Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017014 Rhodococcus sp. WMMA185 chromosome, complete genome 1 crisprs WYL,cas3,Cas14u_CAS-V,c2c9_V-U4,cas4,cas14j,DEDDh,csa3,DinG 0 1 0 0

Results visualization

1. NZ_CP017014
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017014_1 3760304-3760625 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017014_1 1.2|3760395|29|NZ_CP017014|CRISPRCasFinder 3760395-3760423 29 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 830998-831026 7 0.759

1. spacer 1.2|3760395|29|NZ_CP017014|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

agctggcgcggatatgcgatctgtggata	CRISPR spacer
ctctggcgcggatatgccatctgggtagg	Protospacer
  *************** ***** * * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage