96. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

97. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

98. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

99. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

100. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

101. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP013712 (Klebsiella pneumoniae strain J1 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

102. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

103. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

104. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

105. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

106. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 9, identity: 0.735

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cggagccaacagccagcgctggcgcgatttagcc	Protospacer
**** * ******************..* *   .

107. spacer 1.7|1617322|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgtaggtgaaaaggtgctggccgaactgcc	CRISPR spacer
tgacgctgggcgaagaggtgctggccgaactggg	Protospacer
.*.   *.**.***.*****************  

108. spacer 1.17|1618025|35|NZ_CP016447|CRISPRCasFinder,CRT matches to NC_008739 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence) position: , mismatch: 10, identity: 0.714

cgcaagacctcatttccttgctgctgggtggtgct	CRISPR spacer
tgtgtttgttcattaccttgctggtgggtggtgct	Protospacer
.*..    .***** ******** ***********

109. spacer 1.18|1618096|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 10, identity: 0.706

cgaagtaagcgcacaggcggcggtccaccttctt	CRISPR spacer
tcctgcgggcgcgcaggcggcggtacaccttcta	Protospacer
.   *...****.*********** ******** 

110. spacer 1.30|1618940|36|NZ_CP016447|CRISPRCasFinder,CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 10, identity: 0.722

gcccgcgccgccgagcgcaagcgcgcctaccaggaa	CRISPR spacer
gctcgcgccgccgagcgcatgcgcgctctgcaacgc	Protospacer
**.**************** ******..  **. . 

111. spacer 1.30|1618940|36|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 10, identity: 0.722

gcccgcgccgccgagcgcaag-----cgcgcctaccaggaa	CRISPR spacer
ccccgcgccgccgagcgcacgcccgccgcgttgacc-----	Protospacer
 ****************** *     ****.. ***     

112. spacer 1.32|1619082|35|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP048631 (Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence) position: , mismatch: 10, identity: 0.714

ctggtcttgccgatggtgacgacgccttcggtgat	CRISPR spacer
ctggtcttgccgatcgtggcgacgcaactgctcta	Protospacer
************** ***.******  ..* *   

113. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 . .****.****.****************.  .

114. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgtattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*.*******************.  .

115. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgtattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*.*******************.  .

116. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgtattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*.*******************.  .

117. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggtggcaa	Protospacer
 * .****.****.**************.*.  .

118. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggtggcaa	Protospacer
 * .****.****.**************.*.  .

119. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggtggcaa	Protospacer
 * .****.****.**************.*.  .

120. spacer 1.42|1619793|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggtggcaa	Protospacer
 * .****.****.**************.*.  .

121. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP011590 (Enterobacter asburiae strain CAV1043 plasmid pCAV1043-97, complete sequence) position: , mismatch: 10, identity: 0.706

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cgcataaaacagccagcgctggcgtgatttagcg	Protospacer
** ** ******************...* *    

122. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP032834 (Klebsiella pneumoniae strain INF237 plasmid pINF237_01-VP, complete sequence) position: , mismatch: 10, identity: 0.706

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cgcataaaacagccagcgctggcgtgatttagcc	Protospacer
** ** ******************...* *   .

123. spacer 1.44|1619934|34|NZ_CP016447|CRISPRCasFinder,CRT matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 10, identity: 0.706

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cgcataaaacagccagcgctggcgtgatttagcg	Protospacer
** ** ******************...* *    

124. spacer 1.51|1617324|34|NZ_CP016447|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

cgggcgtaggtgaaaaggtgctggccgaactgcc	CRISPR spacer
tgacgctgggcgaagaggtgctggccgaactggg	Protospacer
.*.   *.**.***.*****************  

125. spacer 1.61|1618027|35|NZ_CP016447|PILER-CR matches to NC_008739 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence) position: , mismatch: 10, identity: 0.714

cgcaagacctcatttccttgctgctgggtggtgct	CRISPR spacer
tgtgtttgttcattaccttgctggtgggtggtgct	Protospacer
.*..    .***** ******** ***********

126. spacer 1.62|1618098|34|NZ_CP016447|PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 10, identity: 0.706

cgaagtaagcgcacaggcggcggtccaccttctt	CRISPR spacer
tcctgcgggcgcgcaggcggcggtacaccttcta	Protospacer
.   *...****.*********** ******** 

127. spacer 1.74|1618942|36|NZ_CP016447|PILER-CR matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 10, identity: 0.722

gcccgcgccgccgagcgcaagcgcgcctaccaggaa	CRISPR spacer
gctcgcgccgccgagcgcatgcgcgctctgcaacgc	Protospacer
**.**************** ******..  **. . 

128. spacer 1.74|1618942|36|NZ_CP016447|PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 10, identity: 0.722

gcccgcgccgccgagcgcaag-----cgcgcctaccaggaa	CRISPR spacer
ccccgcgccgccgagcgcacgcccgccgcgttgacc-----	Protospacer
 ****************** *     ****.. ***     

129. spacer 1.76|1619084|35|NZ_CP016447|PILER-CR matches to NZ_CP048631 (Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence) position: , mismatch: 10, identity: 0.714

ctggtcttgccgatggtgacgacgccttcggtgat	CRISPR spacer
ctggtcttgccgatcgtggcgacgcaactgctcta	Protospacer
************** ***.******  ..* *   

130. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgcatcgccgtgctgcgcggcggcaa	Protospacer
 . .****.****.****************.  .

131. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgtattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*.*******************.  .

132. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgtattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*.*******************.  .

133. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cttgcgaccgtattgccgtgctgcgcggcggcaa	Protospacer
 . .****.*.*******************.  .

134. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggtggcaa	Protospacer
 * .****.****.**************.*.  .

135. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggtggcaa	Protospacer
 * .****.****.**************.*.  .

136. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggtggcaa	Protospacer
 * .****.****.**************.*.  .

137. spacer 1.86|1619795|34|NZ_CP016447|PILER-CR matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 10, identity: 0.706

gcaacgactgcattgccgtgctgcgcggcgagtg	CRISPR spacer
cctgcgaccgcatcgccgtgctgcgcggtggcaa	Protospacer
 * .****.****.**************.*.  .

138. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP011590 (Enterobacter asburiae strain CAV1043 plasmid pCAV1043-97, complete sequence) position: , mismatch: 10, identity: 0.706

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cgcataaaacagccagcgctggcgtgatttagcg	Protospacer
** ** ******************...* *    

139. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP032834 (Klebsiella pneumoniae strain INF237 plasmid pINF237_01-VP, complete sequence) position: , mismatch: 10, identity: 0.706

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cgcataaaacagccagcgctggcgtgatttagcc	Protospacer
** ** ******************...* *   .

140. spacer 1.88|1619936|34|NZ_CP016447|PILER-CR matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 10, identity: 0.706

cggatcaaacagccagcgctggcgcagtgttcat	CRISPR spacer
cgcataaaacagccagcgctggcgtgatttagcg	Protospacer
** ** ******************...* *    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2718727 : 2788844 56 Ralstonia_phage(20.0%) integrase,tRNA,protease,transposase attL 2739061:2739081|attR 2760656:2760676
DBSCAN-SWA_2 3858551 : 3927562 55 Cronobacter_phage(22.22%) integrase,tRNA,transposase attL 3858407:3858466|attR 3893257:3896462
DBSCAN-SWA_3 4170822 : 4185117 20 Pseudomonas_virus(40.0%) terminase NA
DBSCAN-SWA_4 4237155 : 4251450 20 Pseudomonas_virus(40.0%) terminase NA
DBSCAN-SWA_5 4422826 : 4473025 45 Burkholderia_virus(33.33%) integrase,capsid,transposase attL 4449239:4449255|attR 4460456:4460472
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage