Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017580 Curtobacterium sp. BH-2-1-1 chromosome, complete genome 7 crisprs cas3,DEDDh,csa3,WYL,RT 0 2 0 0

Results visualization

1. NZ_CP017580
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017580_1 140422-140752 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017580_2 643638-643788 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017580_3 946586-946676 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017580_4 1226591-1226670 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017580_5 2609085-2609178 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017580_6 3091112-3091214 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017580_7 3222583-3222696 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017580_7 7.1|3222625|30|NZ_CP017580|CRISPRCasFinder 3222625-3222654 30 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1847567-1847596 5 0.833
NZ_CP017580_4 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder 1226615-1226646 32 NZ_CP042825 Rhizobium sp. WL3 plasmid unnamed2, complete sequence 202240-202271 9 0.719
NZ_CP017580_7 7.1|3222625|30|NZ_CP017580|CRISPRCasFinder 3222625-3222654 30 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1832059-1832088 9 0.7
NZ_CP017580_4 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder 1226615-1226646 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 2293023-2293054 10 0.688
NZ_CP017580_4 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder 1226615-1226646 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 308892-308923 10 0.688
NZ_CP017580_4 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder 1226615-1226646 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 315091-315122 10 0.688
NZ_CP017580_4 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder 1226615-1226646 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 2035946-2035977 10 0.688
NZ_CP017580_4 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder 1226615-1226646 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1859064-1859095 10 0.688
NZ_CP017580_4 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder 1226615-1226646 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1405073-1405104 10 0.688
NZ_CP017580_4 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder 1226615-1226646 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 145339-145370 10 0.688

1. spacer 7.1|3222625|30|NZ_CP017580|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.833

-gttgcgcgtgcaacggttgcgggcgcgcgg	CRISPR spacer
cgccgc-cgtgcagcggttgcgggcgcgcgc	Protospacer
 *..** ******.**************** 

2. spacer 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gcccaggccggtcccgcccgctcgagcgcccg	CRISPR spacer
tcggaagccggtcccgcccgatcgagagcagc	Protospacer
 *  *.************** ***** **   

3. spacer 7.1|3222625|30|NZ_CP017580|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.7

gttgcgcgtgcaacggttgcgggcgcgcgg	CRISPR spacer
gccccgcctgcaacggttgcgggcgtcaat	Protospacer
*.. *** *****************.  . 

4. spacer 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 10, identity: 0.688

gcccaggccggtcccgcccgctcgagcgcccg	CRISPR spacer
ttttcgtccggtcccggcggctcgagcgccgc	Protospacer
 ... * ********* * ***********  

5. spacer 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688

gcccaggccggtcccgcccgctcgagcgcccg	CRISPR spacer
ttttcgtccggtcccggcggctcgagcgccgc	Protospacer
 ... * ********* * ***********  

6. spacer 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 10, identity: 0.688

gcccaggccggtcccgcccgctcgagcgcccg	CRISPR spacer
ttttcgtccggtcccggcggctcgagcgccgc	Protospacer
 ... * ********* * ***********  

7. spacer 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688

gcccaggccggtcccgcccgctcgagcgcccg	CRISPR spacer
ttttcgtccggtcccggcggctcgagcgccgc	Protospacer
 ... * ********* * ***********  

8. spacer 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 10, identity: 0.688

gcccaggccggtcccgcccgctcgagcgcccg	CRISPR spacer
ttttcgtccggtcccggcggctcgagcgccgc	Protospacer
 ... * ********* * ***********  

9. spacer 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.688

gcccaggccggtcccgcccgctcgagcgcccg	CRISPR spacer
ttttcgtccggtcccggcggctcgagcgccgc	Protospacer
 ... * ********* * ***********  

10. spacer 4.1|1226615|32|NZ_CP017580|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.688

gcccaggccggtcccgcccgctcgagcgcccg	CRISPR spacer
ttttcgtccggtcccggcggctcgagcgccgc	Protospacer
 ... * ********* * ***********  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage