Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP013406 Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 2, complete sequence 1 crisprs cas3,c2c9_V-U4,csa3,Cas14u_CAS-V,RT,DinG,WYL 18 24 1 0
NZ_CP013405 Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 3, complete sequence 0 crisprs WYL,RT 0 0 0 0
NZ_CP013404 Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 1, complete sequence 0 crisprs RT,WYL,csa3,cas3,DEDDh,DinG,c2c9_V-U4 0 0 6 0

Results visualization

1. NZ_CP013406
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP013406_1 2902796-2904450 Orphan NA
32 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013406.1 2899837-2899855 0 1.0
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP013406.1 2902765-2902795 0 1.0
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP013406.1 2902765-2902795 0 1.0
NZ_CP013406_1 1.31|2904355|19|NZ_CP013406|CRT 2904355-2904373 19 NZ_CP013406.1 2901019-2901037 0 1.0
NZ_CP013406_1 1.31|2904355|19|NZ_CP013406|CRT 2904355-2904373 19 NZ_CP013406.1 2902723-2902741 0 1.0
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_CP013405.1 386564-386594 1 0.968
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NZ_CP013406.1 2901469-2901499 1 0.968
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NZ_CP013406.1 2901919-2901949 1 0.968
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NZ_CP013406.1 2902369-2902399 1 0.968
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013406.1 2899453-2899471 1 0.947
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013405.1 386972-386990 1 0.947
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NZ_CP013406.1 2898727-2898757 1 0.968
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NZ_CP013406.1 2899687-2899717 1 0.968
NZ_CP013406_1 1.31|2904355|19|NZ_CP013406|CRT 2904355-2904373 19 NZ_CP013406.1 2901523-2901541 1 0.947
NZ_CP013406_1 1.31|2904355|19|NZ_CP013406|CRT 2904355-2904373 19 NZ_CP013406.1 2901973-2901991 1 0.947
NZ_CP013406_1 1.31|2904355|19|NZ_CP013406|CRT 2904355-2904373 19 NZ_CP013406.1 2902423-2902441 1 0.947
NZ_CP013406_1 1.3|2902927|19|NZ_CP013406|CRT 2902927-2902945 19 NZ_CP013406.1 2358756-2358774 2 0.895
NZ_CP013406_1 1.3|2902927|19|NZ_CP013406|CRT 2902927-2902945 19 NZ_CP013406.1 2360868-2360886 2 0.895
NZ_CP013406_1 1.3|2902927|19|NZ_CP013406|CRT 2902927-2902945 19 NZ_CP013406.1 2746926-2746944 2 0.895
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP013406.1 2902765-2902795 2 0.935
NZ_CP013406_1 1.7|2903131|19|NZ_CP013406|CRT 2903131-2903149 19 NZ_CP013406.1 2358756-2358774 2 0.895
NZ_CP013406_1 1.7|2903131|19|NZ_CP013406|CRT 2903131-2903149 19 NZ_CP013406.1 2360868-2360886 2 0.895
NZ_CP013406_1 1.7|2903131|19|NZ_CP013406|CRT 2903131-2903149 19 NZ_CP013406.1 2746926-2746944 2 0.895
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NZ_CP013406.1 2900587-2900617 2 0.935
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NZ_CP013406.1 2900641-2900671 2 0.935
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013406.1 2902765-2902795 2 0.935
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013406.1 2898727-2898757 2 0.935
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013406.1 2899687-2899717 2 0.935
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013406.1 2905315-2905333 2 0.895
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013406.1 2905465-2905483 2 0.895
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013406.1 2354910-2354928 2 0.895
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013405.1 386081-386099 2 0.895
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013405.1 386156-386174 2 0.895
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013405.1 386231-386249 2 0.895
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013405.1 386306-386324 2 0.895
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013405.1 386897-386915 2 0.895
NZ_CP013406_1 1.14|2903497|19|NZ_CP013406|CRT 2903497-2903515 19 NZ_CP013404.1 8169-8187 2 0.895
NZ_CP013406_1 1.16|2903593|19|NZ_CP013406|CRT 2903593-2903611 19 NZ_CP013406.1 2358756-2358774 2 0.895
NZ_CP013406_1 1.16|2903593|19|NZ_CP013406|CRT 2903593-2903611 19 NZ_CP013406.1 2360868-2360886 2 0.895
NZ_CP013406_1 1.16|2903593|19|NZ_CP013406|CRT 2903593-2903611 19 NZ_CP013406.1 2746926-2746944 2 0.895
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NZ_CP013406.1 2900533-2900563 2 0.935
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NZ_CP013406.1 2898823-2898853 2 0.935
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NZ_CP013406.1 2899111-2899141 2 0.935
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NZ_CP013406.1 2899303-2899333 2 0.935
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NZ_CP013406.1 2899495-2899525 2 0.935
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NZ_CP013406.1 2899591-2899621 2 0.935
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 2898781-2898799 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 2899069-2899087 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 2900869-2900887 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 2901073-2901091 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 2901781-2901799 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 2902231-2902249 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 2902681-2902699 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 731352-731370 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 837024-837042 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013406.1 842358-842376 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013405.1 386564-386582 2 0.895
NZ_CP013406_1 1.23|2903959|19|NZ_CP013406|CRT 2903959-2903977 19 NZ_CP013405.1 1081433-1081451 2 0.895
NZ_CP013406_1 1.25|2904055|19|NZ_CP013406|CRT 2904055-2904073 19 NZ_CP013406.1 2358756-2358774 2 0.895
NZ_CP013406_1 1.25|2904055|19|NZ_CP013406|CRT 2904055-2904073 19 NZ_CP013406.1 2360868-2360886 2 0.895
NZ_CP013406_1 1.25|2904055|19|NZ_CP013406|CRT 2904055-2904073 19 NZ_CP013406.1 2746926-2746944 2 0.895
NZ_CP013406_1 1.28|2904205|19|NZ_CP013406|CRT 2904205-2904223 19 NZ_CP013406.1 2358756-2358774 2 0.895
NZ_CP013406_1 1.28|2904205|19|NZ_CP013406|CRT 2904205-2904223 19 NZ_CP013406.1 2360868-2360886 2 0.895
NZ_CP013406_1 1.28|2904205|19|NZ_CP013406|CRT 2904205-2904223 19 NZ_CP013406.1 2746926-2746944 2 0.895
NZ_CP013406_1 1.29|2904247|31|NZ_CP013406|CRT 2904247-2904277 31 NZ_CP013406.1 2901415-2901445 2 0.935
NZ_CP013406_1 1.29|2904247|31|NZ_CP013406|CRT 2904247-2904277 31 NZ_CP013406.1 2901865-2901895 2 0.935
NZ_CP013406_1 1.29|2904247|31|NZ_CP013406|CRT 2904247-2904277 31 NZ_CP013406.1 2902315-2902345 2 0.935
NZ_CP013406_1 1.31|2904355|19|NZ_CP013406|CRT 2904355-2904373 19 NZ_CP013406.1 2360079-2360097 2 0.895

1. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 2899837-2899855, mismatch: 0, identity: 1.0

cggcctgagctcgaccaac	CRISPR spacer
cggcctgagctcgaccaac	Protospacer
*******************

2. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to position: 2902765-2902795, mismatch: 0, identity: 1.0

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ttccacctcgaccggcctctcgtcggccaac	Protospacer
*******************************

3. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to position: 2902765-2902795, mismatch: 0, identity: 1.0

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ttccacctcgaccggcctctcgtcggccaac	Protospacer
*******************************

4. spacer 1.31|2904355|19|NZ_CP013406|CRT matches to position: 2901019-2901037, mismatch: 0, identity: 1.0

gggcctcagctcgacgaat	CRISPR spacer
gggcctcagctcgacgaat	Protospacer
*******************

5. spacer 1.31|2904355|19|NZ_CP013406|CRT matches to position: 2902723-2902741, mismatch: 0, identity: 1.0

gggcctcagctcgacgaat	CRISPR spacer
gggcctcagctcgacgaat	Protospacer
*******************

6. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to position: 386564-386594, mismatch: 1, identity: 0.968

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggcctgtcgtcggccaac	Protospacer
****************** ************

7. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to position: 2901469-2901499, mismatch: 1, identity: 0.968

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacttcgaccggtctgtcgtcggctaac	Protospacer
******.************************

8. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to position: 2901919-2901949, mismatch: 1, identity: 0.968

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacttcgaccggtctgtcgtcggctaac	Protospacer
******.************************

9. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to position: 2902369-2902399, mismatch: 1, identity: 0.968

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacttcgaccggtctgtcgtcggctaac	Protospacer
******.************************

10. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 2899453-2899471, mismatch: 1, identity: 0.947

cggcctgagctcgaccaac	CRISPR spacer
cggtctgagctcgaccaac	Protospacer
***.***************

11. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 386972-386990, mismatch: 1, identity: 0.947

cggcctgagctcgaccaac	CRISPR spacer
cgggctgagctcgaccaac	Protospacer
*** ***************

12. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to position: 2898727-2898757, mismatch: 1, identity: 0.968

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ttccacgtcgacgggtctttcgtcggctacc	Protospacer
************ ******************

13. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to position: 2899687-2899717, mismatch: 1, identity: 0.968

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ttccacgtcgacgggtctttcgtcggctacc	Protospacer
************ ******************

14. spacer 1.31|2904355|19|NZ_CP013406|CRT matches to position: 2901523-2901541, mismatch: 1, identity: 0.947

gggcctcagctcgacgaat	CRISPR spacer
gggtctcagctcgacgaat	Protospacer
***.***************

15. spacer 1.31|2904355|19|NZ_CP013406|CRT matches to position: 2901973-2901991, mismatch: 1, identity: 0.947

gggcctcagctcgacgaat	CRISPR spacer
gggtctcagctcgacgaat	Protospacer
***.***************

16. spacer 1.31|2904355|19|NZ_CP013406|CRT matches to position: 2902423-2902441, mismatch: 1, identity: 0.947

gggcctcagctcgacgaat	CRISPR spacer
gggtctcagctcgacgaat	Protospacer
***.***************

17. spacer 1.3|2902927|19|NZ_CP013406|CRT matches to position: 2358756-2358774, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

18. spacer 1.3|2902927|19|NZ_CP013406|CRT matches to position: 2360868-2360886, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

19. spacer 1.3|2902927|19|NZ_CP013406|CRT matches to position: 2746926-2746944, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggccgctgctcgacgaat	Protospacer
***** * ***********

20. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to position: 2902765-2902795, mismatch: 2, identity: 0.935

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ttccacctcgaccggcctctcgtcggccaac	Protospacer
****************** ** *********

21. spacer 1.7|2903131|19|NZ_CP013406|CRT matches to position: 2358756-2358774, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

22. spacer 1.7|2903131|19|NZ_CP013406|CRT matches to position: 2360868-2360886, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

23. spacer 1.7|2903131|19|NZ_CP013406|CRT matches to position: 2746926-2746944, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggccgctgctcgacgaat	Protospacer
***** * ***********

24. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to position: 2900587-2900617, mismatch: 2, identity: 0.935

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacgtcgaccggtctgtcctcggctaac	Protospacer
****** ************** *********

25. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to position: 2900641-2900671, mismatch: 2, identity: 0.935

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacgtcgaccggtctgtcctcggctaac	Protospacer
****** ************** *********

26. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to position: 2902765-2902795, mismatch: 2, identity: 0.935

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ttccacctcgaccggcctctcgtcggccaac	Protospacer
****** ***** ******************

27. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to position: 2898727-2898757, mismatch: 2, identity: 0.935

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ttccacgtcgacgggtctttcgtcggctacc	Protospacer
************ ***********.******

28. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to position: 2899687-2899717, mismatch: 2, identity: 0.935

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ttccacgtcgacgggtctttcgtcggctacc	Protospacer
************ ***********.******

29. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 2905315-2905333, mismatch: 2, identity: 0.895

cggcctgagctcgaccaac	CRISPR spacer
cggcctgagcgcgacgaac	Protospacer
********** **** ***

30. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 2905465-2905483, mismatch: 2, identity: 0.895

cggcctgagctcgaccaac	CRISPR spacer
cggcctgagcacgacgaac	Protospacer
********** **** ***

31. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 2354910-2354928, mismatch: 2, identity: 0.895

cggcctgagctcgaccaac	CRISPR spacer
cggcctgagcacgacaaac	Protospacer
********** **** ***

32. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 386081-386099, mismatch: 2, identity: 0.895

cggcctgagctcgaccaac	CRISPR spacer
cggcctgagcacgacgaac	Protospacer
********** **** ***

33. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 386156-386174, mismatch: 2, identity: 0.895

cggcctgagctcgaccaac	CRISPR spacer
cggcctgagttcgacgaac	Protospacer
*********.***** ***

34. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 386231-386249, mismatch: 2, identity: 0.895

cggcctgagctcgaccaac	CRISPR spacer
cggcctgagttcgacgaac	Protospacer
*********.***** ***

35. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 386306-386324, mismatch: 2, identity: 0.895

cggcctgagctcgaccaac	CRISPR spacer
cggcctgagttcgacgaac	Protospacer
*********.***** ***

36. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 386897-386915, mismatch: 2, identity: 0.895

cggcctgagctcgaccaac	CRISPR spacer
cgggctgagttcgaccaac	Protospacer
*** *****.*********

37. spacer 1.14|2903497|19|NZ_CP013406|CRT matches to position: 8169-8187, mismatch: 2, identity: 0.895

cggcctgagctcgaccaac	CRISPR spacer
cggcctgagcgcgcccaac	Protospacer
********** ** *****

38. spacer 1.16|2903593|19|NZ_CP013406|CRT matches to position: 2358756-2358774, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

39. spacer 1.16|2903593|19|NZ_CP013406|CRT matches to position: 2360868-2360886, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

40. spacer 1.16|2903593|19|NZ_CP013406|CRT matches to position: 2746926-2746944, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggccgctgctcgacgaat	Protospacer
***** * ***********

41. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to position: 2900533-2900563, mismatch: 2, identity: 0.935

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ttccacgtcgacgggtctgtcgtcggctaac	Protospacer
****************** ********.***

42. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to position: 2898823-2898853, mismatch: 2, identity: 0.935

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ttccacgtcgacgggtctttcgtcggccacc	Protospacer
************ **************.***

43. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to position: 2899111-2899141, mismatch: 2, identity: 0.935

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ttccacgtcgacgggtctttcgtcggccacc	Protospacer
************ **************.***

44. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to position: 2899303-2899333, mismatch: 2, identity: 0.935

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ttccacgtcgacgggtctgtcgtcggctacc	Protospacer
************ ***** ************

45. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to position: 2899495-2899525, mismatch: 2, identity: 0.935

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ttccacgtcgaccggtctgtcgtcggccacc	Protospacer
****************** ********.***

46. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to position: 2899591-2899621, mismatch: 2, identity: 0.935

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ttcgacgtcgacgggtctttcgtcggctacc	Protospacer
*** ******** ******************

47. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 2898781-2898799, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggtctctcgtcgacgaac	Protospacer
***.** ************

48. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 2899069-2899087, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggtctctcgtcgacgaac	Protospacer
***.** ************

49. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 2900869-2900887, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcctgtcgtcggctaac	Protospacer
*************.* ***

50. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 2901073-2901091, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcctgtcgtcggcaaac	Protospacer
*************.*.***

51. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 2901781-2901799, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcctgtcgtcggcaaac	Protospacer
*************.*.***

52. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 2902231-2902249, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcctgtcgtcggcaaac	Protospacer
*************.*.***

53. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 2902681-2902699, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcctgtcgtcggcaaac	Protospacer
*************.*.***

54. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 731352-731370, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcttgccgtcgacgaac	Protospacer
****.**.***********

55. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 837024-837042, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcttgtcgtcgccgaac	Protospacer
****.******** *****

56. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 842358-842376, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcgtgtcgccgacgaac	Protospacer
**** *****.********

57. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 386564-386582, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcctgtcgtcggccaac	Protospacer
*************.* ***

58. spacer 1.23|2903959|19|NZ_CP013406|CRT matches to position: 1081433-1081451, mismatch: 2, identity: 0.895

cggcctgtcgtcgacgaac	CRISPR spacer
cggcctgtcggcgaagaac	Protospacer
********** *** ****

59. spacer 1.25|2904055|19|NZ_CP013406|CRT matches to position: 2358756-2358774, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

60. spacer 1.25|2904055|19|NZ_CP013406|CRT matches to position: 2360868-2360886, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

61. spacer 1.25|2904055|19|NZ_CP013406|CRT matches to position: 2746926-2746944, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggccgctgctcgacgaat	Protospacer
***** * ***********

62. spacer 1.28|2904205|19|NZ_CP013406|CRT matches to position: 2358756-2358774, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

63. spacer 1.28|2904205|19|NZ_CP013406|CRT matches to position: 2360868-2360886, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggcctgagcacgacgaat	Protospacer
****** *** ********

64. spacer 1.28|2904205|19|NZ_CP013406|CRT matches to position: 2746926-2746944, mismatch: 2, identity: 0.895

cggcctcagctcgacgaat	CRISPR spacer
cggccgctgctcgacgaat	Protospacer
***** * ***********

65. spacer 1.29|2904247|31|NZ_CP013406|CRT matches to position: 2901415-2901445, mismatch: 2, identity: 0.935

ttcgacctcgacgggcctttcgtcggcgaat	CRISPR spacer
ttcgacttcgacgggtctttcgtcggcgaat	Protospacer
******.********.***************

66. spacer 1.29|2904247|31|NZ_CP013406|CRT matches to position: 2901865-2901895, mismatch: 2, identity: 0.935

ttcgacctcgacgggcctttcgtcggcgaat	CRISPR spacer
ttcgacttcgacgggtctttcgtcggcgaat	Protospacer
******.********.***************

67. spacer 1.29|2904247|31|NZ_CP013406|CRT matches to position: 2902315-2902345, mismatch: 2, identity: 0.935

ttcgacctcgacgggcctttcgtcggcgaat	CRISPR spacer
ttcgacttcgacgggtctttcgtcggcgaat	Protospacer
******.********.***************

68. spacer 1.31|2904355|19|NZ_CP013406|CRT matches to position: 2360079-2360097, mismatch: 2, identity: 0.895

gggcctcagctcgacgaat	CRISPR spacer
gggcctgagcacgacgaat	Protospacer
****** *** ********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150293-150323 2 0.935
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150950-150980 2 0.935
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151499-151529 2 0.935
NZ_CP013406_1 1.2|2902873|31|NZ_CP013406|CRT 2902873-2902903 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 3 0.903
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 3 0.903
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104793-104823 3 0.903
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105951-105981 3 0.903
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151499-151529 3 0.903
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149744-149774 3 0.903
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150293-150323 3 0.903
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150401-150431 3 0.903
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150950-150980 3 0.903
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151058-151088 3 0.903
NZ_CP013406_1 1.15|2903539|31|NZ_CP013406|CRT 2903539-2903569 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 3 0.903
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104793-104823 3 0.903
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105951-105981 3 0.903
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151928-151958 3 0.903
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104793-104823 3 0.903
NZ_CP013406_1 1.22|2903905|31|NZ_CP013406|CRT 2903905-2903935 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105951-105981 3 0.903
NZ_CP013406_1 1.24|2904001|31|NZ_CP013406|CRT 2904001-2904031 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 3 0.903
NZ_CP013406_1 1.26|2904097|31|NZ_CP013406|CRT 2904097-2904127 31 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 13985-14015 3 0.903
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1920906-1920936 4 0.871
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 451719-451749 4 0.871
NZ_CP013406_1 1.2|2902873|31|NZ_CP013406|CRT 2902873-2902903 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150293-150323 4 0.871
NZ_CP013406_1 1.2|2902873|31|NZ_CP013406|CRT 2902873-2902903 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150950-150980 4 0.871
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151799-151829 4 0.871
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149561-149591 4 0.871
NZ_CP013406_1 1.6|2903077|31|NZ_CP013406|CRT 2903077-2903107 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150293-150323 4 0.871
NZ_CP013406_1 1.6|2903077|31|NZ_CP013406|CRT 2903077-2903107 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150950-150980 4 0.871
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149798-149828 4 0.871
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150455-150485 4 0.871
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151112-151142 4 0.871
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149465-149495 4 0.871
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104793-104823 4 0.871
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105951-105981 4 0.871
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107205-107235 4 0.871
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149561-149591 4 0.871
NZ_CP013406_1 1.15|2903539|31|NZ_CP013406|CRT 2903539-2903569 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150293-150323 4 0.871
NZ_CP013406_1 1.15|2903539|31|NZ_CP013406|CRT 2903539-2903569 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150950-150980 4 0.871
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151799-151829 4 0.871
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 76982-77012 4 0.871
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104655-104685 4 0.871
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105717-105747 4 0.871
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151799-151829 4 0.871
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149561-149591 4 0.871
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151499-151529 4 0.871
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107589-107619 4 0.871
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104793-104823 4 0.871
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105813-105843 4 0.871
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105951-105981 4 0.871
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107205-107235 4 0.871
NZ_CP013406_1 1.24|2904001|31|NZ_CP013406|CRT 2904001-2904031 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150293-150323 4 0.871
NZ_CP013406_1 1.24|2904001|31|NZ_CP013406|CRT 2904001-2904031 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150950-150980 4 0.871
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149465-149495 4 0.871
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149798-149828 4 0.871
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150455-150485 4 0.871
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151112-151142 4 0.871
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151499-151529 5 0.839
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1227177-1227207 5 0.839
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104793-104823 5 0.839
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105951-105981 5 0.839
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107205-107235 5 0.839
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107205-107235 5 0.839
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107013-107043 5 0.839
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107493-107523 5 0.839
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107781-107811 5 0.839
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 5 0.839
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149798-149828 5 0.839
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150455-150485 5 0.839
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151112-151142 5 0.839
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107589-107619 5 0.839
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107205-107235 5 0.839
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 5 0.839
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149798-149828 5 0.839
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150455-150485 5 0.839
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151112-151142 5 0.839
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149561-149591 5 0.839
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107589-107619 5 0.839
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107013-107043 5 0.839
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107493-107523 5 0.839
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107781-107811 5 0.839
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 76982-77012 5 0.839
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107205-107235 5 0.839
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 5 0.839
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149798-149828 5 0.839
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 150455-150485 5 0.839
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151112-151142 5 0.839
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 5 0.839
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 149465-149495 5 0.839
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 13985-14015 5 0.839
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1550466-1550496 5 0.839
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP019604 Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence 46139-46169 5 0.839
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP015441 Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence 133986-134016 5 0.839
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107013-107043 6 0.806
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107493-107523 6 0.806
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107781-107811 6 0.806
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104739-104769 6 0.806
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105897-105927 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 177842-177872 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 76982-77012 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP042167 Burkholderia contaminans strain ZCC plasmid unnamed1, complete sequence 95861-95891 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP028810 Burkholderia contaminans strain SK875 plasmid p875, complete sequence 105877-105907 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP046610 Burkholderia contaminans strain XL73 plasmid unnamed1, complete sequence 12730-12760 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP011920 Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence 77241-77271 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NC_013531 Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence 55997-56027 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP014514 Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence 151877-151907 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 105130-105160 6 0.806
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107013-107043 6 0.806
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107109-107139 6 0.806
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107493-107523 6 0.806
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107781-107811 6 0.806
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107877-107907 6 0.806
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2699491-2699521 6 0.806
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NC_008545 Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence 36349-36379 6 0.806
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 339728-339758 6 0.806
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 312120-312150 6 0.806
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 MN583270 Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence 219334-219364 6 0.806
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 451719-451749 6 0.806
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1920906-1920936 6 0.806
NZ_CP013406_1 1.10|2903281|31|NZ_CP013406|CRT 2903281-2903311 31 NZ_CP014276 Martelella sp. AD-3 plasmid unnamed1, complete sequence 251208-251238 6 0.806
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 958995-959025 6 0.806
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107013-107043 6 0.806
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107109-107139 6 0.806
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107493-107523 6 0.806
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107781-107811 6 0.806
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107877-107907 6 0.806
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2699491-2699521 6 0.806
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 6 0.806
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104793-104823 6 0.806
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105951-105981 6 0.806
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104577-104607 6 0.806
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107685-107715 6 0.806
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP042167 Burkholderia contaminans strain ZCC plasmid unnamed1, complete sequence 95861-95891 6 0.806
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP028810 Burkholderia contaminans strain SK875 plasmid p875, complete sequence 105877-105907 6 0.806
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP046610 Burkholderia contaminans strain XL73 plasmid unnamed1, complete sequence 12730-12760 6 0.806
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP011920 Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence 77241-77271 6 0.806
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105759-105789 6 0.806
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 151595-151625 6 0.806
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107013-107043 6 0.806
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107109-107139 6 0.806
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107493-107523 6 0.806
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107781-107811 6 0.806
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107877-107907 6 0.806
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2699491-2699521 6 0.806
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NC_008545 Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence 36349-36379 6 0.806
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 601325-601355 7 0.774
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP047145 Streptomyces sp. HF10 plasmid plas1, complete sequence 84966-84996 7 0.774
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 463258-463288 7 0.774
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 73824-73854 7 0.774
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 18392-18422 7 0.774
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 616022-616052 7 0.774
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 264937-264967 7 0.774
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NZ_LR134462 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence 28635-28665 7 0.774
NZ_CP013406_1 1.6|2903077|31|NZ_CP013406|CRT 2903077-2903107 31 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 958995-959025 7 0.774
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_LR536452 Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 3 55423-55453 7 0.774
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 AY328853 Vibrio parahaemolyticus phage VP16C, partial sequence 25694-25724 7 0.774
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 KF854250 UNVERIFIED: Vibrio phage VP_EVC_2013, partial genome 25599-25629 7 0.774
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105759-105789 7 0.774
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 114313-114343 7 0.774
NZ_CP013406_1 1.11|2903335|31|NZ_CP013406|CRT 2903335-2903365 31 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 5435-5465 7 0.774
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NZ_LR134462 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence 28635-28665 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 601325-601355 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 339728-339758 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 312120-312150 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 MN583270 Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence 219334-219364 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 463258-463288 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 616022-616052 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 264937-264967 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NC_008545 Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence 36349-36379 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP019604 Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence 46139-46169 7 0.774
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP015441 Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence 133986-134016 7 0.774
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 104697-104727 7 0.774
NZ_CP013406_1 1.20|2903797|31|NZ_CP013406|CRT 2903797-2903827 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 105855-105885 7 0.774
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NZ_LR134462 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence 28635-28665 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 601325-601355 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 339728-339758 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 312120-312150 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 MN583270 Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence 219334-219364 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 463258-463288 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 616022-616052 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 264937-264967 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NC_008545 Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence 36349-36379 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP019604 Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence 46139-46169 7 0.774
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP015441 Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence 133986-134016 7 0.774
NZ_CP013406_1 1.29|2904247|31|NZ_CP013406|CRT 2904247-2904277 31 MF403007 Agrobacterium phage Atu_ph04, complete genome 78034-78064 7 0.774
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP019604 Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence 46139-46169 7 0.774
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 339728-339758 7 0.774
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 312120-312150 7 0.774
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 MN583270 Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence 219334-219364 7 0.774
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP015441 Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence 133986-134016 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 CP006582 Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence 51628-51658 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1486817-1486847 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 326250-326280 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 89709-89739 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1158520-1158550 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 760965-760995 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 877167-877197 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 545183-545213 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 791958-791988 7 0.774
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 46631-46661 7 0.774
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 391862-391892 8 0.742
NZ_CP013406_1 1.1|2902819|31|NZ_CP013406|CRT 2902819-2902849 31 NC_049498 Arthrobacter phage Abba, complete genome 644-674 8 0.742
NZ_CP013406_1 1.2|2902873|31|NZ_CP013406|CRT 2902873-2902903 31 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 202170-202200 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 172434-172464 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 AB276040 Ralstonia phage RSA1 DNA, complete genome 8310-8340 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 AB981169 Ralstonia phage RSY1 DNA, complete genome 13035-13065 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NC_009382 Ralstonia phage phiRSA1, complete genome 8310-8340 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NC_049432 Ralstonia phage RsoM1USA, complete genome 8312-8342 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP010684 Phaeobacter piscinae strain P14 plasmid pP14_c, complete sequence 83548-83578 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP010808 Phaeobacter piscinae strain P23 plasmid pP23_c, complete sequence 76732-76762 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP031954 Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence 6901-6931 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP016369 Phaeobacter porticola strain P97 plasmid pP97_e, complete sequence 48823-48853 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NC_018423 Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence 6789-6819 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP010761 Phaeobacter inhibens strain P80 plasmid pP80_e, complete sequence 72782-72812 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP010604 Phaeobacter inhibens strain P83 plasmid pP83_e, complete sequence 72782-72812 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP010646 Phaeobacter piscinae strain P36 plasmid pP36_c, complete sequence 76732-76762 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP010710 Phaeobacter inhibens strain P66 plasmid pP66_e, complete sequence 72782-72812 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP010692 Phaeobacter piscinae strain P42 plasmid pP42_c, complete sequence 76732-76762 8 0.742
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 66897-66927 8 0.742
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 65971-66001 8 0.742
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 MN478375 Bacteriophage Titan-X, complete genome 4711-4741 8 0.742
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 30505-30535 8 0.742
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 107919-107949 8 0.742
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 465201-465231 8 0.742
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 269162-269192 8 0.742
NZ_CP013406_1 1.8|2903173|31|NZ_CP013406|CRT 2903173-2903203 31 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 356255-356285 8 0.742
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 66897-66927 8 0.742
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 65971-66001 8 0.742
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 MN478375 Bacteriophage Titan-X, complete genome 4711-4741 8 0.742
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 30505-30535 8 0.742
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 304009-304039 8 0.742
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 304009-304039 8 0.742
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 302450-302480 8 0.742
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 306697-306727 8 0.742
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 300815-300845 8 0.742
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 160426-160456 8 0.742
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 304009-304039 8 0.742
NZ_CP013406_1 1.13|2903443|31|NZ_CP013406|CRT 2903443-2903473 31 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 160420-160450 8 0.742
NZ_CP013406_1 1.15|2903539|31|NZ_CP013406|CRT 2903539-2903569 31 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 202170-202200 8 0.742
NZ_CP013406_1 1.17|2903635|31|NZ_CP013406|CRT 2903635-2903665 31 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 105130-105160 8 0.742
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 MN234219 Mycobacterium phage Mercurio, complete genome 1053-1083 8 0.742
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2008326-2008356 8 0.742
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP034817 Paracoccus sp. Arc7-R13 plasmid unnamed7, complete sequence 9302-9332 8 0.742
NZ_CP013406_1 1.19|2903743|31|NZ_CP013406|CRT 2903743-2903773 31 NZ_CP034817 Paracoccus sp. Arc7-R13 plasmid unnamed7, complete sequence 20941-20971 8 0.742
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 66897-66927 8 0.742
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 65971-66001 8 0.742
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 MN478375 Bacteriophage Titan-X, complete genome 4711-4741 8 0.742
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 30505-30535 8 0.742
NZ_CP013406_1 1.24|2904001|31|NZ_CP013406|CRT 2904001-2904031 31 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 202170-202200 8 0.742
NZ_CP013406_1 1.27|2904151|31|NZ_CP013406|CRT 2904151-2904181 31 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 105130-105160 8 0.742
NZ_CP013406_1 1.29|2904247|31|NZ_CP013406|CRT 2904247-2904277 31 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 76588-76618 8 0.742
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP013109 Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence 485252-485282 8 0.742
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP024309 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence 59438-59468 8 0.742
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 445821-445851 8 0.742
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP034153 Rhodococcus sp. NJ-530 plasmid unnamed1, complete sequence 53107-53137 8 0.742
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 333776-333806 8 0.742
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 532266-532296 8 0.742
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 2280689-2280719 8 0.742
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1633257-1633287 8 0.742
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1428884-1428914 9 0.71
NZ_CP013406_1 1.4|2902969|31|NZ_CP013406|CRT 2902969-2902999 31 NZ_CP006371 Aureimonas sp. AU20 plasmid pAU20d, complete sequence 70290-70320 9 0.71
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 156872-156902 9 0.71
NZ_CP013406_1 1.5|2903023|31|NZ_CP013406|CRT 2903023-2903053 31 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 24535-24565 9 0.71
NZ_CP013406_1 1.9|2903227|31|NZ_CP013406|CRT 2903227-2903257 31 NC_049498 Arthrobacter phage Abba, complete genome 644-674 9 0.71
NZ_CP013406_1 1.10|2903281|31|NZ_CP013406|CRT 2903281-2903311 31 NC_017771 Deinococcus gobiensis I-0 plasmid P3, complete sequence 51691-51721 9 0.71
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 156872-156902 9 0.71
NZ_CP013406_1 1.12|2903389|31|NZ_CP013406|CRT 2903389-2903419 31 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 24535-24565 9 0.71
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NZ_CP036405 Komagataeibacter saccharivorans strain JH1 plasmid p221732, complete sequence 51164-51194 9 0.71
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 400586-400616 9 0.71
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NZ_CP021051 Phaeobacter gallaeciensis strain P128 plasmid pP128_d, complete sequence 71236-71266 9 0.71
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NZ_CP021044 Phaeobacter gallaeciensis strain P129 plasmid pP129_d, complete sequence 71236-71266 9 0.71
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 286843-286873 9 0.71
NZ_CP013406_1 1.18|2903689|31|NZ_CP013406|CRT 2903689-2903719 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 542036-542066 9 0.71
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 156872-156902 9 0.71
NZ_CP013406_1 1.21|2903851|31|NZ_CP013406|CRT 2903851-2903881 31 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 24535-24565 9 0.71
NZ_CP013406_1 1.26|2904097|31|NZ_CP013406|CRT 2904097-2904127 31 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 319913-319943 9 0.71
NZ_CP013406_1 1.26|2904097|31|NZ_CP013406|CRT 2904097-2904127 31 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 567261-567291 9 0.71
NZ_CP013406_1 1.29|2904247|31|NZ_CP013406|CRT 2904247-2904277 31 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 648651-648681 9 0.71
NZ_CP013406_1 1.29|2904247|31|NZ_CP013406|CRT 2904247-2904277 31 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 394451-394481 9 0.71
NZ_CP013406_1 1.29|2904247|31|NZ_CP013406|CRT 2904247-2904277 31 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 16379-16409 9 0.71
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NZ_CP021119 Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence 21286-21316 9 0.71
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_LR027556 Epibacterium mobile isolate EPIB1 plasmid 4, complete sequence 141886-141916 9 0.71
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_CP025813 Sulfitobacter sp. SK025 plasmid unnamed5, complete sequence 67112-67142 9 0.71
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 MH509442 Mycobacterium phage Aminay, complete genome 39300-39330 10 0.677
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NC_041890 Propionibacterium phage Anatole, complete genome 14618-14648 10 0.677
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 KX620752 Propionibacterium phage E1, complete genome 14618-14648 10 0.677
NZ_CP013406_1 1.30|2904301|31|NZ_CP013406|CRT 2904301-2904331 31 NC_041892 Propionibacterium phage B3, complete genome 14621-14651 10 0.677
NZ_CP013406_1 1.32|2904397|31|NZ_CP013406|CRT 2904397-2904427 31 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 227817-227847 11 0.645

1. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.935

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************.**************.***

2. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.935

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************.**************.***

3. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 2, identity: 0.935

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ttcgacgtcgaccggtctgtcgtcggctacc	Protospacer
*** ************** ************

4. spacer 1.2|2902873|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
************************.** ** 

5. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
*************************** *  

6. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.903

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
***************.** ********** *

7. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.903

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
***************.** ********** *

8. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ttcgacgtcgaccggtctgtcgtcggctacc	Protospacer
.***** ********************** *

9. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ttccacgtcgacgggcctttcatcggccaat	Protospacer
******************.**.********.

10. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
.*********** **************.***

11. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ttccacgtcgacgggcctttcatcggccaat	Protospacer
******************.**.********.

12. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
.*********** **************.***

13. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ttccacgtcgacgggcctttcatcggccaat	Protospacer
******************.**.********.

14. spacer 1.15|2903539|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
************************.** ** 

15. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
.******************** ******* *

16. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
.******************** ******* *

17. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
ttccacgtcgaccggtctgtcgacggccacc	Protospacer
*********************  ****** *

18. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
.***************** ********.***

19. spacer 1.22|2903905|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 3, identity: 0.903

ttccacgtcgaccggtctttcgtcggctacc	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
.***************** ********.***

20. spacer 1.24|2904001|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.903

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
************************.** ** 

21. spacer 1.26|2904097|31|NZ_CP013406|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 3, identity: 0.903

ttcgacttcgacgggcctttcgtcggcgaac	CRISPR spacer
ttcgacttcgacgggcctgtcgtcggccaat	Protospacer
****************** ******** **.

22. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
gtcgacctcgaccggtttgtcgtcgacgtag	Protospacer
 ***************.*********** * 

23. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
gtcgacctcgaccggtttgtcgtcgacgtag	Protospacer
 ***************.*********** * 

24. spacer 1.2|2902873|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************.***********.**.* *

25. spacer 1.2|2902873|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************.***********.**.* *

26. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ttccacgtcgactggcctgtcctcggccact	Protospacer
****** *****.**************** .

27. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ttccacgtcgacgggcctgtcctcggctacc	Protospacer
****** ***** **************.* *

28. spacer 1.6|2903077|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgacgggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************ ***********.**.* *

29. spacer 1.6|2903077|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgacgggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************ ***********.**.* *

30. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ***********************.* *

31. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ***********************.* *

32. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ***********************.* *

33. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
atcgacctcgaccgggctgtcgtcggccaat	Protospacer
 ************** ***********.**.

34. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
*** ** ********************.* *

35. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
*** ** ********************.* *

36. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacc	Protospacer
****** ***** **************.* *

37. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ttccacgtcgacgggcctgtcctcggctacc	Protospacer
****************** ** *****.* *

38. spacer 1.15|2903539|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************.***********.**.* *

39. spacer 1.15|2903539|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************.***********.**.* *

40. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
ttccacgtcgactggcctgtcctcggccact	Protospacer
************.********.***** * *

41. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
gtctgcgtcgacgggtctgtcctcggccaac	Protospacer
 **..******* ******************

42. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
ctccacgtcgaccggtttgtcgtcggccacc	Protospacer
.***************.**** ******* *

43. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
ctccacgtcgacgggtctgtccacggccacc	Protospacer
.*********** ********* ****** *

44. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
ttccacgtcgactggcctgtcctcggccact	Protospacer
************.**.************* .

45. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
ttccacgtcgacgggcctgtcctcggctacc	Protospacer
************ **.***********.* *

46. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
ttcgacgtcgaccggtctgtcgtcggctacc	Protospacer
*** ***************** *****.* *

47. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
gtccacgtcgacgggtctgtcgtcggccacg	Protospacer
 ***************** **********  

48. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
.*********** ***** ********** *

49. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctccacgtcgacgggtctgtcgacggccacc	Protospacer
.***************** *** ****** *

50. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
.*********** ***** ********** *

51. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 4, identity: 0.871

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacc	Protospacer
.** ************** ********** *

52. spacer 1.24|2904001|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************.***********.**.* *

53. spacer 1.24|2904001|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctccacgtcgactggcctctcgtcggctaac	Protospacer
************.***********.**.* *

54. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
atcgacctcgaccgggctgtcgtcggccaat	Protospacer
 ************** ** ***********.

55. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ***** ********************.* *

56. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ***** ********************.* *

57. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 4, identity: 0.871

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ***** ********************.* *

58. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
ttcgacgtcgaccggtctgtcgtcggctacc	Protospacer
.***** ******************.* * *

59. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
ctgctcctcgaccggtctgtcggcgacgatc	Protospacer
**   ***************** ****** *

60. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
*** ** ******************.* * *

61. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
*** ** ******************.* * *

62. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacc	Protospacer
****** ***** ************.* * *

63. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacc	Protospacer
****** ********.*********.* * *

64. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ***** **************.*  

65. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ***** **************.*  

66. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ***** **************.*  

67. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
.*********** ************** *  

68. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ******** **************.* *

69. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ******** **************.* *

70. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ******** **************.* *

71. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
gtccacgtcgacgggtctgtcgtcggccacg	Protospacer
 **************.** **********  

72. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacc	Protospacer
****** ********.*********.* * *

73. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
.***** ******************** *  

74. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ** ********************.* *

75. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ** ********************.* *

76. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ** ********************.* *

77. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
ttccacgtcgacgggcctgtcctcggctacc	Protospacer
************ ********.***** * .

78. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
gtccacgtcgacgggtctgtcgtcggccacg	Protospacer
 *********** ******** *******  

79. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
.** ************** **********  

80. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
.** ************** **********  

81. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
.** ************** **********  

82. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
gtctgcgtcgacgggtctgtcctcggccaac	Protospacer
 **..************* ** *********

83. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacc	Protospacer
****** ********.*********.* * *

84. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
.***** ******************** *  

85. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ** ********************.* *

86. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ** ********************.* *

87. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
gtcgacgtcgaccggcctctcgtcggctacc	Protospacer
 ** ** ********************.* *

88. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
*** ** ******************** *  

89. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 5, identity: 0.839

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
atcgacctcgaccgggctgtcgtcggccaat	Protospacer
 ************** *********** * .

90. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 5, identity: 0.839

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
ttcgacttcgacgggcctgtcgtcggccaat	Protospacer
******.***** ************** * .

91. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.839

ttcgac-ctcgaccggcctgtcgtcggcgacc	CRISPR spacer
-gcgacgctcgcccggcctgtcgtcgccgaca	Protospacer
  **** **** ************** **** 

92. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 5, identity: 0.839

ttcgacctcgaccggcctgtcgtcggcgacc-	CRISPR spacer
ttcgacctcgaccggcctcacgttga-gaccg	Protospacer
******************  ***.*. **** 

93. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839

ttcgacctcgaccggcctgtcgtcggcgacc-	CRISPR spacer
ttcgacctcgaccggcctcacgttga-gaccg	Protospacer
******************  ***.*. **** 

94. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ***** ************.* *  

95. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ***** ************.* *  

96. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ***** ************.* *  

97. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
gtcgttgtcgactggtctctcgtcgacgaac	Protospacer
 *** . *****.***** ************

98. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
gtcgttgtcgactggtctctcgtcgacgaac	Protospacer
 *** . *****.***** ************

99. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcctcgccggcc	Protospacer
.****************.******* * . *

100. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
gtctgcgtcgacgggtctgtcctcggccaac	Protospacer
 **..* ***** **.***************

101. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP042167 (Burkholderia contaminans strain ZCC plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
gtcgctgtcgaccggcttgtcctcggccaac	Protospacer
 **  . *********.**************

102. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP028810 (Burkholderia contaminans strain SK875 plasmid p875, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
gtcgctgtcgaccggcttgtcctcggccaac	Protospacer
 **  . *********.**************

103. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP046610 (Burkholderia contaminans strain XL73 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
gtcgctgtcgaccggcttgtcctcggccaac	Protospacer
 **  . *********.**************

104. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP011920 (Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
atcgctgtcgaccggcttgtcctcggccaac	Protospacer
 **  . *********.**************

105. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctcgtcctcgaccggccagacctcggccacc	Protospacer
.**  ************ * ********* *

106. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP014514 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacctcgaccggcctgtcct-cggccaac	CRISPR spacer
ttccacctcggccggcctgccctgcagacga-	Protospacer
**********.********.*** *.* *.* 

107. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacctcgaccggcc---tgtcctcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtccccggcc---	Protospacer
.****************   .****.*****   

108. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ********.*********.* *  

109. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacggggctgtcgtcggccacg	Protospacer
****** ******** *********.* *  

110. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ********.*********.* *  

111. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ********.*********.* *  

112. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacggggctgtcgtcggccacg	Protospacer
****** ******** *********.* *  

113. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacctcgacgggcgcgtcgtcgaacccc	Protospacer
**************** .********    *

114. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NC_008545 (Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
atcgctgtcgaccggcttatcgtcggccaac	Protospacer
 **  .**********.* ************

115. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 6, identity: 0.806

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
*  **  **************.*.*******

116. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 6, identity: 0.806

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
*  **  **************.*.*******

117. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 6, identity: 0.806

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
*  **  **************.*.*******

118. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
gtcgacctcgaccggtttgtcgtcgacgtag	Protospacer
 ***************.********.*  * 

119. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
gtcgacctcgaccggtttgtcgtcgacgtag	Protospacer
 ***************.********.*  * 

120. spacer 1.10|2903281|31|NZ_CP013406|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

gtcgacatcgacgggcctgtcctcagccaac--	CRISPR spacer
gtcgacatcgacgggcctttcct--gcggatgg	Protospacer
****************** ****  ** .*.  

121. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgacgggcctctcgtcggccaac-	CRISPR spacer
atccacgtcgacgggcagctcgtc-ttcaaca	Protospacer
 ***************  ******  .**** 

122. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ********.*********.* *  

123. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacggggctgtcgtcggccacg	Protospacer
****** ******** *********.* *  

124. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ********.*********.* *  

125. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ********.*********.* *  

126. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacggggctgtcgtcggccacg	Protospacer
****** ******** *********.* *  

127. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacctcgacgggcgcgtcgtcgaacccc	Protospacer
**************** .********    *

128. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
.***************** ** *****.*  

129. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
.**************.***** ***** * .

130. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
ctccacgtcgaccggtctgtcgtcggccacc	Protospacer
.**************.***** ***** * .

131. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
ctccacgtcgacgggtctgtccacggcgatg	Protospacer
.*********** ********* **** *  

132. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
gtccacgtcgacgggtctgtccacggcaacg	Protospacer
 *********** ********* **** *  

133. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP042167 (Burkholderia contaminans strain ZCC plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
gtcgctgtcgaccggcttgtcctcggccaac	Protospacer
 **  .*********..**************

134. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP028810 (Burkholderia contaminans strain SK875 plasmid p875, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
gtcgctgtcgaccggcttgtcctcggccaac	Protospacer
 **  .*********..**************

135. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP046610 (Burkholderia contaminans strain XL73 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
gtcgctgtcgaccggcttgtcctcggccaac	Protospacer
 **  .*********..**************

136. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP011920 (Burkholderia cenocepacia strain ST32 plasmid pBCEN1232, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
atcgctgtcgaccggcttgtcctcggccaac	Protospacer
 **  .*********..**************

137. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctcgctgtcgacgggtctctcgtcgaccaat	Protospacer
.**  .*******************.****.

138. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 6, identity: 0.806

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctccacgtcgaccggcctctcgtcggcaacg	Protospacer
.*********** **.*********** *  

139. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ********.*********.* *  

140. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacggggctgtcgtcggccacg	Protospacer
****** ******** *********.* *  

141. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ********.*********.* *  

142. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacgggtctgtcgtcggccacg	Protospacer
****** ********.*********.* *  

143. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacgtcgacggggctgtcgtcggccacg	Protospacer
****** ******** *********.* *  

144. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
ctcgacctcgacgggcgcgtcgtcgaacccc	Protospacer
**************** .********    *

145. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NC_008545 (Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
atcgctgtcgaccggcttatcgtcggccaac	Protospacer
 *** . *********.* ************

146. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgccggcc	Protospacer
.****************.*** *** * . *

147. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ttccacctcgaccggccggtcatccacaagg	Protospacer
***************** *** ** .* *. 

148. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgccggcc	Protospacer
.****************.*** *** * . *

149. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP010862 (Marinovum algicola DG 898 plasmid pMaD7) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctattcgtcgaccggcctggtctcggccaac	Protospacer
.* . * ************ .**********

150. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP010862 (Marinovum algicola DG 898 plasmid pMaD7) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
cccgatctcgaccggcttgccctcggccatc	Protospacer
..* *.**********.**.********* *

151. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgtcggcc	Protospacer
.****************.*** *** * . *

152. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgccggcc	Protospacer
.****************.*** *** * . *

153. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 7, identity: 0.774

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gtcgacctcgacgagccggtcgtcgacctcg	Protospacer
 ************.*** *********    

154. spacer 1.6|2903077|31|NZ_CP013406|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.774

ctccacgtcgacgggcctctcgtcagccacc	CRISPR spacer
atccacgtcgacgggcagctcgtcttcaaca	Protospacer
 ***************  ******  * ** 

155. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_LR536452 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 3) position: , mismatch: 7, identity: 0.774

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
cgcgacgtcgaccagcctcccgtcggcccgg	Protospacer
* * *********.*****.******** . 

156. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to AY328853 (Vibrio parahaemolyticus phage VP16C, partial sequence) position: , mismatch: 7, identity: 0.774

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacgtcgcccggtctgtcgttgaacgac	Protospacer
****** *** ************.*. ..**

157. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to KF854250 (UNVERIFIED: Vibrio phage VP_EVC_2013, partial genome) position: , mismatch: 7, identity: 0.774

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
ctcgacgtcgcccggtctgtcgttgaacgac	Protospacer
****** *** ************.*. ..**

158. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ctcgctgtcgacgggtctctcgtcgaccaat	Protospacer
.**  .*********.*********.****.

159. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgacgagcttctcgtcggcgctg	Protospacer
.************.**.**********    

160. spacer 1.11|2903335|31|NZ_CP013406|CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacgtcgacgggcctctcgtcggccaac	CRISPR spacer
ctccacgtcgacgagcttctcgtcggcgctg	Protospacer
.************.**.**********    

161. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 7, identity: 0.774

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gtcgacctcgacgagccggtcgtcgacctcg	Protospacer
 ************.*** *********    

162. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgccggcc	Protospacer
.****************. ****** * . *

163. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
.  ** .**************.*.*******

164. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
.  ** .**************.*.*******

165. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
.  ** .**************.*.*******

166. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgccggcc	Protospacer
.****************. ****** * . *

167. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgtcggcc	Protospacer
.****************. ****** * . *

168. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgccggcc	Protospacer
.****************. ****** * . *

169. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NC_008545 (Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
atcgctgtcgaccggcttatcgtcggccaac	Protospacer
 **  . *********.* ************

170. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac--	CRISPR spacer
ttcgacctcgaccggcctcacgttga--gaccg	Protospacer
*** *************** ***.*.  .**  

171. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac--	CRISPR spacer
ttcgacctcgaccggcctcacgttga--gaccg	Protospacer
*** *************** ***.*.  .**  

172. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctcgctgtcgacgggtctctcgtcgacgaat	Protospacer
.**  .*******************.* **.

173. spacer 1.20|2903797|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacgtcgacgggtctctcgtcggccaac	CRISPR spacer
ctcgctgtcgacgggtctctcgtcgacgaat	Protospacer
.**  .*******************.* **.

174. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NZ_LR134462 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 20, complete sequence) position: , mismatch: 7, identity: 0.774

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gtcgacctcgacgagccggtcgtcgacctcg	Protospacer
 ************.*** *********    

175. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgccggcc	Protospacer
.****************. ****** * . *

176. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
.  ** .**************.*.*******

177. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
.  ** .**************.*.*******

178. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
.  ** .**************.*.*******

179. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgccggcc	Protospacer
.****************. ****** * . *

180. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgtcggcc	Protospacer
.****************. ****** * . *

181. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtcgccggcc	Protospacer
.****************. ****** * . *

182. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NC_008545 (Burkholderia cenocepacia HI2424 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
atcgctgtcgaccggcttatcgtcggccaac	Protospacer
 **  . *********.* ************

183. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac--	CRISPR spacer
ttcgacctcgaccggcctcacgttga--gaccg	Protospacer
*** *************** ***.*.  .**  

184. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ttccacctcgaccggcctctcgtcggccaac--	CRISPR spacer
ttcgacctcgaccggcctcacgttga--gaccg	Protospacer
*** *************** ***.*.  .**  

185. spacer 1.29|2904247|31|NZ_CP013406|CRT matches to MF403007 (Agrobacterium phage Atu_ph04, complete genome) position: , mismatch: 7, identity: 0.774

ttcgacctcgacgggcctttcgtcggcgaat	CRISPR spacer
ttcgacctcgaagagcctttcgtcaacatct	Protospacer
*********** *.**********..*.  *

186. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 7, identity: 0.774

ctcgacctcgaccggcctctcgtcggccaac--	CRISPR spacer
ttcgacctcgaccggcctcacgttga--gaccg	Protospacer
.****************** ***.*.  .**  

187. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 7, identity: 0.774

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
*   * .**************.*.*******

188. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 7, identity: 0.774

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
*   * .**************.*.*******

189. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 7, identity: 0.774

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
caacagttcgaccggcctctcattggccaac	Protospacer
*   * .**************.*.*******

190. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ctcgacctcgaccggcctctcgtcggccaac--	CRISPR spacer
ttcgacctcgaccggcctcacgttga--gaccg	Protospacer
.****************** ***.*.  .**  

191. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
agccgtctcgtccgacctgtcgtcggcgacc	Protospacer
  * ..**** ***.****************

192. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
gtcgaccacgaccggcccgtcgtcggggtgt	Protospacer
 ****** *********.******** *  .

193. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
gtcgaccacgaccggcccgtcgtcggggtgt	Protospacer
 ****** *********.******** *  .

194. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctc-----gaccggcctgtcgtcggcgacc	CRISPR spacer
-----gctcggggagaccggcctgtcgtccgcgacc	Protospacer
      ***     *************** ******

195. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
atcgacctcgaccggcttgtcgccgcagtct	Protospacer
 ***************.*****.**  * *.

196. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
atcgacctcgaccggcttgtcgccgcagtct	Protospacer
 ***************.*****.**  * *.

197. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
atcgacctcgaccggcttgtcgccgcagtct	Protospacer
 ***************.*****.**  * *.

198. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
atcgacctcgaccggcttgtcgccgcagtct	Protospacer
 ***************.*****.**  * *.

199. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
atcgacctcgaccggcttgtcgccgcagtct	Protospacer
 ***************.*****.**  * *.

200. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
cgcgacctcgaacggcccgtcgtcgcccccc	Protospacer
. ********* *****.******* *  **

201. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
gatcgcctcgaccggtccgtcctcgacgacc	Protospacer
  . .************.*** ******* *

202. spacer 1.1|2902819|31|NZ_CP013406|CRT matches to NC_049498 (Arthrobacter phage Abba, complete genome) position: , mismatch: 8, identity: 0.742

ctcgacctcgaccggtctgtcgtcgacgaac	CRISPR spacer
cccgacctcgaacggtcagtcgtcgaaccgt	Protospacer
*.********* ***** ********   ..

203. spacer 1.2|2902873|31|NZ_CP013406|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.742

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctgtttgtcgaccggcttctcctcagccagg	Protospacer
** . .**********.**** *******  

204. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
gagcacctcgaccggcctgtccgcgacctct	Protospacer
   ******************* **.**  .

205. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
gcgcacctcgtccggcatgtcctcggccgcg	Protospacer
 . ******* ***** ***********.  

206. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
gcgcacctcgtccggcatgtcctcggccgcg	Protospacer
 . ******* ***** ***********.  

207. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
gcgcacctcgtccggcatgtcctcggccgcg	Protospacer
 . ******* ***** ***********.  

208. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NC_049432 (Ralstonia phage RsoM1USA, complete genome) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
gcgcacctcgtccggcatgtcctcggccgcg	Protospacer
 . ******* ***** ***********.  

209. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP010684 (Phaeobacter piscinae strain P14 plasmid pP14_c, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

210. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP010808 (Phaeobacter piscinae strain P23 plasmid pP23_c, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

211. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP031954 (Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

212. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP016369 (Phaeobacter porticola strain P97 plasmid pP97_e, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

213. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NC_018423 (Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

214. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP010761 (Phaeobacter inhibens strain P80 plasmid pP80_e, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

215. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP010604 (Phaeobacter inhibens strain P83 plasmid pP83_e, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

216. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP010646 (Phaeobacter piscinae strain P36 plasmid pP36_c, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

217. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP010710 (Phaeobacter inhibens strain P66 plasmid pP66_e, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

218. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP010692 (Phaeobacter piscinae strain P42 plasmid pP42_c, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ctccacatcgaccggcttgtcctcttccttg	Protospacer
.***** *********.*******  **   

219. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gacgcgctcgacggtcctgtcgtcgacggcg	Protospacer
  **  ******** *************.  

220. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gacgcgctcgacggtcctgtcgtcgacggcg	Protospacer
  **  ******** *************.  

221. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gtcgacctcgacgcgcttgtcgtcggcaccg	Protospacer
 ************ **.********.*.   

222. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
tcagaactcgacggtcctgtcgtcgaagctc	Protospacer
.. ** ******** *********** *  *

223. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.742

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
ttcgctgtcgaccggcctgtcgacggccacg	Protospacer
.**  .************ *** ******  

224. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
gacgacgtcgaccggcgcctcgtcggcgatg	Protospacer
  * ************ .********* *  

225. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 8, identity: 0.742

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
gtctgggtcgaccggcatctcgtcgggcagg	Protospacer
 **.. ********** ********* **. 

226. spacer 1.8|2903173|31|NZ_CP013406|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.742

ctccacgtcgaccggcctctcgtcggccaac	CRISPR spacer
gtctgggtcgaccggcatctcgtcgggcagg	Protospacer
 **.. ********** ********* **. 

227. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gacgcgctcgacggtcctgtcgtcgacggcg	Protospacer
  **  ******** *************.  

228. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gacgcgctcgacggtcctgtcgtcgacggcg	Protospacer
  **  ******** *************.  

229. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gtcgacctcgacgcgcttgtcgtcggcaccg	Protospacer
 ************ **.********.*.   

230. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
tcagaactcgacggtcctgtcgtcgaagctc	Protospacer
.. ** ******** *********** *  *

231. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ggactgatcgacgggtctttcgtcagcgacc	Protospacer
   *  .***** ************** ***

232. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ggactgatcgacgggtctttcgtcagcgacc	Protospacer
   *  .***** ************** ***

233. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ggactgatcgacgggtctttcgtcagcgacc	Protospacer
   *  .***** ************** ***

234. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ggactgatcgacgggtctttcgtcagcgacc	Protospacer
   *  .***** ************** ***

235. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ggactgatcgacgggtctttcgtcagcgacc	Protospacer
   *  .***** ************** ***

236. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ggactgatcgacgggtctttcgtcagcgacc	Protospacer
   *  .***** ************** ***

237. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ggactgatcgacgggtctttcgtcagcgacc	Protospacer
   *  .***** ************** ***

238. spacer 1.13|2903443|31|NZ_CP013406|CRT matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctttcgtcagctacc	CRISPR spacer
ggactgatcgacgggtctttcgtcagcgacc	Protospacer
   *  .***** ************** ***

239. spacer 1.15|2903539|31|NZ_CP013406|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.742

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctgtttgtcgaccggcttctcctcagccagg	Protospacer
** . .**********.**** *******  

240. spacer 1.17|2903635|31|NZ_CP013406|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtccccggcc	Protospacer
.****************. *****  * . *

241. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
ctcgccgtcggccggcctttcttcggcgtcg	Protospacer
.**  *****.******* *********   

242. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
gcactcgtcgaccggtctgcgctcggccgag	Protospacer
 . * **************. *******.* 

243. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP034817 (Paracoccus sp. Arc7-R13 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
cacaagatcgaccgttctgtcttcggccaag	Protospacer
. * * .******* ******.******** 

244. spacer 1.19|2903743|31|NZ_CP013406|CRT matches to NZ_CP034817 (Paracoccus sp. Arc7-R13 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacgtcgaccggtctgtcctcggccaac	CRISPR spacer
cacaagatcgaccgttctgtcttcggccaag	Protospacer
. * * .******* ******.******** 

245. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gacgcgctcgacggtcctgtcgtcgacggcg	Protospacer
  **  ******** *************.  

246. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gacgcgctcgacggtcctgtcgtcgacggcg	Protospacer
  **  ******** *************.  

247. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gtcgacctcgacgcgcttgtcgtcggcaccg	Protospacer
 ************ **.********.*.   

248. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
tcagaactcgacggtcctgtcgtcgaagctc	Protospacer
.. ** ******** *********** *  *

249. spacer 1.24|2904001|31|NZ_CP013406|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.742

ctccacgtcgaccggcctctcgtcagccacc	CRISPR spacer
ctgtttgtcgaccggcttctcctcagccagg	Protospacer
** . .**********.**** *******  

250. spacer 1.27|2904151|31|NZ_CP013406|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 8, identity: 0.742

ttccacctcgaccggcctctcgtcggccaac	CRISPR spacer
ctccacctcgaccggcccgtcgtccccggcc	Protospacer
.****************. *****  * . *

251. spacer 1.29|2904247|31|NZ_CP013406|CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ttcgacctcgacgggcctttcgtcggcgaat--	CRISPR spacer
atcgacctcgacgggccttacgtt--cagacca	Protospacer
 ****************** ***.  *..*.  

252. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
tgcgtcctcgaccggcctcacgtcgccggcc	Protospacer
. ** ************** ***** * . *

253. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP024309 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
tgcgtcctcgaccggcctcacgtcgccggcc	Protospacer
. ** ************** ***** * . *

254. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
tgcgtcctcgaccggcctcacgtcgccggcc	Protospacer
. ** ************** ***** * . *

255. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP034153 (Rhodococcus sp. NJ-530 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
gacgacctcgaccggcggctcgtcgttcggc	Protospacer
  **************  ******* .*..*

256. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
ggtcgcctcgaccagcctgtcggcggcgaca	Protospacer
  . .********.******** ******* 

257. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.742

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
gtcgacgtcgaccggcgtgtcgtcgacatag	Protospacer
 ***** ********* ********.*.   

258. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.742

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
gtcgacttcgaccggcttgtcgtcgacatag	Protospacer
 *****.*********.********.*.   

259. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.742

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
gtcgacgtcgaccggcgtgtcgtcgacatag	Protospacer
 ***** ********* ********.*.   

260. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.71

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
cggcacctcgaccggcccgtgctcggacttt	Protospacer
.  **************.** ***** *  .

261. spacer 1.4|2902969|31|NZ_CP013406|CRT matches to NZ_CP006371 (Aureimonas sp. AU20 plasmid pAU20d, complete sequence) position: , mismatch: 9, identity: 0.71

ttccacctcgaccggcctgtcctcggccaac	CRISPR spacer
ccggacctcggccagcctgtcctcggctccc	Protospacer
..  ******.**.*************.  *

262. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gacgacctcgacgggctcgtcgtcgttggca	Protospacer
  **************..******* .*.  

263. spacer 1.5|2903023|31|NZ_CP013406|CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gccgacctcgacgtgcctgtcgccgcctgca	Protospacer
 .*********** ********.** * .  

264. spacer 1.9|2903227|31|NZ_CP013406|CRT matches to NC_049498 (Arthrobacter phage Abba, complete genome) position: , mismatch: 9, identity: 0.71

ctcgacctcgaccggtctgtcgtcggctaac	CRISPR spacer
cccgacctcgaacggtcagtcgtcgaaccgt	Protospacer
*.********* ***** *******. . ..

265. spacer 1.10|2903281|31|NZ_CP013406|CRT matches to NC_017771 (Deinococcus gobiensis I-0 plasmid P3, complete sequence) position: , mismatch: 9, identity: 0.71

gtcgacatcgacgggcctgtcctcagccaac	CRISPR spacer
ctcgacaccgacgcgcctgtcctcgtgagaa	Protospacer
 ******.***** **********.   .* 

266. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gacgacctcgacgggctcgtcgtcgttggca	Protospacer
  **************..******* .*.  

267. spacer 1.12|2903389|31|NZ_CP013406|CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gccgacctcgacgtgcctgtcgccgcctgca	Protospacer
 .*********** ********.** * .  

268. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NZ_CP036405 (Komagataeibacter saccharivorans strain JH1 plasmid p221732, complete sequence) position: , mismatch: 9, identity: 0.71

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
ggccacgtcgaccgacctgttttcgatcagg	Protospacer
  ************.*****.****.. *. 

269. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 9, identity: 0.71

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
cgccacggcgaccggccggtcttcgcggcgg	Protospacer
. ***** ********* *******  * . 

270. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NZ_CP021051 (Phaeobacter gallaeciensis strain P128 plasmid pP128_d, complete sequence) position: , mismatch: 9, identity: 0.71

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
ctccacatcgaccggcttgtcttcttccttg	Protospacer
.*****.*********.*******  *    

271. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NZ_CP021044 (Phaeobacter gallaeciensis strain P129 plasmid pP129_d, complete sequence) position: , mismatch: 9, identity: 0.71

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
ctccacatcgaccggcttgtcttcttccttg	Protospacer
.*****.*********.*******  *    

272. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 9, identity: 0.71

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
gtaatattcgcccggcctgtattcggcgaag	Protospacer
 *     *** ********* ********* 

273. spacer 1.18|2903689|31|NZ_CP013406|CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 9, identity: 0.71

ttccacgtcgaccggcctgtcttcggcgaat	CRISPR spacer
accggcggcgaccgccctgtcttcggcggcc	Protospacer
 .* .** ****** *************. .

274. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gacgacctcgacgggctcgtcgtcgttggca	Protospacer
  **************..******* .*.  

275. spacer 1.21|2903851|31|NZ_CP013406|CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgacctcgacgggcctgtcgtcgacgaac	CRISPR spacer
gccgacctcgacgtgcctgtcgccgcctgca	Protospacer
 .*********** ********.** * .  

276. spacer 1.26|2904097|31|NZ_CP013406|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

ttcgacttcgacgggcctttcgtcggcgaac	CRISPR spacer
gcgatcttcgacgtgcctttcgtcggctcgc	Protospacer
 . . ******** *************  .*

277. spacer 1.26|2904097|31|NZ_CP013406|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.71

ttcgacttcgacgggcctttcgtcggcgaac	CRISPR spacer
gcgatcttcgacgtgcctttcgtcggctcgc	Protospacer
 . . ******** *************  .*

278. spacer 1.29|2904247|31|NZ_CP013406|CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

ttcgacctcgacgggcctttcgtcggcgaat	CRISPR spacer
caccgcctcgaagggcctttcatcggcgcgc	Protospacer
. * .****** *********.****** ..

279. spacer 1.29|2904247|31|NZ_CP013406|CRT matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 9, identity: 0.71

ttcgacctcgacgggcctttcgtcggcgaat------	CRISPR spacer
gtcgacctcgacggggccttcgtc------ttgcccg	Protospacer
 ************** *.******      *      

280. spacer 1.29|2904247|31|NZ_CP013406|CRT matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 9, identity: 0.71

ttcgacctcgacgggcctttcgtcggcgaat	CRISPR spacer
accgacctcgacggggcgttcgtcgcccccg	Protospacer
 .************* * ******* *    

281. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
agcctcctcgaccggcgcctcgtcggccggg	Protospacer
  *  *********** .**********.. 

282. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_LR027556 (Epibacterium mobile isolate EPIB1 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.71

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
gggcgcctcgtccggcctgtcggcggcgggc	Protospacer
    .***** *********** *****. *

283. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_CP025813 (Sulfitobacter sp. SK025 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.71

ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
gggcgcctcgtccggcctgtcggcggcgggc	Protospacer
    .***** *********** *****. *

284. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to MH509442 (Mycobacterium phage Aminay, complete genome) position: , mismatch: 10, identity: 0.677

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
ggcgacctcgaccggctgctcgtcgagatgg	Protospacer
  **************. *******.   . 

285. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NC_041890 (Propionibacterium phage Anatole, complete genome) position: , mismatch: 10, identity: 0.677

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
ggcgacctcgaccgccctcacgtcgcagggg	Protospacer
  ************ **** *****   .. 

286. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to KX620752 (Propionibacterium phage E1, complete genome) position: , mismatch: 10, identity: 0.677

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
ggcgacctcgaccgccctcacgtcgcagggg	Protospacer
  ************ **** *****   .. 

287. spacer 1.30|2904301|31|NZ_CP013406|CRT matches to NC_041892 (Propionibacterium phage B3, complete genome) position: , mismatch: 10, identity: 0.677

ctcgacctcgaccggcctctcgtcggccaac	CRISPR spacer
ggcgacctcgaccgccctcacgtcgcagggg	Protospacer
  ************ **** *****   .. 

288. spacer 1.32|2904397|31|NZ_CP013406|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 11, identity: 0.645

-ttcgacctcgaccggcctgtcgtcggcgacc	CRISPR spacer
cgtcgccgacgaccggccgctcgaccttgac-	Protospacer
  *** *  *********  *** *  .*** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2543023 : 2587488 46 Ralstonia_phage(28.57%) head,terminase,integrase,tail,capsid,portal attL 2528081:2528097|attR 2575652:2575668
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP013405
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP013404
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 212357 : 287619 74 Burkholderia_phage(67.74%) plate,tail,holin,integrase attL 205053:205073|attR 284134:284154
DBSCAN-SWA_2 469648 : 517398 38 uncultured_Caudovirales_phage(50.0%) protease,tail,plate NA
DBSCAN-SWA_3 814464 : 823546 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_4 1058300 : 1068939 9 Bacillus_virus(33.33%) transposase,tRNA NA
DBSCAN-SWA_5 1151154 : 1159437 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_6 2232860 : 2305253 68 uncultured_Caudovirales_phage(23.08%) tail,holin,integrase,protease,transposase,plate attL 2230182:2230199|attR 2294554:2294571
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage