Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017579 Sphingomonas melonis TY plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP017578 Sphingomonas melonis TY chromosome, complete genome 1 crisprs DEDDh,csa3,RT 0 1 5 0

Results visualization

1. NZ_CP017578
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017578_1 1262423-1262538 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017578_1 1.1|1262455|52|NZ_CP017578|CRISPRCasFinder 1262455-1262506 52 NZ_CP009572 Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence 160147-160198 11 0.788

1. spacer 1.1|1262455|52|NZ_CP017578|CRISPRCasFinder matches to NZ_CP009572 (Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence) position: , mismatch: 11, identity: 0.788

ctgcccctgcggctgggtggaccccggaacaagtccggggtgacgaggggtg	CRISPR spacer
gcacgcctgcggctcggtggaccccggaacgagtccggggtgacggatattg	Protospacer
 ..* ********* ***************.**************.. . **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 94196 : 108693 18 Rhizobium_phage(30.0%) terminase,capsid,protease,portal,tail,head NA
DBSCAN-SWA_2 2901917 : 2968750 45 Escherichia_phage(22.22%) tRNA,transposase NA
DBSCAN-SWA_3 2980007 : 3034118 45 Stx2-converting_phage(16.67%) integrase,transposase attL 3027373:3027389|attR 3037441:3037457
DBSCAN-SWA_4 3063449 : 3072405 9 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_5 3913472 : 3920977 9 Caulobacter_virus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage