Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013367 Burkholderia territorii strain RF8-non-BP5 chromosome 3, complete sequence 0 crisprs WYL,csa3,PD-DExK 0 0 1 0
NZ_CP013365 Burkholderia territorii strain RF8-non-BP5 chromosome 2, complete sequence 4 crisprs cas3,csa3,DinG,DEDDh 16 22 0 0
NZ_CP013366 Burkholderia territorii strain RF8-non-BP5 chromosome 1, complete sequence 1 crisprs cas3,DEDDh,csa3,DinG 0 0 3 0

Results visualization

1. NZ_CP013367
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 421876 : 482163 43 uncultured_Caudovirales_phage(22.22%) transposase,plate NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP013365
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013365_1 745157-745257 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013365_2 934509-934597 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013365_3 2048206-2050102 Orphan NA
30 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013365_4 2052279-2052355 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013365.1 2050856-2050884 0 1.0
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013365.1 2051093-2051121 0 1.0
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013365.1 2051513-2051541 0 1.0
NZ_CP013365_3 3.23|2049587|50|NZ_CP013365|CRT 2049587-2049636 50 NZ_CP013365.1 2050964-2051013 0 1.0
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013365.1 2051039-2051067 0 1.0
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013365.1 2050856-2050884 1 0.966
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013365.1 2051093-2051121 1 0.966
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013365.1 2051513-2051541 1 0.966
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013365.1 2051039-2051067 1 0.966
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013367.1 731519-731547 1 0.966
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013367.1 731648-731676 1 0.966
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013365.1 2051039-2051067 1 0.966
NZ_CP013365_3 3.27|2049845|50|NZ_CP013365|CRT 2049845-2049894 50 NZ_CP013365.1 2052137-2052186 1 0.98
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013365.1 2052341-2052369 1 0.966
NZ_CP013365_1 1.1|745183|49|NZ_CP013365|CRISPRCasFinder 745183-745231 49 NZ_CP013365.1 2055053-2055101 2 0.959
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NZ_CP013365.1 2051039-2051067 2 0.931
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NZ_CP013365.1 2051039-2051067 2 0.931
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP013365.1 747114-747148 2 0.943
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013365.1 747174-747202 2 0.931
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013367.1 731519-731547 2 0.931
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013367.1 731648-731676 2 0.931
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NZ_CP013365.1 2051039-2051067 2 0.931
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 NZ_CP013365.1 2051567-2051595 2 0.931
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 NZ_CP013365.1 746625-746653 2 0.931
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 NZ_CP013365.1 746808-746836 2 0.931
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013365.1 747390-747418 2 0.931
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP013365.1 747120-747148 2 0.931
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP013365.1 747444-747472 2 0.931
NZ_CP013365_3 3.29|2049974|50|NZ_CP013365|CRT 2049974-2050023 50 NZ_CP013365.1 2050835-2050884 2 0.96
NZ_CP013365_3 3.29|2049974|50|NZ_CP013365|CRT 2049974-2050023 50 NZ_CP013365.1 2052137-2052186 2 0.96
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013365.1 746163-746191 2 0.931
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013365.1 747573-747601 2 0.931
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013365.1 2052911-2052939 2 0.931
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013365.1 2054093-2054121 2 0.931

1. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to position: 2050856-2050884, mismatch: 0, identity: 1.0 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtcg	Protospacer
*****************************

2. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to position: 2051093-2051121, mismatch: 0, identity: 1.0 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtcg	Protospacer
*****************************

3. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to position: 2051513-2051541, mismatch: 0, identity: 1.0 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtcg	Protospacer
*****************************

4. spacer 3.23|2049587|50|NZ_CP013365|CRT matches to position: 2050964-2051013, mismatch: 0, identity: 1.0 

cggcatcaactcgctgtcgaccggcctcagctcgaccaacagctcggtcg	CRISPR spacer
cggcatcaactcgctgtcgaccggcctcagctcgaccaacagctcggtcg	Protospacer
**************************************************

5. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to position: 2051039-2051067, mismatch: 0, identity: 1.0 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaacagctcgatct	Protospacer
*****************************

6. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to position: 2050856-2050884, mismatch: 1, identity: 0.966 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtcg	Protospacer
******************.**********

7. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to position: 2051093-2051121, mismatch: 1, identity: 0.966 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtcg	Protospacer
******************.**********

8. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to position: 2051513-2051541, mismatch: 1, identity: 0.966 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtcg	Protospacer
******************.**********

9. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to position: 2051039-2051067, mismatch: 1, identity: 0.966 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaacagctcgatct	Protospacer
***.*************************

10. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to position: 731519-731547, mismatch: 1, identity: 0.966 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgacgaacagttcggtcg	Protospacer
*************** *************

11. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to position: 731648-731676, mismatch: 1, identity: 0.966 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgacgaacagttcggtcg	Protospacer
*************** *************

12. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to position: 2051039-2051067, mismatch: 1, identity: 0.966 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaacagctcgatct	Protospacer
******.**********************

13. spacer 3.27|2049845|50|NZ_CP013365|CRT matches to position: 2052137-2052186, mismatch: 1, identity: 0.98 

gggtatcaactcgctgtcgaccggcctcagctcgaccaacagttcggtcg	CRISPR spacer
gggcatcaactcgctgtcgaccggcctcagctcgaccaacagttcggtcg	Protospacer
***.**********************************************

14. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to position: 2052341-2052369, mismatch: 1, identity: 0.966 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
cggtctctcgtcggctaacagctcgatca	Protospacer
***.*************************

15. spacer 1.1|745183|49|NZ_CP013365|CRISPRCasFinder matches to position: 2055053-2055101, mismatch: 2, identity: 0.959 

gaggttgctgttggtcgagctgaggcccgtcgacagcgagttgatcgcc	CRISPR spacer
gaggttgctgtttgtcgagctcaggcccgtcgacagcgagttgatcgcc	Protospacer
************ ******** ***************************

16. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to position: 2051039-2051067, mismatch: 2, identity: 0.931 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
cggcctctcgtcggctaacagctcgatct	Protospacer
***************.**.**********

17. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to position: 2051039-2051067, mismatch: 2, identity: 0.931 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
cggcctctcgtcggctaacagctcgatct	Protospacer
****** ***********.**********

18. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to position: 747114-747148, mismatch: 2, identity: 0.943 

tgggctgtcgtcggctaacagctcgatctcgtcgc	CRISPR spacer
tggtctctcgtcggctaacagctcgatctcgtcgc	Protospacer
*** ** ****************************

19. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to position: 747174-747202, mismatch: 2, identity: 0.931 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagttcgaccaatagttcgatcg	Protospacer
*********.***************.***

20. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to position: 731519-731547, mismatch: 2, identity: 0.931 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgacgaacagttcggtcg	Protospacer
*************** **.**********

21. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to position: 731648-731676, mismatch: 2, identity: 0.931 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgacgaacagttcggtcg	Protospacer
*************** **.**********

22. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to position: 2051039-2051067, mismatch: 2, identity: 0.931 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
cggcctctcgtcggctaacagctcgatct	Protospacer
****** ***********.**********

23. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to position: 2051567-2051595, mismatch: 2, identity: 0.931 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
cggcctgtcgtcggctaccagctcgattt	Protospacer
************ **** ***********

24. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to position: 746625-746653, mismatch: 2, identity: 0.931 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
cggcctgtcgtcggctaccagctcgattt	Protospacer
************ **** ***********

25. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to position: 746808-746836, mismatch: 2, identity: 0.931 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
cggcctgtcgtcggctaccagctcgattt	Protospacer
************ **** ***********

26. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to position: 747390-747418, mismatch: 2, identity: 0.931 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagttcgaccaacagttcgatcg	Protospacer
*********.***************.***

27. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to position: 747120-747148, mismatch: 2, identity: 0.931 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
tggtctctcgtcggctaacagctcgatct	Protospacer
***.***********.*************

28. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to position: 747444-747472, mismatch: 2, identity: 0.931 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
tggactctcgtcggcgaacagctcgatct	Protospacer
*** *********** *************

29. spacer 3.29|2049974|50|NZ_CP013365|CRT matches to position: 2050835-2050884, mismatch: 2, identity: 0.96 

gggtatcaactcgctgtcgacgggcctcagctcgaccaacagttcggtcg	CRISPR spacer
gggtatcaactcgttgtcgacgggcctgagctcgaccaacagttcggtcg	Protospacer
*************.************* **********************

30. spacer 3.29|2049974|50|NZ_CP013365|CRT matches to position: 2052137-2052186, mismatch: 2, identity: 0.96 

gggtatcaactcgctgtcgacgggcctcagctcgaccaacagttcggtcg	CRISPR spacer
gggcatcaactcgctgtcgaccggcctcagctcgaccaacagttcggtcg	Protospacer
***.***************** ****************************

31. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to position: 746163-746191, mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
cggcctgtcgtcggctaccagctcgatca	Protospacer
****** ********** ***********

32. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to position: 747573-747601, mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
cggcctgtcgtcggctaccagctcgatca	Protospacer
****** ********** ***********

33. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to position: 2052911-2052939, mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
cggcctctcgtccgctaccagctcgatca	Protospacer
************ **** ***********

34. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to position: 2054093-2054121, mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
cggcctgtcgtcggctaccagctcgatca	Protospacer
****** ********** ***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 1 0.966
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 1 0.966
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150122-150150 1 0.966
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150359-150387 1 0.966
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150779-150807 1 0.966
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151016-151044 1 0.966
NZ_CP013365_3 3.21|2049479|29|NZ_CP013365|CRT 2049479-2049507 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150122-150150 1 0.966
NZ_CP013365_3 3.21|2049479|29|NZ_CP013365|CRT 2049479-2049507 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150359-150387 1 0.966
NZ_CP013365_3 3.21|2049479|29|NZ_CP013365|CRT 2049479-2049507 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150779-150807 1 0.966
NZ_CP013365_3 3.21|2049479|29|NZ_CP013365|CRT 2049479-2049507 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151016-151044 1 0.966
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 1 0.966
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 1 0.966
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 1 0.966
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 1 0.966
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149810-149838 1 0.966
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150467-150495 1 0.966
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151124-151152 1 0.966
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150339 2 0.943
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150996 2 0.943
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150122-150150 2 0.931
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150359-150387 2 0.931
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150779-150807 2 0.931
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151016-151044 2 0.931
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 2 0.931
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 2 0.931
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149810-149838 2 0.931
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150467-150495 2 0.931
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151124-151152 2 0.931
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 2 0.931
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 2 0.931
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 2 0.931
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 2 0.931
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149810-149838 2 0.931
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150467-150495 2 0.931
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151124-151152 2 0.931
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 2 0.931
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 2 0.931
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149477-149505 3 0.897
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 3 0.897
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 3 0.897
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149477-149505 3 0.897
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 3 0.897
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 3 0.897
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149810-149838 3 0.897
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150467-150495 3 0.897
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151124-151152 3 0.897
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149477-149505 3 0.897
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 3 0.897
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 3 0.897
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149810-149838 3 0.897
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150467-150495 3 0.897
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151124-151152 3 0.897
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151511-151539 3 0.897
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151757-151785 3 0.897
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104709-104737 3 0.897
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105867-105895 3 0.897
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104709-104737 3 0.897
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105867-105895 3 0.897
NZ_CP013365_3 3.21|2049479|29|NZ_CP013365|CRT 2049479-2049507 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151757-151785 3 0.897
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149810-149838 3 0.897
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150467-150495 3 0.897
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151124-151152 3 0.897
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149756-149784 4 0.862
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150413-150441 4 0.862
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151070-151098 4 0.862
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 13997-14025 4 0.862
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 13868-13896 4 0.862
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 13997-14025 4 0.862
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 13868-13896 4 0.862
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 13997-14025 4 0.862
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149730 4 0.862
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149967 4 0.862
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150624 4 0.862
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151281 4 0.862
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150305-150333 4 0.862
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150962-150990 4 0.862
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149730 4 0.862
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149967 4 0.862
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150624 4 0.862
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151281 4 0.862
NZ_CP013365_3 3.21|2049479|29|NZ_CP013365|CRT 2049479-2049507 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151682-151710 4 0.862
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149810-149838 4 0.862
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150176-150204 4 0.862
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150467-150495 4 0.862
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150833-150861 4 0.862
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151124-151152 4 0.862
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150176-150204 4 0.862
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150833-150861 4 0.862
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149730 4 0.862
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149967 4 0.862
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150624 4 0.862
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151281 4 0.862
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1018595-1018623 5 0.828
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 NZ_CP015735 Arthrobacter sp. U41 plasmid unnamed3, complete sequence 41159-41187 5 0.828
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149730 5 0.828
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149967 5 0.828
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150624 5 0.828
NZ_CP013365_3 3.4|2048435|29|NZ_CP013365|CRT 2048435-2048463 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151281 5 0.828
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149730 5 0.828
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149967 5 0.828
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150624 5 0.828
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151281 5 0.828
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149730 5 0.828
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149967 5 0.828
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150624 5 0.828
NZ_CP013365_3 3.11|2048876|29|NZ_CP013365|CRT 2048876-2048904 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151281 5 0.828
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 152852-152880 5 0.828
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150014-150042 5 0.828
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150671-150699 5 0.828
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151328-151356 5 0.828
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104751-104779 5 0.828
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105909-105937 5 0.828
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104751-104779 5 0.828
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105909-105937 5 0.828
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 170466-170494 5 0.828
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149730 5 0.828
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149967 5 0.828
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150624 5 0.828
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151281 5 0.828
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149730 5 0.828
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149967 5 0.828
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150624 5 0.828
NZ_CP013365_3 3.26|2049791|29|NZ_CP013365|CRT 2049791-2049819 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151281 5 0.828
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149730 5 0.828
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149967 5 0.828
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150624 5 0.828
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151281 5 0.828
NZ_CP013365_3 3.28|2049920|29|NZ_CP013365|CRT 2049920-2049948 29 NZ_CP015735 Arthrobacter sp. U41 plasmid unnamed3, complete sequence 41159-41187 5 0.828
NZ_CP013365_3 3.2|2048306|29|NZ_CP013365|CRT 2048306-2048334 29 MN585994 Mycobacterium phage SheaKeira, complete genome 44614-44642 6 0.793
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149702-149736 6 0.829
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149939-149973 6 0.829
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150596-150630 6 0.829
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151253-151287 6 0.829
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 152852-152880 6 0.793
NZ_CP013365_3 3.9|2048747|29|NZ_CP013365|CRT 2048747-2048775 29 NZ_CP015735 Arthrobacter sp. U41 plasmid unnamed3, complete sequence 41159-41187 6 0.793
NZ_CP013365_3 3.13|2049005|29|NZ_CP013365|CRT 2049005-2049033 29 KP027201 Mycobacterium phage Sbash, complete genome 34368-34396 6 0.793
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104751-104779 6 0.793
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105909-105937 6 0.793
NZ_CP013365_3 3.14|2049059|29|NZ_CP013365|CRT 2049059-2049087 29 NZ_CP015735 Arthrobacter sp. U41 plasmid unnamed3, complete sequence 41159-41187 6 0.793
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151682-151710 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 899728-899756 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 481337-481365 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 894303-894331 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 881773-881801 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1551892-1551920 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1237999-1238027 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1145556-1145584 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 807376-807404 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 5669-5697 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1045561-1045589 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 905937-905965 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 838287-838315 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 806736-806764 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 904508-904536 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 408656-408684 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 525289-525317 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 40881-40909 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 124651-124679 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 978545-978573 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 753437-753465 6 0.793
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 838291-838319 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 899728-899756 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 481337-481365 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 894303-894331 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 881773-881801 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1551892-1551920 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1237999-1238027 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1145556-1145584 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 807376-807404 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 5669-5697 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1045561-1045589 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 905937-905965 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 838287-838315 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 806736-806764 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 904508-904536 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 408656-408684 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 525289-525317 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 40881-40909 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 124651-124679 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 978545-978573 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 753437-753465 6 0.793
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 838291-838319 6 0.793
NZ_CP013365_3 3.21|2049479|29|NZ_CP013365|CRT 2049479-2049507 29 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 768788-768816 6 0.793
NZ_CP013365_3 3.21|2049479|29|NZ_CP013365|CRT 2049479-2049507 29 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 412985-413013 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104667-104695 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP015735 Arthrobacter sp. U41 plasmid unnamed3, complete sequence 41159-41187 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1018595-1018623 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 MF541406 Streptomyces phage Dattran, complete genome 36995-37023 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 KX507344 Streptomyces phage Godpower, complete genome 36874-36902 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 MT711979 Streptomyces phage Endor2, complete genome 38684-38712 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 MT701598 Streptomyces phage Sitrop, complete genome 35853-35881 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NC_021304 Streptomyces phage Sujidade, complete genome 37165-37193 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 MH171097 Streptomyces phage Goby, complete genome 36894-36922 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 KT186229 Streptomyces phage Verse, complete genome 39231-39259 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NC_021298 Streptomyces phage Lika, complete genome 36877-36905 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 KT186228 Streptomyces phage Amela, complete genome 39237-39265 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 MN204498 Streptomyces phage Saftant, complete genome 38460-38488 6 0.793
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 MH171098 Streptomyces phage Toma, complete genome 36894-36922 6 0.793
NZ_CP013365_3 3.24|2049662|29|NZ_CP013365|CRT 2049662-2049690 29 NZ_CP015735 Arthrobacter sp. U41 plasmid unnamed3, complete sequence 41159-41187 6 0.793
NZ_CP013365_3 3.29|2049974|50|NZ_CP013365|CRT 2049974-2050023 50 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151436-151485 6 0.88
NZ_CP013365_3 3.30|2050049|29|NZ_CP013365|CRT 2050049-2050077 29 NZ_CP015735 Arthrobacter sp. U41 plasmid unnamed3, complete sequence 41159-41187 6 0.793
NZ_CP013365_4 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder 2052302-2052332 31 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 9720-9750 6 0.806
NZ_CP013365_1 1.1|745183|49|NZ_CP013365|CRISPRCasFinder 745183-745231 49 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151436-151484 7 0.857
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149477-149511 7 0.8
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 104204-104238 7 0.8
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 27559-27593 7 0.8
NZ_CP013365_3 3.8|2048693|29|NZ_CP013365|CRT 2048693-2048721 29 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151682-151710 7 0.759
NZ_CP013365_3 3.15|2049113|29|NZ_CP013365|CRT 2049113-2049141 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1521619-1521647 7 0.759
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 NZ_CP015735 Arthrobacter sp. U41 plasmid unnamed3, complete sequence 41159-41187 7 0.759
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 NZ_CP015735 Arthrobacter sp. U41 plasmid unnamed3, complete sequence 41159-41187 7 0.759
NZ_CP013365_3 3.6|2048564|35|NZ_CP013365|CRT 2048564-2048598 35 AP018698 Arthrobacter sp. MN05-02 plasmid plasmid1 DNA, complete genome 120999-121033 8 0.771
NZ_CP013365_3 3.16|2049167|29|NZ_CP013365|CRT 2049167-2049195 29 JX194160 Uncultured bacterium plasmid pM02_c6 clone c6, complete sequence 25319-25347 8 0.724
NZ_CP013365_3 3.18|2049296|29|NZ_CP013365|CRT 2049296-2049324 29 JX194160 Uncultured bacterium plasmid pM02_c6 clone c6, complete sequence 25319-25347 8 0.724
NZ_CP013365_3 3.19|2049350|50|NZ_CP013365|CRT 2049350-2049399 50 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 75991-76040 8 0.84
NZ_CP013365_3 3.20|2049425|29|NZ_CP013365|CRT 2049425-2049453 29 MK801724 Gordonia phage PhrostedPhlake, complete genome 46302-46330 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1028199-1028227 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 924911-924939 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 263755-263783 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 175584-175612 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 997144-997172 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 924008-924036 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 924903-924931 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 924933-924961 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 924894-924922 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1028292-1028320 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 187127-187155 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1028288-1028316 8 0.724
NZ_CP013365_3 3.22|2049533|29|NZ_CP013365|CRT 2049533-2049561 29 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1028271-1028299 8 0.724
NZ_CP013365_4 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder 2052302-2052332 31 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 13883-13913 8 0.742
NZ_CP013365_4 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder 2052302-2052332 31 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 516362-516392 9 0.71
NZ_CP013365_4 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder 2052302-2052332 31 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 109895-109925 9 0.71
NZ_CP013365_4 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder 2052302-2052332 31 MH426726 Erwinia phage Pavtok, complete genome 10135-10165 9 0.71

1. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
****************************

2. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
****************************

3. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
*************************** *

4. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
*************************** *

5. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
*************************** *

6. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
*************************** *

7. spacer 3.21|2049479|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

cggcctgagctcgaccaacagttcggtgg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
 ****************************

8. spacer 3.21|2049479|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

cggcctgagctcgaccaacagttcggtgg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
 ****************************

9. spacer 3.21|2049479|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

cggcctgagctcgaccaacagttcggtgg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
 ****************************

10. spacer 3.21|2049479|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

cggcctgagctcgaccaacagttcggtgg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
 ****************************

11. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
***************.*************

12. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
***************.*************

13. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.****************************

14. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.****************************

15. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***************** ***********

16. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***************** ***********

17. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 1, identity: 0.966 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***************** ***********

18. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.943 

tgggctgtcgtcggctaacagctcgatctcgtcgc	CRISPR spacer
tggcctctcgtcggctaacagctcgatctcgtcgc	Protospacer
*** ** ****************************

19. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.943 

tgggctgtcgtcggctaacagctcgatctcgtcgc	CRISPR spacer
tggcctctcgtcggctaacagctcgatctcgtcgc	Protospacer
*** ** ****************************

20. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
******************.******** *

21. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
******************.******** *

22. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
******************.******** *

23. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagttcggtgg	Protospacer
******************.******** *

24. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.**.*************************

25. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.**.*************************

26. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***************** **********

27. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***************** **********

28. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***************** **********

29. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.*****.**********************

30. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.*****.**********************

31. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***************************

32. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***************************

33. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***************** **********.

34. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***************** **********.

35. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***************** **********.

36. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***************************

37. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.931 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***************************

38. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
cgggctgtcgtcggccaatagctcgatca	Protospacer
*** ** *********************

39. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.**************.**.**********

40. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.**************.**.**********

41. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
cgggctgtcgtcggccaatagctcgatca	Protospacer
*** ***********.************

42. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***** ***********.**********

43. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***** ***********.**********

44. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
.**************** **********.

45. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
.**************** **********.

46. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
.**************** **********.

47. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
cgggctgtcgtcggccaatagctcgatca	Protospacer
*** ***********.************

48. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***** ***********.**********

49. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***** ***********.**********

50. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***.************* **********

51. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***.************* **********

52. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
***.************* **********

53. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
cggtctgtcgtcggctaccagctcgatca	Protospacer
****** ********** **********

54. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagttcgaccaacagctcggtgg	Protospacer
*********.***********.***** *

55. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.897 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
gggtctctcgtcgacgaatagctcggtta	Protospacer
*************.***********.*.*

56. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.897 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
gggtctctcgtcgacgaatagctcggtta	Protospacer
*************.***********.*.*

57. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.897 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
gggtctctcgtcgacgaatagctcggtta	Protospacer
*************.***********.*.*

58. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.897 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
gggtctctcgtcgacgaatagctcggtta	Protospacer
*************.***********.*.*

59. spacer 3.21|2049479|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctgagctcgaccaacagttcggtgg	CRISPR spacer
gggcctgagttcgaccaacagctcggtgg	Protospacer
 ********.***********.*******

60. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
******.********** **********

61. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
******.********** **********

62. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.897 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
******.********** **********

63. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
gggcctttcatcggccaatagctcgatca	Protospacer
 *****.**.******************

64. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
gggcctttcatcggccaatagctcgatca	Protospacer
 *****.**.******************

65. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
gggcctttcatcggccaatagctcgatca	Protospacer
 *****.**.******************

66. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
gggcctgtcgtcggccaatagctcggtca	Protospacer
 ***** ******************.**

67. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
cggcctgtcctctgctaatagctcgatta	Protospacer
********* ** **************.

68. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggcctgtcgtcggccaatagctcggtca	Protospacer
 **************.*********.**

69. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
cggcctgtcctctgctaatagctcgatta	Protospacer
********* ** **************.

70. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggcctgtcgtcggccaatagctcggtca	Protospacer
 **************.*********.**

71. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.******** ***************

72. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.******** ***************

73. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.******** ***************

74. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.******** ***************

75. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***** ***** **************.*

76. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
tggcctctcgtcggctaacagctcgatct	Protospacer
.***** ***** **************.*

77. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 ***** ********************.

78. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 ***** ********************.

79. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 ***** ********************.

80. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 ***** ********************.

81. spacer 3.21|2049479|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctgagctcgaccaacagttcggtgg	CRISPR spacer
cagcctcagctcgaccaacagttcgctga	Protospacer
*.**** ****************** **.

82. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
.**************.* **********

83. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
gggcctttcatcggccaacagctcgatca	Protospacer
 *****.**.******************

84. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
.**************.* **********

85. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
gggcctttcatcggccaacagctcgatca	Protospacer
 *****.**.******************

86. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
cggcctctcgtcggctaccagctcgatca	Protospacer
.**************.* **********

87. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
gggcctttcatcggccaacagctcgatca	Protospacer
 ********.*****.************

88. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
gggcctttcatcggccaacagctcgatca	Protospacer
 ********.*****.************

89. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.*

90. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.*

91. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.*

92. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.862 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.*

93. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
cggccgctcgtcggccaaaagctcgtcca	Protospacer
***** ************ ****** .*

94. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to NZ_CP015735 (Arthrobacter sp. U41 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggccaatagctcgatct	CRISPR spacer
ctgggtctcgtcggccaagagctcgatcg	Protospacer
* *  ************* *********

95. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.**************.********.

96. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.**************.********.

97. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.**************.********.

98. spacer 3.4|2048435|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.**************.********.

99. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************..

100. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************..

101. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************..

102. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************..

103. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.**************.********.

104. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.**************.********.

105. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.**************.********.

106. spacer 3.11|2048876|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctgtcgtcggctaatagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.**************.********.

107. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagcttgctga	Protospacer
*********************.*.* * .

108. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccgacagcactgtgg	Protospacer
****************.****. * ** *

109. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccgacagcactgtgg	Protospacer
****************.****. * ** *

110. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gggcctgagctcgaccgacagcactgtgg	Protospacer
****************.****. * ** *

111. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.828 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
tggtctctcgtcgacgaacagctcggtta	Protospacer
 ************.****.******.*.*

112. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.828 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
tggtctctcgtcgacgaacagctcggtta	Protospacer
 ************.****.******.*.*

113. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.828 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
tggtctctcgtcgacgaacagctcggtta	Protospacer
 ************.****.******.*.*

114. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.828 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
tggtctctcgtcgacgaacagctcggtta	Protospacer
 ************.****.******.*.*

115. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 5, identity: 0.828 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
tcggctctcgtccgccaactgctcgatcg	Protospacer
* * ******** ****** ********

116. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.

117. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.

118. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.

119. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.

120. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.

121. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.

122. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.

123. spacer 3.26|2049791|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctttcgtcggctaacagctcgatct	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************.

124. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************..

125. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************..

126. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************..

127. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
gggtctgtcgtcggctaacagctcgatta	Protospacer
 **.** ********************..

128. spacer 3.28|2049920|29|NZ_CP013365|CRT matches to NZ_CP015735 (Arthrobacter sp. U41 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828 

cggcctctcgtcggctaacagctcgatcg	CRISPR spacer
ctgggtctcgtcggccaagagctcgatcg	Protospacer
* *  **********.** **********

129. spacer 3.2|2048306|29|NZ_CP013365|CRT matches to MN585994 (Mycobacterium phage SheaKeira, complete genome) position: , mismatch: 6, identity: 0.793 

cggcctctcgtcggccaatagctcgatct-	CRISPR spacer
acgcctctcgtcggccagtagct-gctgtg	Protospacer
  ***************.***** * * *

130. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 6, identity: 0.829 

tgggctgtcgtcggctaacagctcgatctcgtcgc	CRISPR spacer
gggtctgtcgtcggctaacagctcgattagctcgc	Protospacer
 ** ***********************.   ****

131. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 6, identity: 0.829 

tgggctgtcgtcggctaacagctcgatctcgtcgc	CRISPR spacer
gggtctgtcgtcggctaacagctcgattagctcgc	Protospacer
 ** ***********************.   ****

132. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 6, identity: 0.829 

tgggctgtcgtcggctaacagctcgatctcgtcgc	CRISPR spacer
gggtctgtcgtcggctaacagctcgattagctcgc	Protospacer
 ** ***********************.   ****

133. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 6, identity: 0.829 

tgggctgtcgtcggctaacagctcgatctcgtcgc	CRISPR spacer
gggtctgtcgtcggctaacagctcgattagctcgc	Protospacer
 ** ***********************.   ****

134. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
gggcctgagctcgaccaacagcttgctga	Protospacer
******************.**.*.* * .

135. spacer 3.9|2048747|29|NZ_CP013365|CRT matches to NZ_CP015735 (Arthrobacter sp. U41 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggctaacagctcgatcg	CRISPR spacer
ctgggtctcgtcggccaagagctcgatcg	Protospacer
. *  **********.** **********

136. spacer 3.13|2049005|29|NZ_CP013365|CRT matches to KP027201 (Mycobacterium phage Sbash, complete genome) position: , mismatch: 6, identity: 0.793 

cggcctgtcgtccgctaacagctcgattt	CRISPR spacer
cggcctgtcgtgcgctaccagctcaccgt	Protospacer
*********** ***** ******. . *

137. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.793 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
tggtctctcgtcgacgaacagctcggtta	Protospacer
.************.* *********.*.

138. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.793 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
tggtctctcgtcgacgaacagctcggtta	Protospacer
.************.* *********.*.

139. spacer 3.14|2049059|29|NZ_CP013365|CRT matches to NZ_CP015735 (Arthrobacter sp. U41 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793 

cggtctctcgtcggctaacagctcgatct	CRISPR spacer
ctgggtctcgtcggccaagagctcgatcg	Protospacer
* *  **********.** *********

140. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 6, identity: 0.793 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
cagcctcagctcgaccaacagttcgctga	Protospacer
 .**** ****************** * .

141. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

142. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

143. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

144. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

145. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

146. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

147. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

148. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

149. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

150. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

151. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

152. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

153. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

154. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

155. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

156. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

157. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

158. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

159. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

160. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

161. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

162. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

163. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

164. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

165. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

166. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

167. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

168. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

169. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

170. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

171. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

172. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

173. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

174. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

175. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

176. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

177. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

178. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

179. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

180. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

181. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

182. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.793 

gggtctc-----tcgtcggcgaatagctcgatca	CRISPR spacer
-----tccgagatcgtcggcgaatggctcgatca	Protospacer
     **     ************.*********

183. spacer 3.21|2049479|29|NZ_CP013365|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.793 

cggcctgagctcgaccaacagttcggtgg	CRISPR spacer
cgccgcccgctcgaccagcagttcggtgg	Protospacer
** * .  *********.***********

184. spacer 3.21|2049479|29|NZ_CP013365|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.793 

cggcctgagctcgaccaacagttcggtgg	CRISPR spacer
cgccgcccgctcgaccagcagttcggtgg	Protospacer
** * .  *********.***********

185. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
cggtttgtcgtcggccaccagctcgatcg	Protospacer
.**..* ********** **********

186. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP015735 (Arthrobacter sp. U41 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctgggtctcgtcggccaagagctcgatcg	Protospacer
. *  ************* *********

187. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
cggccgctcgtcggccaaaagctcgtcca	Protospacer
.**** ************ ****** .*

188. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to MF541406 (Streptomyces phage Dattran, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

189. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to KX507344 (Streptomyces phage Godpower, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

190. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to MT711979 (Streptomyces phage Endor2, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

191. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

192. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NC_021304 (Streptomyces phage Sujidade, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

193. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to MH171097 (Streptomyces phage Goby, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

194. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to KT186229 (Streptomyces phage Verse, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

195. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NC_021298 (Streptomyces phage Lika, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

196. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to KT186228 (Streptomyces phage Amela, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

197. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to MN204498 (Streptomyces phage Saftant, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

198. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to MH171098 (Streptomyces phage Toma, complete genome) position: , mismatch: 6, identity: 0.793 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ctccatctcgtcggccaccatctcgatct	Protospacer
.  * ************ ** ********

199. spacer 3.24|2049662|29|NZ_CP013365|CRT matches to NZ_CP015735 (Arthrobacter sp. U41 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793 

cggcctctcgtcggctaacagctcgatct	CRISPR spacer
ctgggtctcgtcggccaagagctcgatcg	Protospacer
* *  **********.** *********

200. spacer 3.29|2049974|50|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 6, identity: 0.88 

gggtatcaactcgctgtcgacgggcctcagctcgaccaacagttcggtcg	CRISPR spacer
gggtatcaactcgctgtcgacgggcctcagctcaaccgacagcaccgtgg	Protospacer
*********************************.***.****. * ** *

201. spacer 3.30|2050049|29|NZ_CP013365|CRT matches to NZ_CP015735 (Arthrobacter sp. U41 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793 

cggcctctcgtcggctaacagctcgatca	CRISPR spacer
ctgggtctcgtcggccaagagctcgatcg	Protospacer
* *  **********.** *********.

202. spacer 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806 

aaccagct---cgatttcgtcgctgtcgacttcg	CRISPR spacer
---caggtagacgatttcgtcgctgtcgagtacg	Protospacer
   *** *   ****************** * **

203. spacer 1.1|745183|49|NZ_CP013365|CRISPRCasFinder matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 7, identity: 0.857 

gaggttgctgttggtcgagctgaggcccgtcgacagcgagttgatcgcc	CRISPR spacer
cacggtgctgtcggttgagctgaggcccgtcgacagcgagttgataccc	Protospacer
 * * ******.***.*****************************  **

204. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 7, identity: 0.8 

tgggctgtcgtcggctaacagctcgatctcgtcgc	CRISPR spacer
cgggctgtcgtcggccaatagctcgatcagctcgt	Protospacer
.**************.**.*********   ***.

205. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.8 

tgggctgtc---gtcggctaacagctcgatctcgtcgc	CRISPR spacer
---gttgcccatgtcggcgaacagctcgatctcgtagc	Protospacer
   *.**.*   ****** **************** **

206. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.8 

tgggctgtc---gtcggctaacagctcgatctcgtcgc	CRISPR spacer
---gttgcccatgtcggcgaacagctcgatctcgtagc	Protospacer
   *.**.*   ****** **************** **

207. spacer 3.8|2048693|29|NZ_CP013365|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 7, identity: 0.759 

gggcctgagctcgaccaatagttcggtcg	CRISPR spacer
cagcctcagctcgaccaacagttcgctga	Protospacer
 .**** ***********.****** * .

208. spacer 3.15|2049113|29|NZ_CP013365|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.759 

gggcctgagctcgaccaacagttcggtcg	CRISPR spacer
gccggtgcgctcgacccacagttcggtca	Protospacer
*    ** ******** ***********.

209. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to NZ_CP015735 (Arthrobacter sp. U41 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
ctgggtctcgtcggccaagagctcgatcg	Protospacer
  *  ********** ** *********.

210. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to NZ_CP015735 (Arthrobacter sp. U41 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
ctgggtctcgtcggccaagagctcgatcg	Protospacer
  *  ********** ** *********.

211. spacer 3.6|2048564|35|NZ_CP013365|CRT matches to AP018698 (Arthrobacter sp. MN05-02 plasmid plasmid1 DNA, complete genome) position: , mismatch: 8, identity: 0.771 

tgggctgtcgtcggctaacagctcgatctcgtcgc	CRISPR spacer
ttcgccgcgctcggctaccagctcgctctcgtcgc	Protospacer
*  **.*.  ******* ******* *********

212. spacer 3.16|2049167|29|NZ_CP013365|CRT matches to JX194160 (Uncultured bacterium plasmid pM02_c6 clone c6, complete sequence) position: , mismatch: 8, identity: 0.724 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
gtcctcctcgtcggcgaatagctctatgc	Protospacer
*  ...****************** **

213. spacer 3.18|2049296|29|NZ_CP013365|CRT matches to JX194160 (Uncultured bacterium plasmid pM02_c6 clone c6, complete sequence) position: , mismatch: 8, identity: 0.724 

gggtctctcgtcggcgaatagctcgatca	CRISPR spacer
gtcctcctcgtcggcgaatagctctatgc	Protospacer
*  ...****************** **

214. spacer 3.19|2049350|50|NZ_CP013365|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.84 

ggggatcaactcgctgtcgacgggcctgagctcgaccaacagctcggtgg	CRISPR spacer
cgcgatcaactcgctgtcgacgggcctgagcgcgacgaacagcaacgtga	Protospacer
 * **************************** **** ******   ***.

215. spacer 3.20|2049425|29|NZ_CP013365|CRT matches to MK801724 (Gordonia phage PhrostedPhlake, complete genome) position: , mismatch: 8, identity: 0.724 

ggggctctcgtcagcgaatagctcgattt	CRISPR spacer
atggctctcgtccgcgaacagctcgccgc	Protospacer
. ********** *****.****** . .

216. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

217. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

218. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
cagccgcccgtcggccaacagctcggcgc	Protospacer
..*** *.*****************.. .

219. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ccagttctcgtcggccatcagcgcgatca	Protospacer
. . .************ **** *****

220. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

221. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

222. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

223. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

224. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

225. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

226. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
cagccgcccgtcggccaacagctcggcgc	Protospacer
..*** *.*****************.. .

227. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

228. spacer 3.22|2049533|29|NZ_CP013365|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724 

tggcctctcgtcggccaacagctcgatct	CRISPR spacer
ggcagggtcgtcggcccacagctcgatcc	Protospacer
 *     ********* ***********.

229. spacer 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 8, identity: 0.742 

aaccagctcgatttcgtcgctgtcgacttcg	CRISPR spacer
taatagctcgattacgtctctgtcgaccgca	Protospacer
 * .********* **** ********. *.

230. spacer 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

aaccagctcgatttcgtcgctgtcgacttcg	CRISPR spacer
caccagctcgatctcgtcgccgtcctgtcgc	Protospacer
 ***********.*******.***   *.

231. spacer 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.71 

aaccagctcgatttcgtcgctgtcgacttcg	CRISPR spacer
caccagctcgatctcgtcgccgtcctgtcgc	Protospacer
 ***********.*******.***   *.

232. spacer 4.1|2052302|31|NZ_CP013365|CRISPRCasFinder matches to MH426726 (Erwinia phage Pavtok, complete genome) position: , mismatch: 9, identity: 0.71 

aaccagctcgatttcgtcgctgtcgacttcg	CRISPR spacer
gtccagctcgatttcgtcgccgccgtggatg	Protospacer
. ******************.*.**    .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP013366
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013366_1 566143-566237 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 726181 : 735222 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 1048568 : 1056886 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_3 1644641 : 1684385 52 Burkholderia_phage(62.5%) capsid NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage