Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017858 Campylobacter jejuni strain YQ2210 plasmid pCJDM210S, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP017859 Campylobacter jejuni strain YQ2210 chromosome, complete genome 4 crisprs DEDDh,WYL,cas14j,cas2,cas1,cas9,csa3 1 2 3 0
NZ_CP017857 Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence 2 crisprs NA 0 1 0 0

Results visualization

1. NZ_CP017859
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017859_1 103961-104068 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017859_2 1003164-1003250 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017859_3 1553130-1553242 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017859_4 1568370-1568486 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP017859_1 1.1|103986|58|NZ_CP017859|CRISPRCasFinder 103986-104043 58 NZ_CP017859.1 191021-191078 0 1.0

1. spacer 1.1|103986|58|NZ_CP017859|CRISPRCasFinder matches to position: 191021-191078, mismatch: 0, identity: 1.0

aagtaaatgataatggatgtagaattaactactaatgctttaggtgatgcaaatagtt	CRISPR spacer
aagtaaatgataatggatgtagaattaactactaatgctttaggtgatgcaaatagtt	Protospacer
**********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017859_2 2.1|1003188|39|NZ_CP017859|CRISPRCasFinder 1003188-1003226 39 NZ_CP017026 Campylobacter coli plasmid pCC14983A-1, complete sequence 158391-158429 0 1.0
NZ_CP017859_2 2.1|1003188|39|NZ_CP017859|CRISPRCasFinder 1003188-1003226 39 NZ_CP044174 Campylobacter jejuni strain AR-0412 plasmid pAR-0412, complete sequence 16701-16739 0 1.0
NZ_CP017859_2 2.1|1003188|39|NZ_CP017859|CRISPRCasFinder 1003188-1003226 39 NZ_CP048772 Campylobacter jejuni strain ZS007 plasmid pCJ145K, complete sequence 107550-107588 2 0.949
NZ_CP017859_4 4.1|1568412|33|NZ_CP017859|CRISPRCasFinder 1568412-1568444 33 AP018277 Calothrix sp. NIES-4101 plasmid plasmid4 DNA, complete genome 35793-35825 10 0.697

1. spacer 2.1|1003188|39|NZ_CP017859|CRISPRCasFinder matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 0, identity: 1.0

gatgggaagggggaggaagcgataacaaacaaccaccaa	CRISPR spacer
gatgggaagggggaggaagcgataacaaacaaccaccaa	Protospacer
***************************************

2. spacer 2.1|1003188|39|NZ_CP017859|CRISPRCasFinder matches to NZ_CP044174 (Campylobacter jejuni strain AR-0412 plasmid pAR-0412, complete sequence) position: , mismatch: 0, identity: 1.0

gatgggaagggggaggaagcgataacaaacaaccaccaa	CRISPR spacer
gatgggaagggggaggaagcgataacaaacaaccaccaa	Protospacer
***************************************

3. spacer 2.1|1003188|39|NZ_CP017859|CRISPRCasFinder matches to NZ_CP048772 (Campylobacter jejuni strain ZS007 plasmid pCJ145K, complete sequence) position: , mismatch: 2, identity: 0.949

gatgggaagggggaggaagcgataacaaacaaccaccaa	CRISPR spacer
gatgggaagggataggaagcgataacaaacaaccaccaa	Protospacer
***********. **************************

4. spacer 4.1|1568412|33|NZ_CP017859|CRISPRCasFinder matches to AP018277 (Calothrix sp. NIES-4101 plasmid plasmid4 DNA, complete genome) position: , mismatch: 10, identity: 0.697

aatgctaaaacaaagtaagtaaatgataatgga	CRISPR spacer
ccatctaaaaccaagtaagtcaatgataaaaac	Protospacer
    ******* ******** ******** .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 451481 : 455708 7 Campylobacter_phage(100.0%) NA NA
DBSCAN-SWA_2 920122 : 993677 53 Phaeocystis_globosa_virus(20.0%) tRNA,integrase,protease,plate attL 922751:922769|attR 1000971:1000989
DBSCAN-SWA_3 1430534 : 1444969 17 Synechococcus_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP017857
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017857_1 20842-20940 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017857_2 21156-21221 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017857_1 1.1|20867|48|NZ_CP017857|CRISPRCasFinder 20867-20914 48 NZ_CP022078 Campylobacter jejuni strain FDAARGOS_265 plasmid unnamed1, complete sequence 956-1003 0 1.0
NZ_CP017857_1 1.1|20867|48|NZ_CP017857|CRISPRCasFinder 20867-20914 48 NZ_CP045046 Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence 18715-18762 0 1.0
NZ_CP017857_1 1.1|20867|48|NZ_CP017857|CRISPRCasFinder 20867-20914 48 NZ_CP017857 Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence 20867-20914 0 1.0
NZ_CP017857_1 1.1|20867|48|NZ_CP017857|CRISPRCasFinder 20867-20914 48 NZ_CP017854 Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence 3962-4009 0 1.0
NZ_CP017857_1 1.1|20867|48|NZ_CP017857|CRISPRCasFinder 20867-20914 48 NZ_CP028186 Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence 37797-37844 0 1.0
NZ_CP017857_1 1.1|20867|48|NZ_CP017857|CRISPRCasFinder 20867-20914 48 CP013735 Campylobacter coli strain OR12 plasmid pOR12TET, complete sequence 3665-3712 0 1.0
NZ_CP017857_1 1.1|20867|48|NZ_CP017857|CRISPRCasFinder 20867-20914 48 CP047483 Campylobacter jejuni strain CFSAN096297 plasmid CFSAN096297, complete sequence 46123-46170 0 1.0
NZ_CP017857_1 1.1|20867|48|NZ_CP017857|CRISPRCasFinder 20867-20914 48 NZ_CP044170 Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence 19101-19148 0 1.0
NZ_CP017857_1 1.1|20867|48|NZ_CP017857|CRISPRCasFinder 20867-20914 48 NZ_MK541987 Campylobacter coli strain CVM N46788F plasmid pN46788F, complete sequence 22344-22391 0 1.0

1. spacer 1.1|20867|48|NZ_CP017857|CRISPRCasFinder matches to NZ_CP022078 (Campylobacter jejuni strain FDAARGOS_265 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

2. spacer 1.1|20867|48|NZ_CP017857|CRISPRCasFinder matches to NZ_CP045046 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

3. spacer 1.1|20867|48|NZ_CP017857|CRISPRCasFinder matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

4. spacer 1.1|20867|48|NZ_CP017857|CRISPRCasFinder matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

5. spacer 1.1|20867|48|NZ_CP017857|CRISPRCasFinder matches to NZ_CP028186 (Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

6. spacer 1.1|20867|48|NZ_CP017857|CRISPRCasFinder matches to CP013735 (Campylobacter coli strain OR12 plasmid pOR12TET, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

7. spacer 1.1|20867|48|NZ_CP017857|CRISPRCasFinder matches to CP047483 (Campylobacter jejuni strain CFSAN096297 plasmid CFSAN096297, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

8. spacer 1.1|20867|48|NZ_CP017857|CRISPRCasFinder matches to NZ_CP044170 (Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

9. spacer 1.1|20867|48|NZ_CP017857|CRISPRCasFinder matches to NZ_MK541987 (Campylobacter coli strain CVM N46788F plasmid pN46788F, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage