Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016314 Thermus brockianus strain GE-1 plasmid pTB2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP016312 Thermus brockianus strain GE-1 chromosome, complete genome 2 crisprs Cas9_archaeal,cas3,DEDDh 0 0 0 0
NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 7 crisprs cas6,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,csx1,cas2,cas1,cmr3gr5,cmr1gr7,cmr4gr7,cmr5gr11,cmr6gr7,cas4,cas3,cas3HD,cas8b1,cas7,cas5,cas8c,cas7b,WYL,cas8e,cse2gr11,cas6e,csa3 0 133 0 0

Results visualization

1. NZ_CP016312
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016312_1 1443256-1443979 Orphan III-A
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016312_2 1713219-1714218 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP016313
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016313_1 32232-32792 TypeIII III-A
7 spacers
cas2,csx1,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6,cas1,cmr3gr5,cmr1gr7,cmr4gr7,cmr5gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016313_2 46134-46848 TypeIII NA
10 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr1gr7,cmr3gr5,cas10,csx1,cas1,cas4,cas3,cas3HD,cas6,cas8b1,cas7,cas5,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016313_3 55531-56445 TypeIII NA
13 spacers
cas2,cas5,cas7,cas8b1,cas6,cas3HD,cas3,cas4,cas1,cmr6gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016313_4 82781-82870 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016313_5 134393-135022 TypeI-C,TypeI-U I-C,III-B
8 spacers
cas2,cas1,cas4,cas7b,cas8c,cas5,cas3,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016313_6 251952-253500 TypeI-E I-E,II-B
25 spacers
WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016313_7 263194-264862 TypeI-E I-E,II-B
27 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016313_1 1.1|32268|39|NZ_CP016313|CRISPRCasFinder,CRT 32268-32306 39 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32268-32306 0 1.0
NZ_CP016313_1 1.2|32343|37|NZ_CP016313|CRISPRCasFinder,CRT 32343-32379 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32343-32379 0 1.0
NZ_CP016313_1 1.3|32416|39|NZ_CP016313|CRISPRCasFinder,CRT 32416-32454 39 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32416-32454 0 1.0
NZ_CP016313_1 1.4|32491|42|NZ_CP016313|CRISPRCasFinder,CRT 32491-32532 42 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32491-32532 0 1.0
NZ_CP016313_1 1.5|32569|38|NZ_CP016313|CRISPRCasFinder,CRT 32569-32606 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32569-32606 0 1.0
NZ_CP016313_1 1.6|32643|37|NZ_CP016313|CRISPRCasFinder,CRT 32643-32679 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32643-32679 0 1.0
NZ_CP016313_1 1.7|32716|41|NZ_CP016313|CRISPRCasFinder,CRT 32716-32756 41 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32716-32756 0 1.0
NZ_CP016313_1 1.8|32268|43|NZ_CP016313|PILER-CR 32268-32310 43 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32268-32310 0 1.0
NZ_CP016313_1 1.9|32343|41|NZ_CP016313|PILER-CR 32343-32383 41 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32343-32383 0 1.0
NZ_CP016313_1 1.10|32416|43|NZ_CP016313|PILER-CR 32416-32458 43 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32416-32458 0 1.0
NZ_CP016313_1 1.11|32491|46|NZ_CP016313|PILER-CR 32491-32536 46 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32491-32536 0 1.0
NZ_CP016313_1 1.12|32569|42|NZ_CP016313|PILER-CR 32569-32610 42 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32569-32610 0 1.0
NZ_CP016313_1 1.13|32643|41|NZ_CP016313|PILER-CR 32643-32683 41 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32643-32683 0 1.0
NZ_CP016313_1 1.14|32716|45|NZ_CP016313|PILER-CR 32716-32760 45 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 32716-32760 0 1.0
NZ_CP016313_2 2.1|46164|38|NZ_CP016313|CRISPRCasFinder,CRT 46164-46201 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46164-46201 0 1.0
NZ_CP016313_2 2.2|46232|37|NZ_CP016313|CRISPRCasFinder,CRT 46232-46268 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46232-46268 0 1.0
NZ_CP016313_2 2.3|46299|40|NZ_CP016313|CRISPRCasFinder,CRT 46299-46338 40 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46299-46338 0 1.0
NZ_CP016313_2 2.4|46369|38|NZ_CP016313|CRISPRCasFinder,CRT 46369-46406 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46369-46406 0 1.0
NZ_CP016313_2 2.5|46437|38|NZ_CP016313|CRISPRCasFinder,CRT 46437-46474 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46437-46474 0 1.0
NZ_CP016313_2 2.6|46505|38|NZ_CP016313|CRISPRCasFinder,CRT 46505-46542 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46505-46542 0 1.0
NZ_CP016313_2 2.7|46573|36|NZ_CP016313|CRISPRCasFinder,CRT 46573-46608 36 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46573-46608 0 1.0
NZ_CP016313_2 2.7|46573|36|NZ_CP016313|CRISPRCasFinder,CRT 46573-46608 36 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 56041-56076 0 1.0
NZ_CP016313_2 2.8|46639|43|NZ_CP016313|CRISPRCasFinder,CRT 46639-46681 43 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46639-46681 0 1.0
NZ_CP016313_2 2.9|46712|40|NZ_CP016313|CRISPRCasFinder,CRT 46712-46751 40 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46712-46751 0 1.0
NZ_CP016313_2 2.10|46782|37|NZ_CP016313|CRISPRCasFinder,CRT 46782-46818 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46782-46818 0 1.0
NZ_CP016313_2 2.11|46166|38|NZ_CP016313|PILER-CR 46166-46203 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46164-46201 0 1.0
NZ_CP016313_2 2.12|46234|37|NZ_CP016313|PILER-CR 46234-46270 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46232-46268 0 1.0
NZ_CP016313_2 2.13|46301|40|NZ_CP016313|PILER-CR 46301-46340 40 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46299-46338 0 1.0
NZ_CP016313_2 2.14|46371|38|NZ_CP016313|PILER-CR 46371-46408 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46369-46406 0 1.0
NZ_CP016313_2 2.15|46439|38|NZ_CP016313|PILER-CR 46439-46476 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46437-46474 0 1.0
NZ_CP016313_2 2.16|46507|38|NZ_CP016313|PILER-CR 46507-46544 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46505-46542 0 1.0
NZ_CP016313_2 2.17|46575|36|NZ_CP016313|PILER-CR 46575-46610 36 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46573-46608 0 1.0
NZ_CP016313_2 2.17|46575|36|NZ_CP016313|PILER-CR 46575-46610 36 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 56041-56076 0 1.0
NZ_CP016313_2 2.18|46641|43|NZ_CP016313|PILER-CR 46641-46683 43 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46639-46681 0 1.0
NZ_CP016313_2 2.19|46714|40|NZ_CP016313|PILER-CR 46714-46753 40 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46712-46751 0 1.0
NZ_CP016313_2 2.20|46784|37|NZ_CP016313|PILER-CR 46784-46820 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46782-46818 0 1.0
NZ_CP016313_3 3.1|55561|39|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 55561-55599 39 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 55561-55599 0 1.0
NZ_CP016313_3 3.2|55630|38|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 55630-55667 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 55630-55667 0 1.0
NZ_CP016313_3 3.3|55698|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 55698-55733 36 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 55698-55733 0 1.0
NZ_CP016313_3 3.4|55764|40|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 55764-55803 40 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 55764-55803 0 1.0
NZ_CP016313_3 3.5|55834|38|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 55834-55871 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 55834-55871 0 1.0
NZ_CP016313_3 3.6|55902|40|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 55902-55941 40 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 55902-55941 0 1.0
NZ_CP016313_3 3.7|55972|39|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 55972-56010 39 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 55972-56010 0 1.0
NZ_CP016313_3 3.8|56041|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 56041-56076 36 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 46573-46608 0 1.0
NZ_CP016313_3 3.8|56041|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 56041-56076 36 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 56041-56076 0 1.0
NZ_CP016313_3 3.9|56107|37|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 56107-56143 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 56107-56143 0 1.0
NZ_CP016313_3 3.10|56174|39|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 56174-56212 39 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 56174-56212 0 1.0
NZ_CP016313_3 3.11|56243|40|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 56243-56282 40 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 56243-56282 0 1.0
NZ_CP016313_3 3.12|56313|38|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 56313-56350 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 56313-56350 0 1.0
NZ_CP016313_3 3.13|56381|35|NZ_CP016313|CRT 56381-56415 35 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 56381-56415 0 1.0
NZ_CP016313_4 4.1|82810|32|NZ_CP016313|CRISPRCasFinder 82810-82841 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 82810-82841 0 1.0
NZ_CP016313_5 5.1|134430|37|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 134430-134466 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 134430-134466 0 1.0
NZ_CP016313_5 5.2|134504|41|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 134504-134544 41 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 134504-134544 0 1.0
NZ_CP016313_5 5.3|134582|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 134582-134617 36 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 134582-134617 0 1.0
NZ_CP016313_5 5.4|134655|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 134655-134690 36 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 134655-134690 0 1.0
NZ_CP016313_5 5.5|134728|35|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 134728-134762 35 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 134728-134762 0 1.0
NZ_CP016313_5 5.6|134800|37|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 134800-134836 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 134800-134836 0 1.0
NZ_CP016313_5 5.7|134874|38|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 134874-134911 38 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 134874-134911 0 1.0
NZ_CP016313_5 5.8|134949|37|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT 134949-134985 37 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 134949-134985 0 1.0
NZ_CP016313_6 6.1|251981|32|NZ_CP016313|CRISPRCasFinder,CRT 251981-252012 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 251981-252012 0 1.0
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252042-252073 0 1.0
NZ_CP016313_6 6.3|252103|32|NZ_CP016313|CRISPRCasFinder,CRT 252103-252134 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252103-252134 0 1.0
NZ_CP016313_6 6.4|252164|32|NZ_CP016313|CRISPRCasFinder,CRT 252164-252195 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252164-252195 0 1.0
NZ_CP016313_6 6.5|252225|32|NZ_CP016313|CRISPRCasFinder,CRT 252225-252256 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252225-252256 0 1.0
NZ_CP016313_6 6.6|252286|32|NZ_CP016313|CRISPRCasFinder,CRT 252286-252317 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252286-252317 0 1.0
NZ_CP016313_6 6.7|252347|31|NZ_CP016313|CRISPRCasFinder,CRT 252347-252377 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252347-252377 0 1.0
NZ_CP016313_6 6.8|252407|32|NZ_CP016313|CRISPRCasFinder,CRT 252407-252438 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252407-252438 0 1.0
NZ_CP016313_6 6.9|252468|33|NZ_CP016313|CRISPRCasFinder,CRT 252468-252500 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252468-252500 0 1.0
NZ_CP016313_6 6.10|252530|32|NZ_CP016313|CRISPRCasFinder,CRT 252530-252561 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252530-252561 0 1.0
NZ_CP016313_6 6.11|252591|32|NZ_CP016313|CRISPRCasFinder,CRT 252591-252622 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252591-252622 0 1.0
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252652-252683 0 1.0
NZ_CP016313_6 6.13|252713|31|NZ_CP016313|CRISPRCasFinder,CRT 252713-252743 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252713-252743 0 1.0
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252773-252803 0 1.0
NZ_CP016313_6 6.15|252833|32|NZ_CP016313|CRISPRCasFinder,CRT 252833-252864 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252833-252864 0 1.0
NZ_CP016313_6 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT 252894-252924 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252894-252924 0 1.0
NZ_CP016313_6 6.17|252954|32|NZ_CP016313|CRISPRCasFinder,CRT 252954-252985 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252954-252985 0 1.0
NZ_CP016313_6 6.18|253015|32|NZ_CP016313|CRISPRCasFinder,CRT 253015-253046 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253015-253046 0 1.0
NZ_CP016313_6 6.19|253076|32|NZ_CP016313|CRISPRCasFinder,CRT 253076-253107 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253076-253107 0 1.0
NZ_CP016313_6 6.20|253137|32|NZ_CP016313|CRISPRCasFinder,CRT 253137-253168 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253137-253168 0 1.0
NZ_CP016313_6 6.21|253198|32|NZ_CP016313|CRISPRCasFinder,CRT 253198-253229 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253198-253229 0 1.0
NZ_CP016313_6 6.22|253259|32|NZ_CP016313|CRISPRCasFinder,CRT 253259-253290 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253259-253290 0 1.0
NZ_CP016313_6 6.23|253320|31|NZ_CP016313|CRISPRCasFinder,CRT 253320-253350 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253320-253350 0 1.0
NZ_CP016313_6 6.24|253380|32|NZ_CP016313|CRISPRCasFinder,CRT 253380-253411 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253380-253411 0 1.0
NZ_CP016313_6 6.25|253441|31|NZ_CP016313|CRISPRCasFinder,CRT 253441-253471 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253441-253471 0 1.0
NZ_CP016313_6 6.26|251982|33|NZ_CP016313|PILER-CR 251982-252014 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 251981-252013 0 1.0
NZ_CP016313_6 6.27|252043|33|NZ_CP016313|PILER-CR 252043-252075 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252042-252074 0 1.0
NZ_CP016313_6 6.28|252104|33|NZ_CP016313|PILER-CR 252104-252136 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252103-252135 0 1.0
NZ_CP016313_6 6.29|252165|33|NZ_CP016313|PILER-CR 252165-252197 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252164-252196 0 1.0
NZ_CP016313_6 6.30|252226|33|NZ_CP016313|PILER-CR 252226-252258 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252225-252257 0 1.0
NZ_CP016313_6 6.31|252287|33|NZ_CP016313|PILER-CR 252287-252319 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252286-252318 0 1.0
NZ_CP016313_6 6.32|252348|32|NZ_CP016313|PILER-CR 252348-252379 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252347-252378 0 1.0
NZ_CP016313_6 6.33|252408|33|NZ_CP016313|PILER-CR 252408-252440 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252407-252439 0 1.0
NZ_CP016313_6 6.34|252469|34|NZ_CP016313|PILER-CR 252469-252502 34 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252468-252501 0 1.0
NZ_CP016313_6 6.35|252531|33|NZ_CP016313|PILER-CR 252531-252563 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252530-252562 0 1.0
NZ_CP016313_6 6.36|252592|33|NZ_CP016313|PILER-CR 252592-252624 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252591-252623 0 1.0
NZ_CP016313_6 6.37|252653|33|NZ_CP016313|PILER-CR 252653-252685 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252652-252684 0 1.0
NZ_CP016313_6 6.38|252714|32|NZ_CP016313|PILER-CR 252714-252745 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252713-252744 0 1.0
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252773-252804 0 1.0
NZ_CP016313_6 6.40|252834|33|NZ_CP016313|PILER-CR 252834-252866 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252833-252865 0 1.0
NZ_CP016313_6 6.41|252895|32|NZ_CP016313|PILER-CR 252895-252926 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252894-252925 0 1.0
NZ_CP016313_6 6.42|252955|33|NZ_CP016313|PILER-CR 252955-252987 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 252954-252986 0 1.0
NZ_CP016313_6 6.43|253016|33|NZ_CP016313|PILER-CR 253016-253048 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253015-253047 0 1.0
NZ_CP016313_6 6.44|253077|33|NZ_CP016313|PILER-CR 253077-253109 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253076-253108 0 1.0
NZ_CP016313_6 6.45|253138|33|NZ_CP016313|PILER-CR 253138-253170 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253137-253169 0 1.0
NZ_CP016313_6 6.46|253199|33|NZ_CP016313|PILER-CR 253199-253231 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253198-253230 0 1.0
NZ_CP016313_6 6.47|253260|33|NZ_CP016313|PILER-CR 253260-253292 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253259-253291 0 1.0
NZ_CP016313_6 6.48|253321|32|NZ_CP016313|PILER-CR 253321-253352 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253320-253351 0 1.0
NZ_CP016313_6 6.49|253381|33|NZ_CP016313|PILER-CR 253381-253413 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253380-253412 0 1.0
NZ_CP016313_6 6.50|253442|32|NZ_CP016313|PILER-CR 253442-253473 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 253441-253472 0 1.0
NZ_CP016313_7 7.1|263223|31|NZ_CP016313|CRISPRCasFinder,CRT 263223-263253 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263223-263253 0 1.0
NZ_CP016313_7 7.2|263283|32|NZ_CP016313|CRISPRCasFinder,CRT 263283-263314 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263283-263314 0 1.0
NZ_CP016313_7 7.3|263344|31|NZ_CP016313|CRISPRCasFinder,CRT 263344-263374 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263344-263374 0 1.0
NZ_CP016313_7 7.4|263404|32|NZ_CP016313|CRISPRCasFinder,CRT 263404-263435 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263404-263435 0 1.0
NZ_CP016313_7 7.5|263465|31|NZ_CP016313|CRISPRCasFinder,CRT 263465-263495 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263465-263495 0 1.0
NZ_CP016313_7 7.6|263525|31|NZ_CP016313|CRISPRCasFinder,CRT 263525-263555 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263525-263555 0 1.0
NZ_CP016313_7 7.7|263585|32|NZ_CP016313|CRISPRCasFinder,CRT 263585-263616 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263585-263616 0 1.0
NZ_CP016313_7 7.8|263646|32|NZ_CP016313|CRISPRCasFinder,CRT 263646-263677 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263646-263677 0 1.0
NZ_CP016313_7 7.9|263707|31|NZ_CP016313|CRISPRCasFinder,CRT 263707-263737 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263707-263737 0 1.0
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263767-263797 0 1.0
NZ_CP016313_7 7.11|263827|32|NZ_CP016313|CRISPRCasFinder,CRT 263827-263858 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263827-263858 0 1.0
NZ_CP016313_7 7.12|263888|32|NZ_CP016313|CRISPRCasFinder,CRT 263888-263919 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263888-263919 0 1.0
NZ_CP016313_7 7.13|263949|32|NZ_CP016313|CRISPRCasFinder,CRT 263949-263980 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 263949-263980 0 1.0
NZ_CP016313_7 7.14|264010|32|NZ_CP016313|CRISPRCasFinder,CRT 264010-264041 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264010-264041 0 1.0
NZ_CP016313_7 7.15|264071|32|NZ_CP016313|CRISPRCasFinder,CRT 264071-264102 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264071-264102 0 1.0
NZ_CP016313_7 7.16|264132|32|NZ_CP016313|CRISPRCasFinder,CRT 264132-264163 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264132-264163 0 1.0
NZ_CP016313_7 7.17|264193|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264193-264224 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264193-264224 0 1.0
NZ_CP016313_7 7.18|264254|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264254-264285 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264254-264285 0 1.0
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264315-264346 0 1.0
NZ_CP016313_7 7.20|264376|33|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264376-264408 33 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264376-264408 0 1.0
NZ_CP016313_7 7.21|264438|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264438-264469 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264438-264469 0 1.0
NZ_CP016313_7 7.22|264499|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264499-264530 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264499-264530 0 1.0
NZ_CP016313_7 7.23|264560|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264560-264591 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264560-264591 0 1.0
NZ_CP016313_7 7.24|264621|31|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264621-264651 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264621-264651 0 1.0
NZ_CP016313_7 7.25|264681|31|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264681-264711 31 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264681-264711 0 1.0
NZ_CP016313_7 7.26|264741|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264741-264772 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264741-264772 0 1.0
NZ_CP016313_7 7.27|264802|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264802-264833 32 NZ_CP016313 Thermus brockianus strain GE-1 plasmid pTB1, complete sequence 264802-264833 0 1.0
NZ_CP016313_7 7.1|263223|31|NZ_CP016313|CRISPRCasFinder,CRT 263223-263253 31 MH673671 Thermus phage phiKo, complete genome 1549-1579 1 0.968
NZ_CP016313_6 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT 252894-252924 31 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1616229-1616259 5 0.839
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 10803-10833 6 0.806
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP029341 Streptomyces sp. SM17 plasmid pSM17C, complete sequence 8971-9001 6 0.806
NZ_CP016313_6 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT 252894-252924 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 425441-425471 6 0.806
NZ_CP016313_6 6.24|253380|32|NZ_CP016313|CRISPRCasFinder,CRT 253380-253411 32 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 304926-304957 6 0.812
NZ_CP016313_6 6.24|253380|32|NZ_CP016313|CRISPRCasFinder,CRT 253380-253411 32 NZ_CP031159 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence 283563-283594 6 0.812
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 LN997845 Streptomyces reticuli genome assembly TUE45, plasmid : IV 10803-10834 6 0.812
NZ_CP016313_6 6.41|252895|32|NZ_CP016313|PILER-CR 252895-252926 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1616229-1616260 6 0.812
NZ_CP016313_6 6.49|253381|33|NZ_CP016313|PILER-CR 253381-253413 33 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 304925-304957 6 0.818
NZ_CP016313_6 6.49|253381|33|NZ_CP016313|PILER-CR 253381-253413 33 NZ_CP031159 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence 283562-283594 6 0.818
NZ_CP016313_7 7.8|263646|32|NZ_CP016313|CRISPRCasFinder,CRT 263646-263677 32 NZ_CP031226 Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence 123459-123490 6 0.812
NZ_CP016313_7 7.21|264438|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264438-264469 32 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 30014-30045 6 0.812
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 611801-611832 7 0.781
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 3516-3547 7 0.781
NZ_CP016313_6 6.11|252591|32|NZ_CP016313|CRISPRCasFinder,CRT 252591-252622 32 MF668280 Mycobacterium phage Phabba, complete genome 60301-60332 7 0.781
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 86328-86359 7 0.781
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1160635-1160665 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1190635-1190665 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 596296-596326 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 347450-347480 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1358385-1358415 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 547331-547361 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1191195-1191225 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 917794-917824 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 892731-892761 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1563941-1563971 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 892709-892739 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 488203-488233 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 481080-481110 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 481080-481110 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1470617-1470647 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1620361-1620391 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1472829-1472859 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1572255-1572285 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1525961-1525991 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1393084-1393114 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 55353-55383 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1545621-1545651 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1552611-1552641 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1572252-1572282 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1724807-1724837 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1290971-1291001 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1295579-1295609 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1572253-1572283 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1850713-1850743 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1470279-1470309 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 548079-548109 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1990503-1990533 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1553072-1553102 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1262729-1262759 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1479131-1479161 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1509856-1509886 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1392106-1392136 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1436643-1436673 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1436634-1436664 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1475861-1475891 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1654080-1654110 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1393076-1393106 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1392429-1392459 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1393067-1393097 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1438628-1438658 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1475390-1475420 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1564552-1564582 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1654047-1654077 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1530057-1530087 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1563276-1563306 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1652841-1652871 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1552633-1552663 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1466343-1466373 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1530369-1530399 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1563276-1563306 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1478795-1478825 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1282072-1282102 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1652877-1652907 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1530057-1530087 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1422741-1422771 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1470771-1470801 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1466989-1467019 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1529260-1529290 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1563276-1563306 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1563276-1563306 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1563276-1563306 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1652877-1652907 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1652866-1652896 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1466365-1466395 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1470671-1470701 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1470752-1470782 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1451322-1451352 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1504268-1504298 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1543458-1543488 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1560591-1560621 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1652866-1652896 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1466365-1466395 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1530368-1530398 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1567073-1567103 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1653867-1653897 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1466365-1466395 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1466365-1466395 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1652877-1652907 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1563279-1563309 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1652888-1652918 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1652689-1652719 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1470735-1470765 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 273424-273454 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 383125-383155 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 333173-333203 7 0.774
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 389713-389743 7 0.774
NZ_CP016313_6 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT 252894-252924 31 GU936714 Synechococcus phage S-CBS2, complete genome 56509-56539 7 0.774
NZ_CP016313_6 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT 252894-252924 31 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1190494-1190524 7 0.774
NZ_CP016313_6 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT 252894-252924 31 KR063280 Gordonia phage GMA6, complete genome 2774-2804 7 0.774
NZ_CP016313_6 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT 252894-252924 31 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 277253-277283 7 0.774
NZ_CP016313_6 6.17|252954|32|NZ_CP016313|CRISPRCasFinder,CRT 252954-252985 32 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 975596-975627 7 0.781
NZ_CP016313_6 6.28|252104|33|NZ_CP016313|PILER-CR 252104-252136 33 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 61027-61059 7 0.788
NZ_CP016313_6 6.36|252592|33|NZ_CP016313|PILER-CR 252592-252624 33 MF668280 Mycobacterium phage Phabba, complete genome 60300-60332 7 0.788
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP029341 Streptomyces sp. SM17 plasmid pSM17C, complete sequence 8971-9002 7 0.781
NZ_CP016313_6 6.41|252895|32|NZ_CP016313|PILER-CR 252895-252926 32 GU936714 Synechococcus phage S-CBS2, complete genome 56509-56540 7 0.781
NZ_CP016313_6 6.41|252895|32|NZ_CP016313|PILER-CR 252895-252926 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 425441-425472 7 0.781
NZ_CP016313_6 6.41|252895|32|NZ_CP016313|PILER-CR 252895-252926 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 277252-277283 7 0.781
NZ_CP016313_6 6.42|252955|33|NZ_CP016313|PILER-CR 252955-252987 33 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 975596-975628 7 0.788
NZ_CP016313_7 7.1|263223|31|NZ_CP016313|CRISPRCasFinder,CRT 263223-263253 31 NC_049850 Burkholderia phage BcepSaruman, complete genome 240744-240774 7 0.774
NZ_CP016313_7 7.6|263525|31|NZ_CP016313|CRISPRCasFinder,CRT 263525-263555 31 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 780978-781008 7 0.774
NZ_CP016313_7 7.6|263525|31|NZ_CP016313|CRISPRCasFinder,CRT 263525-263555 31 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 281913-281943 7 0.774
NZ_CP016313_7 7.9|263707|31|NZ_CP016313|CRISPRCasFinder,CRT 263707-263737 31 NZ_CP033036 Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence 145367-145397 7 0.774
NZ_CP016313_7 7.9|263707|31|NZ_CP016313|CRISPRCasFinder,CRT 263707-263737 31 NC_003064 Agrobacterium fabrum str. C58 plasmid At, complete sequence 59585-59615 7 0.774
NZ_CP016313_7 7.9|263707|31|NZ_CP016313|CRISPRCasFinder,CRT 263707-263737 31 NZ_CP033024 Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence 131831-131861 7 0.774
NZ_CP016313_6 6.1|251981|32|NZ_CP016313|CRISPRCasFinder,CRT 251981-252012 32 NZ_AP018559 Hydrogenophilus thermoluteolus strain TH-1 plasmid pTH1, complete sequence 58821-58852 8 0.75
NZ_CP016313_6 6.4|252164|32|NZ_CP016313|CRISPRCasFinder,CRT 252164-252195 32 MG925349 Mycobacterium phage Mendokysei, complete genome 17357-17388 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1324327-1324358 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 865278-865309 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1307761-1307792 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 761710-761741 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1910137-1910168 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 511146-511177 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1382771-1382802 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1390071-1390102 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1561590-1561621 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1137655-1137686 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1685298-1685329 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1306586-1306617 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1357223-1357254 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1737499-1737530 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1811690-1811721 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1390228-1390259 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1497270-1497301 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1099907-1099938 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1313875-1313906 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1349341-1349372 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1310601-1310632 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1500764-1500795 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1727255-1727286 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1276619-1276650 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 678968-678999 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1401692-1401723 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1500731-1500762 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1364649-1364680 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1400949-1400980 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1499525-1499556 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1299986-1300017 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1364649-1364680 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1400949-1400980 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1499561-1499592 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1364649-1364680 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1300008-1300039 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1364653-1364684 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1400949-1400980 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1400949-1400980 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1400949-1400980 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1499561-1499592 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 653429-653460 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1499550-1499581 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1300008-1300039 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1307843-1307874 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1288504-1288535 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1340470-1340501 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1380623-1380654 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 784211-784242 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1499550-1499581 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1300008-1300039 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1364648-1364679 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1399273-1399304 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1500551-1500582 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1300008-1300039 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1300008-1300039 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1499561-1499592 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1400952-1400983 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 641688-641719 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1499572-1499603 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1499373-1499404 8 0.75
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 641688-641719 8 0.75
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 476636-476666 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 6595-6625 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP035513 Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence 96705-96735 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP026653 Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence 6430-6460 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 463945-463975 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 566444-566474 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2479427-2479457 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH509442 Mycobacterium phage Aminay, complete genome 36998-37028 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MK937601 Gordonia phage Charming, complete genome 16932-16962 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH976519 Gordonia phage Tangent, complete genome 16932-16962 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH976510 Gordonia phage Fosterous, complete genome 17821-17851 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH153809 Gordonia phage Sitar, complete genome 19116-19146 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH976518 Gordonia phage Stultus, complete genome 17727-17757 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH479924 Gordonia phage Rofo, complete genome 17931-17961 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MK937594 Gordonia phage Galadriel, complete genome 17671-17701 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MN329673 Gordonia phage Jabberwocky, complete genome 17792-17822 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MT723934 Gordonia phage Love, complete genome 17991-18021 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH651166 Gordonia phage Angelicage, complete genome 18566-18596 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MT639640 Gordonia phage Paries, complete genome 17679-17709 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MK977702 Gordonia terrae phage McKinley, complete genome 18017-18047 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_042108 Gordonia phage Brandonk123, complete genome 17622-17652 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH976514 Gordonia phage Nordenberg, complete genome 16311-16341 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH976508 Gordonia phage Bibwit, complete genome 18308-18338 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH976506 Gordonia phage Affeca, complete genome 18143-18173 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MN329677 Gordonia phage Keitabear, complete genome 20013-20043 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_042045 Gordonia phage Lennon, complete genome 19116-19146 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH976507 Gordonia phage Ailee, complete genome 18057-18087 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MT498035 Gordonia Phage Barsten, complete genome 18073-18103 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MH976512 Gordonia phage Geodirt, complete genome 17888-17918 8 0.742
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_031239 Gordonia phage Vivi2, complete genome 18094-18124 8 0.742
NZ_CP016313_6 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT 252894-252924 31 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 543372-543402 8 0.742
NZ_CP016313_6 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT 252894-252924 31 NZ_CP023721 Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence 226683-226713 8 0.742
NZ_CP016313_6 6.19|253076|32|NZ_CP016313|CRISPRCasFinder,CRT 253076-253107 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 918416-918447 8 0.75
NZ_CP016313_6 6.19|253076|32|NZ_CP016313|CRISPRCasFinder,CRT 253076-253107 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 894708-894739 8 0.75
NZ_CP016313_6 6.27|252043|33|NZ_CP016313|PILER-CR 252043-252075 33 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 611800-611832 8 0.758
NZ_CP016313_6 6.27|252043|33|NZ_CP016313|PILER-CR 252043-252075 33 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 3515-3547 8 0.758
NZ_CP016313_6 6.37|252653|33|NZ_CP016313|PILER-CR 252653-252685 33 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 86328-86360 8 0.758
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1160634-1160665 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1470617-1470648 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1190634-1190665 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1620361-1620392 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1472829-1472860 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1572255-1572286 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1525961-1525992 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1393084-1393115 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 596295-596326 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 55353-55384 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 347449-347480 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1545621-1545652 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1358384-1358415 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1552611-1552642 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1572252-1572283 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1724807-1724838 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1290971-1291002 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1295579-1295610 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 547330-547361 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1572253-1572284 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1850713-1850744 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1470279-1470310 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1191194-1191225 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 548079-548110 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1990503-1990534 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1553072-1553103 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 917793-917824 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1262729-1262760 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1479131-1479162 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1509856-1509887 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1392106-1392137 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1436643-1436674 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1436634-1436665 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1475861-1475892 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1654080-1654111 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 892730-892761 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1393076-1393107 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1392429-1392460 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1393067-1393098 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1563940-1563971 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1438628-1438659 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1475390-1475421 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1564552-1564583 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1654047-1654078 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1530057-1530088 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1563276-1563307 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1652841-1652872 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 892708-892739 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1552633-1552664 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1466343-1466374 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1530369-1530400 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1563276-1563307 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1478795-1478826 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1282072-1282103 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1652877-1652908 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1530057-1530088 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1422741-1422772 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1470771-1470802 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1466989-1467020 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1529260-1529291 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1563276-1563307 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1563276-1563307 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1563276-1563307 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1652877-1652908 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 488202-488233 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1652866-1652897 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1466365-1466396 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1470671-1470702 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1470752-1470783 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1451322-1451353 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1504268-1504299 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1543458-1543489 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1560591-1560622 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1652866-1652897 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1466365-1466396 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1530368-1530399 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1567073-1567104 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1653867-1653898 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1466365-1466396 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1466365-1466396 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1652877-1652908 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1563279-1563310 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 481079-481110 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1652888-1652919 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1652689-1652720 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 481079-481110 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1470735-1470766 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 273423-273454 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP026653 Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence 6429-6460 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MK937601 Gordonia phage Charming, complete genome 16932-16963 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH976519 Gordonia phage Tangent, complete genome 16932-16963 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH976510 Gordonia phage Fosterous, complete genome 17821-17852 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH153809 Gordonia phage Sitar, complete genome 19116-19147 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH976518 Gordonia phage Stultus, complete genome 17727-17758 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH479924 Gordonia phage Rofo, complete genome 17931-17962 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MK937594 Gordonia phage Galadriel, complete genome 17671-17702 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MN329673 Gordonia phage Jabberwocky, complete genome 17792-17823 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MT723934 Gordonia phage Love, complete genome 17991-18022 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH651166 Gordonia phage Angelicage, complete genome 18566-18597 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MT639640 Gordonia phage Paries, complete genome 17679-17710 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MK977702 Gordonia terrae phage McKinley, complete genome 18017-18048 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NC_042108 Gordonia phage Brandonk123, complete genome 17622-17653 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH976514 Gordonia phage Nordenberg, complete genome 16311-16342 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH976508 Gordonia phage Bibwit, complete genome 18308-18339 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH976506 Gordonia phage Affeca, complete genome 18143-18174 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MN329677 Gordonia phage Keitabear, complete genome 20013-20044 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NC_042045 Gordonia phage Lennon, complete genome 19116-19147 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH976507 Gordonia phage Ailee, complete genome 18057-18088 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MT498035 Gordonia Phage Barsten, complete genome 18073-18104 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH976512 Gordonia phage Geodirt, complete genome 17888-17919 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NC_031239 Gordonia phage Vivi2, complete genome 18094-18125 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 383125-383156 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 333173-333204 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 389713-389744 8 0.75
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 55419-55450 8 0.75
NZ_CP016313_6 6.41|252895|32|NZ_CP016313|PILER-CR 252895-252926 32 NZ_CP023721 Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence 226683-226714 8 0.75
NZ_CP016313_7 7.5|263465|31|NZ_CP016313|CRISPRCasFinder,CRT 263465-263495 31 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 728776-728806 8 0.742
NZ_CP016313_7 7.8|263646|32|NZ_CP016313|CRISPRCasFinder,CRT 263646-263677 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 293696-293727 8 0.75
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NC_017643 Escherichia coli UMNK88 plasmid pUMNK88_Hly, complete sequence 48673-48703 8 0.742
NZ_CP016313_7 7.13|263949|32|NZ_CP016313|CRISPRCasFinder,CRT 263949-263980 32 MG592553 Vibrio phage 1.187.O._10N.286.49.F1, partial genome 120388-120419 8 0.75
NZ_CP016313_7 7.15|264071|32|NZ_CP016313|CRISPRCasFinder,CRT 264071-264102 32 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 852-883 8 0.75
NZ_CP016313_7 7.17|264193|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264193-264224 32 KX911187 Rathayibacter phage NCPPB3778, complete genome 24407-24438 8 0.75
NZ_CP016313_7 7.18|264254|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264254-264285 32 LR606148 Rhizobium sp. Q54 genome assembly, plasmid: 5 435270-435301 8 0.75
NZ_CP016313_4 4.1|82810|32|NZ_CP016313|CRISPRCasFinder 82810-82841 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1155048-1155079 9 0.719
NZ_CP016313_6 6.1|251981|32|NZ_CP016313|CRISPRCasFinder,CRT 251981-252012 32 MN586047 Gordonia phage EMoore, complete genome 37976-38007 9 0.719
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 473362-473393 9 0.719
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NZ_AP018829 Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence 31758-31789 9 0.719
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 61763-61794 9 0.719
NZ_CP016313_6 6.7|252347|31|NZ_CP016313|CRISPRCasFinder,CRT 252347-252377 31 MN304818 Phage 71_18, complete genome 19835-19865 9 0.71
NZ_CP016313_6 6.9|252468|33|NZ_CP016313|CRISPRCasFinder,CRT 252468-252500 33 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 223818-223850 9 0.727
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1338922-1338953 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1015294-1015325 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1478192-1478223 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1434595-1434626 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1395002-1395033 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1260731-1260762 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1015403-1015434 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1434554-1434585 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 293057-293088 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 AP021851 Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome 31227-31258 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1174075-1174106 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 668836-668867 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1434602-1434633 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1324054-1324085 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1259753-1259784 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1302383-1302414 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1302374-1302405 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1015104-1015135 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1260723-1260754 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1260077-1260108 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1260714-1260745 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1015050-1015081 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1390046-1390077 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1352353-1352384 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1163983-1164014 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1297623-1297654 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1339063-1339094 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1339045-1339076 9 0.719
NZ_CP016313_6 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT 252652-252683 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1339030-1339061 9 0.719
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 28586-28616 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 492807-492837 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 542764-542794 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 386181-386211 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 538109-538139 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 542897-542927 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_LR594664 Variovorax sp. RA8 plasmid 3 169012-169042 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 225088-225118 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 257609-257639 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 23076-23106 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP016620 Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence 42107-42137 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MN813694 Gordonia phage Opie, complete genome 19689-19719 9 0.71
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 MT740728 Ralstonia phage Anchaing, complete genome 15784-15814 9 0.71
NZ_CP016313_6 6.26|251982|33|NZ_CP016313|PILER-CR 251982-252014 33 NZ_AP018559 Hydrogenophilus thermoluteolus strain TH-1 plasmid pTH1, complete sequence 58820-58852 9 0.727
NZ_CP016313_6 6.27|252043|33|NZ_CP016313|PILER-CR 252043-252075 33 NZ_AP018829 Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence 31758-31790 9 0.727
NZ_CP016313_6 6.29|252165|33|NZ_CP016313|PILER-CR 252165-252197 33 MG925349 Mycobacterium phage Mendokysei, complete genome 17356-17388 9 0.727
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 566443-566474 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 257609-257640 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 542763-542794 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 23076-23107 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 542896-542927 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_LR594664 Variovorax sp. RA8 plasmid 3 169011-169042 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2479426-2479457 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 225087-225118 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MN813694 Gordonia phage Opie, complete genome 19689-19720 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MH509442 Mycobacterium phage Aminay, complete genome 36997-37028 9 0.719
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 MT740728 Ralstonia phage Anchaing, complete genome 15784-15815 9 0.719
NZ_CP016313_6 6.41|252895|32|NZ_CP016313|PILER-CR 252895-252926 32 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 44690-44721 9 0.719
NZ_CP016313_6 6.44|253077|33|NZ_CP016313|PILER-CR 253077-253109 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 894708-894740 9 0.727
NZ_CP016313_6 6.44|253077|33|NZ_CP016313|PILER-CR 253077-253109 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 918415-918447 9 0.727
NZ_CP016313_6 6.50|253442|32|NZ_CP016313|PILER-CR 253442-253473 32 CP054928 Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence 18441-18472 9 0.719
NZ_CP016313_7 7.5|263465|31|NZ_CP016313|CRISPRCasFinder,CRT 263465-263495 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 17210-17240 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP026794 Shigella flexneri strain 74-1170 plasmid unnamed 156600-156630 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP033511 Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence 114860-114890 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP026789 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed1, complete sequence 1259-1289 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP012138 Shigella flexneri 2a strain 981 plasmid 981p1, complete sequence 131381-131411 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP044160 Shigella flexneri strain AR-0423 plasmid pAR-0423-2, complete sequence 65-95 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NC_017319 Shigella flexneri 2002017 plasmid pSFxv_1, complete sequence 210555-210585 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP012142 Shigella flexneri 4c strain 1205 plasmid 1205p2, complete sequence 209264-209294 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP007038 Shigella flexneri G1663 plasmid pG1663, complete sequence 209780-209810 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP033634 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb3, complete sequence 12997-13027 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP020087 Shigella flexneri 1a strain 0670 plasmid unnamed1, complete sequence 80634-80664 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP020337 Shigella flexneri 4c strain 1602 plasmid unnamed1, complete sequence 174705-174735 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP020343 Shigella flexneri 1a strain 0439 plasmid unnamed1, complete sequence 131405-131435 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP045942 Shigella flexneri 2a strain AUSMDU00010535 plasmid pAUSMDU00010535_01, complete sequence 1225-1255 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NC_004851 Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence 210672-210702 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_LR213456 Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 2 177453-177483 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP044157 Shigella flexneri strain AR-0424 plasmid pAR-0424-2, complete sequence 79579-79609 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP044154 Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence 96561-96591 9 0.71
NZ_CP016313_7 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT 263767-263797 31 NZ_CP034933 Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-2, complete sequence 137237-137267 9 0.71
NZ_CP016313_7 7.13|263949|32|NZ_CP016313|CRISPRCasFinder,CRT 263949-263980 32 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 902694-902725 9 0.719
NZ_CP016313_7 7.15|264071|32|NZ_CP016313|CRISPRCasFinder,CRT 264071-264102 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 93132-93163 9 0.719
NZ_CP016313_7 7.18|264254|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264254-264285 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 115164-115195 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1705329-1705360 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 445762-445793 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 290071-290102 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1705464-1705495 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 290134-290165 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 315255-315286 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1585797-1585828 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 290080-290111 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 124363-124394 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1705022-1705053 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1704968-1704999 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 482953-482984 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1697856-1697887 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 312917-312948 9 0.719
NZ_CP016313_7 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264315-264346 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1637145-1637176 9 0.719
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 376680-376711 10 0.688
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 218597-218628 10 0.688
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 94423-94454 10 0.688
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 MK249183 Blackfly microvirus SF02 isolate 115, complete genome 1067-1098 10 0.688
NZ_CP016313_6 6.4|252164|32|NZ_CP016313|CRISPRCasFinder,CRT 252164-252195 32 NZ_CP016850 Pseudomonas sp. TMW 2.1634 plasmid pL21564-1, complete sequence 28381-28412 10 0.688
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 55420-55450 10 0.677
NZ_CP016313_6 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT 252773-252803 31 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 652901-652931 10 0.677
NZ_CP016313_6 6.32|252348|32|NZ_CP016313|PILER-CR 252348-252379 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 92979-93010 10 0.688
NZ_CP016313_6 6.32|252348|32|NZ_CP016313|PILER-CR 252348-252379 32 MN304818 Phage 71_18, complete genome 19834-19865 10 0.688
NZ_CP016313_6 6.34|252469|34|NZ_CP016313|PILER-CR 252469-252502 34 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 223818-223851 10 0.706
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 28585-28616 10 0.688
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 492807-492838 10 0.688
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 386181-386212 10 0.688
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 538108-538139 10 0.688
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NZ_CP016620 Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence 42107-42138 10 0.688
NZ_CP016313_7 7.3|263344|31|NZ_CP016313|CRISPRCasFinder,CRT 263344-263374 31 NC_049851 Burkholderia phage BcepSauron, complete genome 215235-215265 10 0.677
NZ_CP016313_7 7.26|264741|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264741-264772 32 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 476138-476169 10 0.688
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NC_005838 Thermus thermophilus HB27 plasmid pTT27, complete sequence 187956-187987 11 0.656
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1121906-1121937 11 0.656
NZ_CP016313_6 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT 252042-252073 32 MK392368 Arthrobacter phage Elesar, complete genome 12490-12521 11 0.656
NZ_CP016313_6 6.39|252774|32|NZ_CP016313|PILER-CR 252774-252805 32 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 652901-652932 11 0.656
NZ_CP016313_7 7.23|264560|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR 264560-264591 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 35067-35098 11 0.656

1. spacer 1.1|32268|39|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atggtggttggcaaaaagacatatcagggttctatagcc	CRISPR spacer
atggtggttggcaaaaagacatatcagggttctatagcc	Protospacer
***************************************

2. spacer 1.2|32343|37|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

cggttttggcggttaggcgttctagttgggaagagct	CRISPR spacer
cggttttggcggttaggcgttctagttgggaagagct	Protospacer
*************************************

3. spacer 1.3|32416|39|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gggtcctgttcgctagcggtatcggtttgcttatggttg	CRISPR spacer
gggtcctgttcgctagcggtatcggtttgcttatggttg	Protospacer
***************************************

4. spacer 1.4|32491|42|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

aagtgatagacgccttcctacaaggaaagatgggtgaaaaga	CRISPR spacer
aagtgatagacgccttcctacaaggaaagatgggtgaaaaga	Protospacer
******************************************

5. spacer 1.5|32569|38|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tagctttttggaaaaaggtggatttaccatcctggaca	CRISPR spacer
tagctttttggaaaaaggtggatttaccatcctggaca	Protospacer
**************************************

6. spacer 1.6|32643|37|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atagcaaaagcggggcggcttctatcgccctttcggt	CRISPR spacer
atagcaaaagcggggcggcttctatcgccctttcggt	Protospacer
*************************************

7. spacer 1.7|32716|41|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcgttcccggaacccccttgggcgggcgaaagacggcgggg	CRISPR spacer
tcgttcccggaacccccttgggcgggcgaaagacggcgggg	Protospacer
*****************************************

8. spacer 1.8|32268|43|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atggtggttggcaaaaagacatatcagggttctatagccgtat	CRISPR spacer
atggtggttggcaaaaagacatatcagggttctatagccgtat	Protospacer
*******************************************

9. spacer 1.9|32343|41|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

cggttttggcggttaggcgttctagttgggaagagctgtat	CRISPR spacer
cggttttggcggttaggcgttctagttgggaagagctgtat	Protospacer
*****************************************

10. spacer 1.10|32416|43|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gggtcctgttcgctagcggtatcggtttgcttatggttggtat	CRISPR spacer
gggtcctgttcgctagcggtatcggtttgcttatggttggtat	Protospacer
*******************************************

11. spacer 1.11|32491|46|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

aagtgatagacgccttcctacaaggaaagatgggtgaaaagagtat	CRISPR spacer
aagtgatagacgccttcctacaaggaaagatgggtgaaaagagtat	Protospacer
**********************************************

12. spacer 1.12|32569|42|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tagctttttggaaaaaggtggatttaccatcctggacagtat	CRISPR spacer
tagctttttggaaaaaggtggatttaccatcctggacagtat	Protospacer
******************************************

13. spacer 1.13|32643|41|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atagcaaaagcggggcggcttctatcgccctttcggtgtat	CRISPR spacer
atagcaaaagcggggcggcttctatcgccctttcggtgtat	Protospacer
*****************************************

14. spacer 1.14|32716|45|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcgttcccggaacccccttgggcgggcgaaagacggcgggggtat	CRISPR spacer
tcgttcccggaacccccttgggcgggcgaaagacggcgggggtat	Protospacer
*********************************************

15. spacer 2.1|46164|38|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gttgaggtgatcgacgaagaaggcgatgtctatgtgga	CRISPR spacer
gttgaggtgatcgacgaagaaggcgatgtctatgtgga	Protospacer
**************************************

16. spacer 2.2|46232|37|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

actagtaccagtttcccgccgaagatagttatagaag	CRISPR spacer
actagtaccagtttcccgccgaagatagttatagaag	Protospacer
*************************************

17. spacer 2.3|46299|40|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ccggtttccttatgccacgctagctttcccacatgaacat	CRISPR spacer
ccggtttccttatgccacgctagctttcccacatgaacat	Protospacer
****************************************

18. spacer 2.4|46369|38|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gccgatttccatgccaaggacattgaaggtttggtgtc	CRISPR spacer
gccgatttccatgccaaggacattgaaggtttggtgtc	Protospacer
**************************************

19. spacer 2.5|46437|38|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

acgctcatccaaaacggggcaggacgcgcccagtaaac	CRISPR spacer
acgctcatccaaaacggggcaggacgcgcccagtaaac	Protospacer
**************************************

20. spacer 2.6|46505|38|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggggccactccatgagggcgggcgcggggaaaatggcg	CRISPR spacer
ggggccactccatgagggcgggcgcggggaaaatggcg	Protospacer
**************************************

21. spacer 2.7|46573|36|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcctcacccgcaagtagtggtagacgttttcgcgaa	CRISPR spacer
tcctcacccgcaagtagtggtagacgttttcgcgaa	Protospacer
************************************

22. spacer 2.7|46573|36|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcctcacccgcaagtagtggtagacgttttcgcgaa	CRISPR spacer
tcctcacccgcaagtagtggtagacgttttcgcgaa	Protospacer
************************************

23. spacer 2.8|46639|43|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

accctggactatctcggggaaaaagaagggtaccacttccttc	CRISPR spacer
accctggactatctcggggaaaaagaagggtaccacttccttc	Protospacer
*******************************************

24. spacer 2.9|46712|40|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctagggtcttcaccctctacgagctggtggacttcttcct	CRISPR spacer
ctagggtcttcaccctctacgagctggtggacttcttcct	Protospacer
****************************************

25. spacer 2.10|46782|37|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggagttgccttccccgccgccttcgtggctgagccat	CRISPR spacer
ggagttgccttccccgccgccttcgtggctgagccat	Protospacer
*************************************

26. spacer 2.11|46166|38|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gttgaggtgatcgacgaagaaggcgatgtctatgtgga	CRISPR spacer
gttgaggtgatcgacgaagaaggcgatgtctatgtgga	Protospacer
**************************************

27. spacer 2.12|46234|37|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

actagtaccagtttcccgccgaagatagttatagaag	CRISPR spacer
actagtaccagtttcccgccgaagatagttatagaag	Protospacer
*************************************

28. spacer 2.13|46301|40|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ccggtttccttatgccacgctagctttcccacatgaacat	CRISPR spacer
ccggtttccttatgccacgctagctttcccacatgaacat	Protospacer
****************************************

29. spacer 2.14|46371|38|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gccgatttccatgccaaggacattgaaggtttggtgtc	CRISPR spacer
gccgatttccatgccaaggacattgaaggtttggtgtc	Protospacer
**************************************

30. spacer 2.15|46439|38|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

acgctcatccaaaacggggcaggacgcgcccagtaaac	CRISPR spacer
acgctcatccaaaacggggcaggacgcgcccagtaaac	Protospacer
**************************************

31. spacer 2.16|46507|38|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggggccactccatgagggcgggcgcggggaaaatggcg	CRISPR spacer
ggggccactccatgagggcgggcgcggggaaaatggcg	Protospacer
**************************************

32. spacer 2.17|46575|36|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcctcacccgcaagtagtggtagacgttttcgcgaa	CRISPR spacer
tcctcacccgcaagtagtggtagacgttttcgcgaa	Protospacer
************************************

33. spacer 2.17|46575|36|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcctcacccgcaagtagtggtagacgttttcgcgaa	CRISPR spacer
tcctcacccgcaagtagtggtagacgttttcgcgaa	Protospacer
************************************

34. spacer 2.18|46641|43|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

accctggactatctcggggaaaaagaagggtaccacttccttc	CRISPR spacer
accctggactatctcggggaaaaagaagggtaccacttccttc	Protospacer
*******************************************

35. spacer 2.19|46714|40|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctagggtcttcaccctctacgagctggtggacttcttcct	CRISPR spacer
ctagggtcttcaccctctacgagctggtggacttcttcct	Protospacer
****************************************

36. spacer 2.20|46784|37|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggagttgccttccccgccgccttcgtggctgagccat	CRISPR spacer
ggagttgccttccccgccgccttcgtggctgagccat	Protospacer
*************************************

37. spacer 3.1|55561|39|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

cccgctccaaggcatccaccacggcgtggtaggggtctt	CRISPR spacer
cccgctccaaggcatccaccacggcgtggtaggggtctt	Protospacer
***************************************

38. spacer 3.2|55630|38|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tggcgaggtcggcccgccagtagagggggagctccatg	CRISPR spacer
tggcgaggtcggcccgccagtagagggggagctccatg	Protospacer
**************************************

39. spacer 3.3|55698|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

cgcgcaaagggctgcgggctctccaggtcaaagagg	CRISPR spacer
cgcgcaaagggctgcgggctctccaggtcaaagagg	Protospacer
************************************

40. spacer 3.4|55764|40|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggggtgatggtgagctggaccccgccccccgaaaccacgg	CRISPR spacer
ggggtgatggtgagctggaccccgccccccgaaaccacgg	Protospacer
****************************************

41. spacer 3.5|55834|38|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ttccagtaggcggcttcccagatggcctcgagggcctt	CRISPR spacer
ttccagtaggcggcttcccagatggcctcgagggcctt	Protospacer
**************************************

42. spacer 3.6|55902|40|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

cttccgcatggaccaactactccaatacttggtccactat	CRISPR spacer
cttccgcatggaccaactactccaatacttggtccactat	Protospacer
****************************************

43. spacer 3.7|55972|39|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcgcgctcaggggccggcccctcgggagcatcctgctgg	CRISPR spacer
tcgcgctcaggggccggcccctcgggagcatcctgctgg	Protospacer
***************************************

44. spacer 3.8|56041|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ttcgcgaaaacgtctaccactacttgcgggtgagga	CRISPR spacer
ttcgcgaaaacgtctaccactacttgcgggtgagga	Protospacer
************************************

45. spacer 3.8|56041|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ttcgcgaaaacgtctaccactacttgcgggtgagga	CRISPR spacer
ttcgcgaaaacgtctaccactacttgcgggtgagga	Protospacer
************************************

46. spacer 3.9|56107|37|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tggggcatagggtccggggacggagaagcctccctag	CRISPR spacer
tggggcatagggtccggggacggagaagcctccctag	Protospacer
*************************************

47. spacer 3.10|56174|39|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcggtccactgatttggattaggggcagggagaagccgc	CRISPR spacer
tcggtccactgatttggattaggggcagggagaagccgc	Protospacer
***************************************

48. spacer 3.11|56243|40|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggaggatgaccccacggtgttccagatacccgatgaacgg	CRISPR spacer
ggaggatgaccccacggtgttccagatacccgatgaacgg	Protospacer
****************************************

49. spacer 3.12|56313|38|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcggggaggacgatcttcacgctccgggagggcgggta	CRISPR spacer
gcggggaggacgatcttcacgctccgggagggcgggta	Protospacer
**************************************

50. spacer 3.13|56381|35|NZ_CP016313|CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtgaggacaggggcccccgggctgggagcccggag	CRISPR spacer
gtgaggacaggggcccccgggctgggagcccggag	Protospacer
***********************************

51. spacer 4.1|82810|32|NZ_CP016313|CRISPRCasFinder matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tccggaaggtccgtgaggaagcggcctcccgt	CRISPR spacer
tccggaaggtccgtgaggaagcggcctcccgt	Protospacer
********************************

52. spacer 5.1|134430|37|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

agggtgagggcgttcaggaacccggtgacgatgcgga	CRISPR spacer
agggtgagggcgttcaggaacccggtgacgatgcgga	Protospacer
*************************************

53. spacer 5.2|134504|41|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

catcgctgaggcagcccgccgatagtgcggggctgctccag	CRISPR spacer
catcgctgaggcagcccgccgatagtgcggggctgctccag	Protospacer
*****************************************

54. spacer 5.3|134582|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctggacctctcgtgggagacggtccacggcctgggc	CRISPR spacer
ctggacctctcgtgggagacggtccacggcctgggc	Protospacer
************************************

55. spacer 5.4|134655|36|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctcatctccccggaaggggtgatggcgctagggaag	CRISPR spacer
ctcatctccccggaaggggtgatggcgctagggaag	Protospacer
************************************

56. spacer 5.5|134728|35|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctcgttttccgggagcggtgggaagacgccacctg	CRISPR spacer
ctcgttttccgggagcggtgggaagacgccacctg	Protospacer
***********************************

57. spacer 5.6|134800|37|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ttcgtcatcctctcacctccacccccacgctaccacg	CRISPR spacer
ttcgtcatcctctcacctccacccccacgctaccacg	Protospacer
*************************************

58. spacer 5.7|134874|38|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

cccaccgcctggggacagtagcccgactccacccaaac	CRISPR spacer
cccaccgcctggggacagtagcccgactccacccaaac	Protospacer
**************************************

59. spacer 5.8|134949|37|NZ_CP016313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atctccagggggcgccccacccgggacaccatccctt	CRISPR spacer
atctccagggggcgccccacccgggacaccatccctt	Protospacer
*************************************

60. spacer 6.1|251981|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

accctgcggcacattgctggggccaacctggt	CRISPR spacer
accctgcggcacattgctggggccaacctggt	Protospacer
********************************

61. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
atgaagcgccgaggccgtggcgaaggctccat	Protospacer
********************************

62. spacer 6.3|252103|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tgggggcctcctacggggcggccctggccggc	CRISPR spacer
tgggggcctcctacggggcggccctggccggc	Protospacer
********************************

63. spacer 6.4|252164|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atgttgccgtactggtcaaggtcggcccacac	CRISPR spacer
atgttgccgtactggtcaaggtcggcccacac	Protospacer
********************************

64. spacer 6.5|252225|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggataccctgatggcataaatcaaccgcaacc	CRISPR spacer
ggataccctgatggcataaatcaaccgcaacc	Protospacer
********************************

65. spacer 6.6|252286|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggcgttgacgaagaaggacccttacaaggtga	CRISPR spacer
ggcgttgacgaagaaggacccttacaaggtga	Protospacer
********************************

66. spacer 6.7|252347|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcgctatcggggtgccgttgtgggggccttt	CRISPR spacer
tcgctatcggggtgccgttgtgggggccttt	Protospacer
*******************************

67. spacer 6.8|252407|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctcctcataccccccccgaataatgccgccca	CRISPR spacer
ctcctcataccccccccgaataatgccgccca	Protospacer
********************************

68. spacer 6.9|252468|33|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

actgtctgggctaactcctgcttgatgctcatc	CRISPR spacer
actgtctgggctaactcctgcttgatgctcatc	Protospacer
*********************************

69. spacer 6.10|252530|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tctgatgagtggtcgcctattcagtgggccgc	CRISPR spacer
tctgatgagtggtcgcctattcagtgggccgc	Protospacer
********************************

70. spacer 6.11|252591|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctattggccgcattgcggaaggaaatgta	CRISPR spacer
gcgctattggccgcattgcggaaggaaatgta	Protospacer
********************************

71. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
ccagtggtggcactggtcggggccgtggctgt	Protospacer
********************************

72. spacer 6.13|252713|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atgacgcctttcagtagctggactggctgtt	CRISPR spacer
atgacgcctttcagtagctggactggctgtt	Protospacer
*******************************

73. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
gctcctcggaggtggccggcgccgcccaggt	Protospacer
*******************************

74. spacer 6.15|252833|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atggcgagtttgatgagggatatgtccatgtt	CRISPR spacer
atggcgagtttgatgagggatatgtccatgtt	Protospacer
********************************

75. spacer 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

acgacgacatggtggacgccctggtctacgc	CRISPR spacer
acgacgacatggtggacgccctggtctacgc	Protospacer
*******************************

76. spacer 6.17|252954|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

caggagagaggccacccggctcaggtcctcca	CRISPR spacer
caggagagaggccacccggctcaggtcctcca	Protospacer
********************************

77. spacer 6.18|253015|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctctttctaccctctcccacacgtcagggtac	CRISPR spacer
ctctttctaccctctcccacacgtcagggtac	Protospacer
********************************

78. spacer 6.19|253076|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gccctgcccgagcgggaggaccaccaccacgt	CRISPR spacer
gccctgcccgagcgggaggaccaccaccacgt	Protospacer
********************************

79. spacer 6.20|253137|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gatgttctcccctccgctttctccaacacgga	CRISPR spacer
gatgttctcccctccgctttctccaacacgga	Protospacer
********************************

80. spacer 6.21|253198|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgtacttctctaggagggggtgctctagtag	CRISPR spacer
ttgtacttctctaggagggggtgctctagtag	Protospacer
********************************

81. spacer 6.22|253259|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tgggtgcgttggaggaggctgcacgcggcccc	CRISPR spacer
tgggtgcgttggaggaggctgcacgcggcccc	Protospacer
********************************

82. spacer 6.23|253320|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcacctcctgaggctcctccgaggaggttcc	CRISPR spacer
gcacctcctgaggctcctccgaggaggttcc	Protospacer
*******************************

83. spacer 6.24|253380|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

acggtgagcttccccgtgcgggcgtccaccag	CRISPR spacer
acggtgagcttccccgtgcgggcgtccaccag	Protospacer
********************************

84. spacer 6.25|253441|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggatgggctcgctctgaatgatctcggggag	CRISPR spacer
ggatgggctcgctctgaatgatctcggggag	Protospacer
*******************************

85. spacer 6.26|251982|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

accctgcggcacattgctggggccaacctggtc	CRISPR spacer
accctgcggcacattgctggggccaacctggtc	Protospacer
*********************************

86. spacer 6.27|252043|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atgaagcgccgaggccgtggcgaaggctccatc	CRISPR spacer
atgaagcgccgaggccgtggcgaaggctccatc	Protospacer
*********************************

87. spacer 6.28|252104|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tgggggcctcctacggggcggccctggccggct	CRISPR spacer
tgggggcctcctacggggcggccctggccggct	Protospacer
*********************************

88. spacer 6.29|252165|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atgttgccgtactggtcaaggtcggcccacacc	CRISPR spacer
atgttgccgtactggtcaaggtcggcccacacc	Protospacer
*********************************

89. spacer 6.30|252226|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggataccctgatggcataaatcaaccgcaacct	CRISPR spacer
ggataccctgatggcataaatcaaccgcaacct	Protospacer
*********************************

90. spacer 6.31|252287|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggcgttgacgaagaaggacccttacaaggtgat	CRISPR spacer
ggcgttgacgaagaaggacccttacaaggtgat	Protospacer
*********************************

91. spacer 6.32|252348|32|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcgctatcggggtgccgttgtgggggcctttc	CRISPR spacer
tcgctatcggggtgccgttgtgggggcctttc	Protospacer
********************************

92. spacer 6.33|252408|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctcctcataccccccccgaataatgccgcccac	CRISPR spacer
ctcctcataccccccccgaataatgccgcccac	Protospacer
*********************************

93. spacer 6.34|252469|34|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

actgtctgggctaactcctgcttgatgctcatcc	CRISPR spacer
actgtctgggctaactcctgcttgatgctcatcc	Protospacer
**********************************

94. spacer 6.35|252531|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tctgatgagtggtcgcctattcagtgggccgcc	CRISPR spacer
tctgatgagtggtcgcctattcagtgggccgcc	Protospacer
*********************************

95. spacer 6.36|252592|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctattggccgcattgcggaaggaaatgtac	CRISPR spacer
gcgctattggccgcattgcggaaggaaatgtac	Protospacer
*********************************

96. spacer 6.37|252653|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ccagtggtggcactggtcggggccgtggctgta	CRISPR spacer
ccagtggtggcactggtcggggccgtggctgta	Protospacer
*********************************

97. spacer 6.38|252714|32|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atgacgcctttcagtagctggactggctgttc	CRISPR spacer
atgacgcctttcagtagctggactggctgttc	Protospacer
********************************

98. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
gctcctcggaggtggccggcgccgcccaggtc	Protospacer
********************************

99. spacer 6.40|252834|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

atggcgagtttgatgagggatatgtccatgttc	CRISPR spacer
atggcgagtttgatgagggatatgtccatgttc	Protospacer
*********************************

100. spacer 6.41|252895|32|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

acgacgacatggtggacgccctggtctacgcc	CRISPR spacer
acgacgacatggtggacgccctggtctacgcc	Protospacer
********************************

101. spacer 6.42|252955|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

caggagagaggccacccggctcaggtcctccac	CRISPR spacer
caggagagaggccacccggctcaggtcctccac	Protospacer
*********************************

102. spacer 6.43|253016|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctctttctaccctctcccacacgtcagggtacc	CRISPR spacer
ctctttctaccctctcccacacgtcagggtacc	Protospacer
*********************************

103. spacer 6.44|253077|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gccctgcccgagcgggaggaccaccaccacgtc	CRISPR spacer
gccctgcccgagcgggaggaccaccaccacgtc	Protospacer
*********************************

104. spacer 6.45|253138|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gatgttctcccctccgctttctccaacacggac	CRISPR spacer
gatgttctcccctccgctttctccaacacggac	Protospacer
*********************************

105. spacer 6.46|253199|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ttgtacttctctaggagggggtgctctagtagc	CRISPR spacer
ttgtacttctctaggagggggtgctctagtagc	Protospacer
*********************************

106. spacer 6.47|253260|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tgggtgcgttggaggaggctgcacgcggccccc	CRISPR spacer
tgggtgcgttggaggaggctgcacgcggccccc	Protospacer
*********************************

107. spacer 6.48|253321|32|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcacctcctgaggctcctccgaggaggttccc	CRISPR spacer
gcacctcctgaggctcctccgaggaggttccc	Protospacer
********************************

108. spacer 6.49|253381|33|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

acggtgagcttccccgtgcgggcgtccaccagc	CRISPR spacer
acggtgagcttccccgtgcgggcgtccaccagc	Protospacer
*********************************

109. spacer 6.50|253442|32|NZ_CP016313|PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggatgggctcgctctgaatgatctcggggagc	CRISPR spacer
ggatgggctcgctctgaatgatctcggggagc	Protospacer
********************************

110. spacer 7.1|263223|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgttagggagggcgttgttgcccggatgca	CRISPR spacer
gcgttagggagggcgttgttgcccggatgca	Protospacer
*******************************

111. spacer 7.2|263283|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tatgttgatgccttccgaaatctagctcacga	CRISPR spacer
tatgttgatgccttccgaaatctagctcacga	Protospacer
********************************

112. spacer 7.3|263344|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

aggatgagcccggtggagaacgcatcggcaa	CRISPR spacer
aggatgagcccggtggagaacgcatcggcaa	Protospacer
*******************************

113. spacer 7.4|263404|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gaggtggaagatggtaacggcagaggctagga	CRISPR spacer
gaggtggaagatggtaacggcagaggctagga	Protospacer
********************************

114. spacer 7.5|263465|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

cctcggcacggagcacctccacgctcacggc	CRISPR spacer
cctcggcacggagcacctccacgctcacggc	Protospacer
*******************************

115. spacer 7.6|263525|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gtggcttccgcccgctcattcgtcagggcgt	CRISPR spacer
gtggcttccgcccgctcattcgtcagggcgt	Protospacer
*******************************

116. spacer 7.7|263585|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

aggaggccttctttgaggctgagtttggaggc	CRISPR spacer
aggaggccttctttgaggctgagtttggaggc	Protospacer
********************************

117. spacer 7.8|263646|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gagcaagtggctcagcgaggaacaggtcggga	CRISPR spacer
gagcaagtggctcagcgaggaacaggtcggga	Protospacer
********************************

118. spacer 7.9|263707|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

aaaccgcgaaggcgctatacgaggcggcaaa	CRISPR spacer
aaaccgcgaaggcgctatacgaggcggcaaa	Protospacer
*******************************

119. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
tcaagggggacccccgcttgcggtgggccga	Protospacer
*******************************

120. spacer 7.11|263827|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

taggtaatcaccccgaggctattctggtagac	CRISPR spacer
taggtaatcaccccgaggctattctggtagac	Protospacer
********************************

121. spacer 7.12|263888|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ttagactttgcgttgccgcgcctcatactcta	CRISPR spacer
ttagactttgcgttgccgcgcctcatactcta	Protospacer
********************************

122. spacer 7.13|263949|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

agggcgatgcggttcttgtggtggtaggagtc	CRISPR spacer
agggcgatgcggttcttgtggtggtaggagtc	Protospacer
********************************

123. spacer 7.14|264010|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tggggtaggcggcttattggggcgccccatgg	CRISPR spacer
tggggtaggcggcttattggggcgccccatgg	Protospacer
********************************

124. spacer 7.15|264071|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

acaggctcaccgccgtgcctaggtccaagagc	CRISPR spacer
acaggctcaccgccgtgcctaggtccaagagc	Protospacer
********************************

125. spacer 7.16|264132|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ccgcgtccctaaggggcgacgcgattatagcc	CRISPR spacer
ccgcgtccctaaggggcgacgcgattatagcc	Protospacer
********************************

126. spacer 7.17|264193|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tgcccgtggccgctaacggttaccggtgtatg	CRISPR spacer
tgcccgtggccgctaacggttaccggtgtatg	Protospacer
********************************

127. spacer 7.18|264254|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ccgcgtggcgccccctccgccacctatgaccc	CRISPR spacer
ccgcgtggcgccccctccgccacctatgaccc	Protospacer
********************************

128. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
aagtctatcccgccccagcaatgggcggcttt	Protospacer
********************************

129. spacer 7.20|264376|33|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ctccgggccattcctgagcaccttatctatacc	CRISPR spacer
ctccgggccattcctgagcaccttatctatacc	Protospacer
*********************************

130. spacer 7.21|264438|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tcccactcggagtaggcgcccacgtcggacgc	CRISPR spacer
tcccactcggagtaggcgcccacgtcggacgc	Protospacer
********************************

131. spacer 7.22|264499|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gaactggtggaaggctactggcaggggagcac	CRISPR spacer
gaactggtggaaggctactggcaggggagcac	Protospacer
********************************

132. spacer 7.23|264560|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

gacagggttccctccggcttgacggtggtttt	CRISPR spacer
gacagggttccctccggcttgacggtggtttt	Protospacer
********************************

133. spacer 7.24|264621|31|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

tctttgtacccgtgtttccgcgcaagccaaa	CRISPR spacer
tctttgtacccgtgtttccgcgcaagccaaa	Protospacer
*******************************

134. spacer 7.25|264681|31|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

cctacgaggcccttaggcgagcggggcttgt	CRISPR spacer
cctacgaggcccttaggcgagcggggcttgt	Protospacer
*******************************

135. spacer 7.26|264741|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

aggacggggtgaaggcgctaggcgcttccccc	CRISPR spacer
aggacggggtgaaggcgctaggcgcttccccc	Protospacer
********************************

136. spacer 7.27|264802|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 0, identity: 1.0 

ccaacgttgccccgaaaaacctattaccattt	CRISPR spacer
ccaacgttgccccgaaaaacctattaccattt	Protospacer
********************************

137. spacer 7.1|263223|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH673671 (Thermus phage phiKo, complete genome) position: , mismatch: 1, identity: 0.968 

gcgttagggagggcgttgttgcccggatgca	CRISPR spacer
gcgttaggaagggcgttgttgcccggatgca	Protospacer
********.**********************

138. spacer 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.839 

acgacgacatggtggacgccctggtctacgc-	CRISPR spacer
atgacgacatggtggacgccttcgt-tgcgct	Protospacer
*.******************.* ** *.***

139. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 6, identity: 0.806 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
ccgccgcccaggtggccggcggcgcccaggt	Protospacer
 * ** *  ************ *********

140. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP029341 (Streptomyces sp. SM17 plasmid pSM17C, complete sequence) position: , mismatch: 6, identity: 0.806 

gctcctcggaggtggccggcgccgcccaggt--	CRISPR spacer
cctcctcggcggcggccggcgccg--gaggttg	Protospacer
 ******** **.***********   ****

141. spacer 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.806 

acgacgacatggtggacgccctggtctacgc-	CRISPR spacer
tcgaagacatggtcgacgccctgg-cggcgca	Protospacer
 *** ******** ********** * .***

142. spacer 6.24|253380|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

---acggtgagcttccccgtgcgggcgtccaccag	CRISPR spacer
cgcacggc---ctgccccgtgcgggtgtccaccag	Protospacer
   ****.   ** ***********.*********

143. spacer 6.24|253380|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 6, identity: 0.812 

---acggtgagcttccccgtgcgggcgtccaccag	CRISPR spacer
cgcacggc---ctgccccgtgcgggtgtccaccag	Protospacer
   ****.   ** ***********.*********

144. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to LN997845 (Streptomyces reticuli genome assembly TUE45, plasmid : IV) position: , mismatch: 6, identity: 0.812 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
ccgccgcccaggtggccggcggcgcccaggtc	Protospacer
 * ** *  ************ **********

145. spacer 6.41|252895|32|NZ_CP016313|PILER-CR matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 6, identity: 0.812 

acgacgacatggtggacgccctggtctacgcc-	CRISPR spacer
atgacgacatggtggacgccttcgt-tgcgctt	Protospacer
*.******************.* ** *.***.

146. spacer 6.49|253381|33|NZ_CP016313|PILER-CR matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818 

---acggtgagcttccccgtgcgggcgtccaccagc	CRISPR spacer
cgcacggc---ctgccccgtgcgggtgtccaccagc	Protospacer
   ****.   ** ***********.**********

147. spacer 6.49|253381|33|NZ_CP016313|PILER-CR matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 6, identity: 0.818 

---acggtgagcttccccgtgcgggcgtccaccagc	CRISPR spacer
cgcacggc---ctgccccgtgcgggtgtccaccagc	Protospacer
   ****.   ** ***********.**********

148. spacer 7.8|263646|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 6, identity: 0.812 

gagcaagtggctcagcgagga--acaggtcggga	CRISPR spacer
aagcaattggctcagccaggaacacaggtctg--	Protospacer
.***** ********* ****  ******* *

149. spacer 7.21|264438|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 6, identity: 0.812 

tcccactcggagtaggcgcccacgtcggacgc-	CRISPR spacer
tgctcctcggcgtaggcgcgcacgtcgg-cgct	Protospacer
* *. ***** ******** ******** ***

150. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
acgaaacggcgaggccgtggcgaaggcgcagc	Protospacer
*.***.** ****************** * ..

151. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 7, identity: 0.781 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
atagagcgccgaggcggtggcgacggctgcca	Protospacer
**..*********** ******* **** *

152. spacer 6.11|252591|32|NZ_CP016313|CRISPRCasFinder,CRT matches to MF668280 (Mycobacterium phage Phabba, complete genome) position: , mismatch: 7, identity: 0.781 

gcgctattggccgcattgcggaaggaaatgta	CRISPR spacer
gcgctgttggccgcgttgcggaaggtcaccga	Protospacer
*****.********.**********  *.  *

153. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.781 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
gccgtgctggcactggtcgcggccgtggtcgg	Protospacer
 * *** ************ ********..*

154. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

155. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

156. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

157. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

158. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

159. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

160. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

161. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

162. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

163. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

164. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

165. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

166. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

167. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

168. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

169. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

170. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

171. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acatagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

172. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

173. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

174. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

175. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

176. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

177. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

178. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

179. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

180. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

181. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acatagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

182. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

183. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

184. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

185. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

186. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

187. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

188. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

189. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

190. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

191. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

192. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

193. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

194. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

195. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

196. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

197. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

198. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

199. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

200. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

201. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

202. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

203. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

204. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

205. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

206. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

207. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

208. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

209. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acatagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

210. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

211. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

212. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

213. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acatagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

214. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

215. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

216. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

217. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

218. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

219. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

220. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

221. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

222. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

223. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

224. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

225. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

226. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

227. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

228. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

229. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

230. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

231. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

232. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

233. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

234. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

235. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

236. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

237. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

238. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

239. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

240. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtagcggcggtggccggcgccggccaggt	Protospacer
.* .  *** ************** ******

241. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cctcctcggtggtggccggtgccgcagcggc	Protospacer
 ******** *********.*****   **.

242. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cctcctcgaaggtggccggccccgtgcgtgt	Protospacer
 *******.*********** ***. *. **

243. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cctcctcgaaggtggccggccccgtgcgtgt	Protospacer
 *******.*********** ***. *. **

244. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 7, identity: 0.774 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cctcctcgaaggtggccggccccgtgcgtgt	Protospacer
 *******.*********** ***. *. **

245. spacer 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT matches to GU936714 (Synechococcus phage S-CBS2, complete genome) position: , mismatch: 7, identity: 0.774 

acgacgacatggtggacgccctggtctacgc	CRISPR spacer
acgatgacatggtggacgccctgacgatggc	Protospacer
****.******************..    **

246. spacer 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.774 

acgacgacatggtggacgccctggtc-tacgc	CRISPR spacer
tgcgcgacatggtggccgccctggtcgttcg-	Protospacer
   .*********** ********** * **

247. spacer 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT matches to KR063280 (Gordonia phage GMA6, complete genome) position: , mismatch: 7, identity: 0.774 

acgacgacatggtggacgccctggtctacgc	CRISPR spacer
acgacgacatggtggatgccctcagcggtgc	Protospacer
****************.***** . * ..**

248. spacer 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774 

acgacgacatggtggacgccctggtctacgc	CRISPR spacer
acgacgacatggcgggcgccctgctgatcgg	Protospacer
************.**.******* *   **

249. spacer 6.17|252954|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 7, identity: 0.781 

caggagagaggccacccggctcaggtcctcca	CRISPR spacer
ccccagccgggccacccggctcagatcctcca	Protospacer
*   **  .***************.*******

250. spacer 6.28|252104|33|NZ_CP016313|PILER-CR matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.788 

tgggggcct----cctacggggcggccctggccggct	CRISPR spacer
----ggcccgacgcctacgcggcggccccggccggct	Protospacer
    ****.    ****** ********.********

251. spacer 6.36|252592|33|NZ_CP016313|PILER-CR matches to MF668280 (Mycobacterium phage Phabba, complete genome) position: , mismatch: 7, identity: 0.788 

gcgctattggccgcattgcggaaggaaatgtac	CRISPR spacer
gcgctgttggccgcgttgcggaaggtcaccgac	Protospacer
*****.********.**********  *.  **

252. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP029341 (Streptomyces sp. SM17 plasmid pSM17C, complete sequence) position: , mismatch: 7, identity: 0.781 

gctcctcggaggtggccggcgccgcccaggtc--	CRISPR spacer
cctcctcggcggcggccggcgccg--gaggttgc	Protospacer
 ******** **.***********   ****.

253. spacer 6.41|252895|32|NZ_CP016313|PILER-CR matches to GU936714 (Synechococcus phage S-CBS2, complete genome) position: , mismatch: 7, identity: 0.781 

acgacgacatggtggacgccctggtctacgcc	CRISPR spacer
acgatgacatggtggacgccctgacgatggcc	Protospacer
****.******************..    ***

254. spacer 6.41|252895|32|NZ_CP016313|PILER-CR matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781 

acgacgacatggtggacgccctggtctacgcc-	CRISPR spacer
tcgaagacatggtcgacgccctgg-cggcgcag	Protospacer
 *** ******** ********** * .***

255. spacer 6.41|252895|32|NZ_CP016313|PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781 

acgacgacatggtggacgccctggtctacgcc	CRISPR spacer
acgacgacatggcgggcgccctgctgatcggc	Protospacer
************.**.******* *   ** *

256. spacer 6.42|252955|33|NZ_CP016313|PILER-CR matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 7, identity: 0.788 

caggagagaggccacccggctcaggtcctccac	CRISPR spacer
ccccagccgggccacccggctcagatcctccac	Protospacer
*   **  .***************.********

257. spacer 7.1|263223|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_049850 (Burkholderia phage BcepSaruman, complete genome) position: , mismatch: 7, identity: 0.774 

gcgttagggagggcgttgttgcccggatgca	CRISPR spacer
gcggcccggagcgcgttgttgcgcggatgcc	Protospacer
*** .  **** ********** *******

258. spacer 7.6|263525|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774 

gtggcttccgcccgctcattcgtcagggcgt	CRISPR spacer
atccattccggcagctcattcgtcagggctt	Protospacer
.*   ***** * **************** *

259. spacer 7.6|263525|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.774 

--gtggcttccgcccgctcattcgtcagggcgt	CRISPR spacer
cgatagc--ccgcccgctcatccggcagggcga	Protospacer
  .*.**  ************.** *******

260. spacer 7.9|263707|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 7, identity: 0.774 

aaaccgcgaaggcgctatacgaggcggcaaa	CRISPR spacer
gcatcccgaaggcgctggacgaggcggcata	Protospacer
. *.* **********. *********** *

261. spacer 7.9|263707|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 7, identity: 0.774 

aaaccgcgaaggcgctatacgaggcggcaaa	CRISPR spacer
gcatcccgaaggcgctggacgaggcggcata	Protospacer
. *.* **********. *********** *

262. spacer 7.9|263707|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 7, identity: 0.774 

aaaccgcgaaggcgctatacgaggcggcaaa	CRISPR spacer
gcatcccgaaggcgctggacgaggcggcata	Protospacer
. *.* **********. *********** *

263. spacer 6.1|251981|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_AP018559 (Hydrogenophilus thermoluteolus strain TH-1 plasmid pTH1, complete sequence) position: , mismatch: 8, identity: 0.75 

accctgcggcacattgctggggccaacctggt	CRISPR spacer
accctgccgcacattgctgcggccctggaagt	Protospacer
******* *********** ****     .**

264. spacer 6.4|252164|32|NZ_CP016313|CRISPRCasFinder,CRT matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 8, identity: 0.75 

atgttgccgtactggtcaaggtcggcccacac	CRISPR spacer
atgttgtcgtactggtcagggtcgaacgggtc	Protospacer
******.***********.*****. * .  *

265. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

266. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

267. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

268. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

269. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

270. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

271. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

272. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

273. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

274. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

275. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

276. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

277. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

278. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

279. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

280. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

281. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

282. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

283. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

284. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

285. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

286. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

287. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

288. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

289. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

290. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

291. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

292. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

293. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

294. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

295. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

296. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

297. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

298. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

299. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

300. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

301. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

302. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

303. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

304. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

305. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

306. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

307. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

308. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

309. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

310. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

311. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

312. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

313. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

314. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

315. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

316. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

317. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

318. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

319. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

320. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

321. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

322. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

323. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

324. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

325. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

326. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccagtggt-ggcactggtcggggccgtggctgt	CRISPR spacer
-cggcgccgggctctggtcggggctgtggctgg	Protospacer
 *.*.* . *** ***********.*******

327. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cccgcctcgacgtggccggcgccgcccaggc	Protospacer
 *. *.. ** *******************.

328. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
gacacggcgaggtagccggcgccgcccagga	Protospacer
* . *   *****.****************

329. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP035513 (Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
tgttgtcggaggtggccagcgccgcccctgc	Protospacer
  *. ************.*********  *.

330. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttagcggaggcggccggcgccgccctggc	Protospacer
  *.  ******.************** **.

331. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cccgcctcgacgtggccggcgccgcccaggc	Protospacer
 *. *.. ** *******************.

332. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
gcgaagaggaggtggccgccgccgaccaggg	Protospacer
**     *********** ***** *****

333. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
tcgacgtggatgtggacggcgccgcccagga	Protospacer
 *  * .*** **** **************

334. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH509442 (Mycobacterium phage Aminay, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcg------gaggtggccggcgccgcccaggt	CRISPR spacer
------cgggcgatgaggtggccggcgcggcgcaggt	Protospacer
      **      ************** ** *****

335. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MK937601 (Gordonia phage Charming, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

336. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

337. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH976510 (Gordonia phage Fosterous, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

338. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH153809 (Gordonia phage Sitar, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

339. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH976518 (Gordonia phage Stultus, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

340. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

341. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MK937594 (Gordonia phage Galadriel, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

342. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MN329673 (Gordonia phage Jabberwocky, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

343. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MT723934 (Gordonia phage Love, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

344. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH651166 (Gordonia phage Angelicage, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

345. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MT639640 (Gordonia phage Paries, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

346. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MK977702 (Gordonia terrae phage McKinley, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

347. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_042108 (Gordonia phage Brandonk123, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

348. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH976514 (Gordonia phage Nordenberg, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

349. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH976508 (Gordonia phage Bibwit, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

350. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH976506 (Gordonia phage Affeca, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

351. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MN329677 (Gordonia phage Keitabear, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

352. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_042045 (Gordonia phage Lennon, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

353. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH976507 (Gordonia phage Ailee, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

354. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MT498035 (Gordonia Phage Barsten, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

355. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MH976512 (Gordonia phage Geodirt, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

356. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_031239 (Gordonia phage Vivi2, complete genome) position: , mismatch: 8, identity: 0.742 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggt	Protospacer
  *.*   ***************** * ***

357. spacer 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742 

acgacgacatggtggacgccctggtctacgc	CRISPR spacer
acgacgacacggtggacgccctccagcgcgt	Protospacer
*********.************    ..**.

358. spacer 6.16|252894|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP023721 (Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742 

acgacgacatggtggacgccctggtctacgc	CRISPR spacer
ccgacgacatcgtggacgcccaggatgcagc	Protospacer
 ********* ********** ** .   **

359. spacer 6.19|253076|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75 

gccctgcccgagcgggaggaccaccaccacgt	CRISPR spacer
aagccgttcgagccggaggacgaccaccacgt	Protospacer
.  *.*..***** ******* **********

360. spacer 6.19|253076|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75 

gccctgcccgagcgggaggaccaccaccacgt	CRISPR spacer
aagccgttcgagccggaggacgaccaccacgt	Protospacer
.  *.*..***** ******* **********

361. spacer 6.27|252043|33|NZ_CP016313|PILER-CR matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.758 

atgaagcgccgaggccgtggcgaaggctccatc	CRISPR spacer
acgaaacggcgaggccgtggcgaaggcgcagca	Protospacer
*.***.** ****************** * ..

362. spacer 6.27|252043|33|NZ_CP016313|PILER-CR matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 8, identity: 0.758 

atgaagcgccgaggccgtggcgaaggctccatc	CRISPR spacer
atagagcgccgaggcggtggcgacggctgccag	Protospacer
**..*********** ******* **** *

363. spacer 6.37|252653|33|NZ_CP016313|PILER-CR matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 8, identity: 0.758 

ccagtggtggcactggtcggggccgtggctgta	CRISPR spacer
gccgtgctggcactggtcgcggccgtggtcggc	Protospacer
 * *** ************ ********..*

364. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

365. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

366. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

367. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

368. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

369. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acatagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

370. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

371. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

372. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

373. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

374. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

375. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

376. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

377. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

378. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

379. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

380. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

381. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

382. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

383. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acatagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

384. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

385. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

386. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

387. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

388. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

389. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

390. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

391. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

392. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

393. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

394. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

395. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

396. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

397. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

398. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

399. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

400. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

401. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

402. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

403. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

404. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

405. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

406. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

407. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

408. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

409. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

410. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

411. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

412. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

413. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

414. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

415. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

416. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acatagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

417. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

418. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

419. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

420. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acatagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

421. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

422. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

423. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

424. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

425. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

426. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

427. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

428. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

429. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

430. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

431. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

432. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

433. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

434. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

435. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

436. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

437. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

438. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

439. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

440. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

441. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

442. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

443. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

444. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

445. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

446. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

447. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

448. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

449. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

450. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtagcggcggtggccggcgccggccaggtg	Protospacer
.* .  *** ************** ******

451. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cctcctcggtggtggccggtgccgcagcggcg	Protospacer
 ******** *********.*****   **.

452. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttagcggaggcggccggcgccgccctggcc	Protospacer
  *.  ******.************** **.*

453. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MK937601 (Gordonia phage Charming, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

454. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

455. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH976510 (Gordonia phage Fosterous, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

456. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH153809 (Gordonia phage Sitar, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

457. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH976518 (Gordonia phage Stultus, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

458. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

459. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MK937594 (Gordonia phage Galadriel, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

460. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MN329673 (Gordonia phage Jabberwocky, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

461. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MT723934 (Gordonia phage Love, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

462. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH651166 (Gordonia phage Angelicage, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

463. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MT639640 (Gordonia phage Paries, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

464. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MK977702 (Gordonia terrae phage McKinley, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

465. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NC_042108 (Gordonia phage Brandonk123, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

466. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH976514 (Gordonia phage Nordenberg, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

467. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH976508 (Gordonia phage Bibwit, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

468. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH976506 (Gordonia phage Affeca, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

469. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MN329677 (Gordonia phage Keitabear, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

470. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NC_042045 (Gordonia phage Lennon, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

471. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH976507 (Gordonia phage Ailee, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

472. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MT498035 (Gordonia Phage Barsten, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

473. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH976512 (Gordonia phage Geodirt, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

474. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NC_031239 (Gordonia phage Vivi2, complete genome) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgttcgacgaggtggccggcgccgcgctggtc	Protospacer
  *.*   ***************** * ****

475. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cctcctcgaaggtggccggccccgtgcgtgtg	Protospacer
 *******.*********** ***. *. **

476. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cctcctcgaaggtggccggccccgtgcgtgtg	Protospacer
 *******.*********** ***. *. **

477. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cctcctcgaaggtggccggccccgtgcgtgtg	Protospacer
 *******.*********** ***. *. **

478. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 8, identity: 0.75 

gctcctcggaggtggccggcgccgcc--caggtc	CRISPR spacer
cggcctcggcgatggccggcgccgccttctgg--	Protospacer
   ****** *.**************  * **

479. spacer 6.41|252895|32|NZ_CP016313|PILER-CR matches to NZ_CP023721 (Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgacgacatggtggacgccctggtctacgcc	CRISPR spacer
ccgacgacatcgtggacgcccaggatgcagcc	Protospacer
 ********* ********** ** .   ***

480. spacer 7.5|263465|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.742 

cctcggcacggagcacctccacgctcacggc	CRISPR spacer
aaacatcacgcaggacctccacgctcacgac	Protospacer
   *. **** ** ***************.*

481. spacer 7.8|263646|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75 

gagcaagtggctcagcgaggaacaggtcggga	CRISPR spacer
gcgcaagtagctcagcgaggaatagccggtgc	Protospacer
* ******.*************.** . * *

482. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_017643 (Escherichia coli UMNK88 plasmid pUMNK88_Hly, complete sequence) position: , mismatch: 8, identity: 0.742 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
tgtcgggggcccgccgcttgcggtgggaggt	Protospacer
*   ***** ** **************  *

483. spacer 7.13|263949|32|NZ_CP016313|CRISPRCasFinder,CRT matches to MG592553 (Vibrio phage 1.187.O._10N.286.49.F1, partial genome) position: , mismatch: 8, identity: 0.75 

agggcgatgcggttcttgtggtggtaggagtc	CRISPR spacer
aagtgtaagcagttcttgtggtggtagcagtg	Protospacer
*.*   * **.**************** ***

484. spacer 7.15|264071|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 8, identity: 0.75 

acaggctcaccgccgtgcctaggtccaagagc	CRISPR spacer
ggcggctcaccgccgtgccctggtcctggcgc	Protospacer
.  ****************. ***** .* **

485. spacer 7.17|264193|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.75 

tgcccgtggccgctaacggttaccggtgtatg	CRISPR spacer
tctgcgttgccgctaatggttaccggtgctgg	Protospacer
* . *** ********.***********.  *

486. spacer 7.18|264254|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.75 

ccgcgtggcgccccctccgccacctatgaccc	CRISPR spacer
gcgggtggcgcccccgccgccaccagcgatgc	Protospacer
 ** *********** ******** ..**. *

487. spacer 4.1|82810|32|NZ_CP016313|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719 

tccggaaggtccgtgaggaagcggcctcccgt	CRISPR spacer
cgtggatggtccatgaggaagcggccgaccag	Protospacer
. .*** *****.*************  **.

488. spacer 6.1|251981|32|NZ_CP016313|CRISPRCasFinder,CRT matches to MN586047 (Gordonia phage EMoore, complete genome) position: , mismatch: 9, identity: 0.719 

accctgcggcacattgctggggccaacctggt	CRISPR spacer
ccagggcggcacactgctggcgccaaccggcg	Protospacer
 *   ********.****** ******* *

489. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 9, identity: 0.719 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
gtagagcgccgaggccatggcgaaggcgagca	Protospacer
.*..************.**********

490. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 9, identity: 0.719 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
ggcgcgcgccgaggcggtggcgaagactctac	Protospacer
.  . ********** *********.***.*.

491. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 9, identity: 0.719 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
ctgtggcgccgaggcggtggcgcaggctggtc	Protospacer
 ** .********** ****** *****   .

492. spacer 6.7|252347|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MN304818 (Phage 71_18, complete genome) position: , mismatch: 9, identity: 0.71 

tcgctatcggggtgccgttgtgggggccttt	CRISPR spacer
tcactctcggggtgccgttgtggaacaccag	Protospacer
**.** *****************..  *.

493. spacer 6.9|252468|33|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.727 

actgtctgggctaactcctgcttgatgctcatc	CRISPR spacer
ctgggatagggtaacccctgcttgatgctcata	Protospacer
 . *  *.** ****.****************

494. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

495. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

496. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

497. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

498. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

499. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

500. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

501. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

502. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
gaggtgctggccctggtcggggccgtcgaggc	Protospacer
  .*** **** ************** *  *.

503. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgcccggcggccctggtcggggccgtggtcga	Protospacer
*   .**.*** ****************..*

504. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

505. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

506. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

507. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
tcgggccgggctctggtcggggctgtggctgg	Protospacer
.*.*    *** ***********.*******

508. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

509. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

510. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

511. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

512. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

513. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

514. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

515. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

516. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

517. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

518. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

519. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cgggaccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

520. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

521. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

522. spacer 6.12|252652|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ccagtggtggcactggtcggggccgtggctgt	CRISPR spacer
cggggccgggctctggtcggggctgtggctgg	Protospacer
* .*    *** ***********.*******

523. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
agcggacggatgtggccggcgccgtccaggc	Protospacer
. .   **** *************.*****.

524. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtgctggcggtggccggcgccgccaagga	Protospacer
.* . ..** **************** ***

525. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
tctcctcgacggtggccggcgccgtctctcc	Protospacer
 *******. **************.*.   .

526. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtgctggcggtggccggcgccgccaagga	Protospacer
.* . ..** **************** ***

527. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
tgacctcggcggtggccggtgccgcctgcgc	Protospacer
   ****** *********.******.. *.

528. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
tctcctcgacggtggccggcgccgtctctcc	Protospacer
 *******. **************.*.   .

529. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
aagagttggaggtggccggcggcgccctgga	Protospacer
.    *.************** ***** **

530. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtgctggcggtggccggcgccgccaagga	Protospacer
.* . ..** **************** ***

531. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
tctcctcgacggtggccggcgccgtctctcc	Protospacer
 *******. **************.*.   .

532. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
acgtgctggcggtggccggcgccgccaagga	Protospacer
.* . ..** **************** ***

533. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgccctcggaggtggcgcgcgccgccgcgcc	Protospacer
  .*************  ********  * .

534. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MN813694 (Gordonia phage Opie, complete genome) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cgcacaaggagtgggccggcgccgcccaggg	Protospacer
  . *  ****  *****************

535. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to MT740728 (Ralstonia phage Anchaing, complete genome) position: , mismatch: 9, identity: 0.71 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
gtgtgcaggaggtggccgaagccgcccaggg	Protospacer
*. . . ***********. **********

536. spacer 6.26|251982|33|NZ_CP016313|PILER-CR matches to NZ_AP018559 (Hydrogenophilus thermoluteolus strain TH-1 plasmid pTH1, complete sequence) position: , mismatch: 9, identity: 0.727 

accctgcggcacattgctggggccaacctggtc	CRISPR spacer
accctgccgcacattgctgcggccctggaagta	Protospacer
******* *********** ****     .**

537. spacer 6.27|252043|33|NZ_CP016313|PILER-CR matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 9, identity: 0.727 

atgaagcgccgaggccgtggcgaaggctccatc	CRISPR spacer
ggcgcgcgccgaggcggtggcgaagactctacc	Protospacer
.  . ********** *********.***.*.*

538. spacer 6.29|252165|33|NZ_CP016313|PILER-CR matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 9, identity: 0.727 

atgttgccgtactggtcaaggtcggcccacacc	CRISPR spacer
atgttgtcgtactggtcagggtcgaacgggtcg	Protospacer
******.***********.*****. * .  *

539. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
gcgaagaggaggtggccgccgccgaccaggga	Protospacer
**     *********** ***** *****

540. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
tctcctcgacggtggccggcgccgtctctccc	Protospacer
 *******. **************.*.   .*

541. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
tctcctcgacggtggccggcgccgtctctccc	Protospacer
 *******. **************.*.   .*

542. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtgctggcggtggccggcgccgccaaggac	Protospacer
.* . ..** **************** *** *

543. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
tctcctcgacggtggccggcgccgtctctccc	Protospacer
 *******. **************.*.   .*

544. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
aagagttggaggtggccggcggcgccctggac	Protospacer
.    *.************** ***** ** *

545. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
tcgacgtggatgtggacggcgccgcccaggat	Protospacer
 *  * .*** **** ************** .

546. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtgctggcggtggccggcgccgccaaggac	Protospacer
.* . ..** **************** *** *

547. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MN813694 (Gordonia phage Opie, complete genome) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgcacaaggagtgggccggcgccgcccagggc	Protospacer
  . *  ****  ***************** *

548. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MH509442 (Mycobacterium phage Aminay, complete genome) position: , mismatch: 9, identity: 0.719 

gctcctcg------gaggtggccggcgccgcccaggtc	CRISPR spacer
------cgggcgatgaggtggccggcgcggcgcaggtt	Protospacer
      **      ************** ** *****.

549. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to MT740728 (Ralstonia phage Anchaing, complete genome) position: , mismatch: 9, identity: 0.719 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
gtgtgcaggaggtggccgaagccgcccagggc	Protospacer
*. . . ***********. ********** *

550. spacer 6.41|252895|32|NZ_CP016313|PILER-CR matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgacgacatggtggacgccctggtctacgcc	CRISPR spacer
ggtgggccctggtggacgccctgatccacgcc	Protospacer
.  . * * **************.**.*****

551. spacer 6.44|253077|33|NZ_CP016313|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727 

gccctgcccgagcgggaggaccaccaccacgtc	CRISPR spacer
aagccgttcgagccggaggacgaccaccacgtg	Protospacer
.  *.*..***** ******* **********

552. spacer 6.44|253077|33|NZ_CP016313|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727 

gccctgcccgagcgggaggaccaccaccacgtc	CRISPR spacer
aagccgttcgagccggaggacgaccaccacgtg	Protospacer
.  *.*..***** ******* **********

553. spacer 6.50|253442|32|NZ_CP016313|PILER-CR matches to CP054928 (Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ggatgggctcgct------ctgaatgatctcggggagc	CRISPR spacer
------cctcgccagcgcactgaatgatcttggggagc	Protospacer
       *****.      ***********.*******

554. spacer 7.5|263465|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 9, identity: 0.71 

cctcggcacggagcacctccacgctcacggc	CRISPR spacer
ggtgatggcggagcacatccacgcccacggc	Protospacer
  * .  .******** *******.******

555. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP026794 (Shigella flexneri strain 74-1170 plasmid unnamed) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

556. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP033511 (Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

557. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP026789 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

558. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP012138 (Shigella flexneri 2a strain 981 plasmid 981p1, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

559. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP044160 (Shigella flexneri strain AR-0423 plasmid pAR-0423-2, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

560. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_017319 (Shigella flexneri 2002017 plasmid pSFxv_1, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

561. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP012142 (Shigella flexneri 4c strain 1205 plasmid 1205p2, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

562. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP007038 (Shigella flexneri G1663 plasmid pG1663, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

563. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP033634 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb3, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
cggtgggggcccgccgcttgcggtgggaggt	Protospacer
. . ***** ** **************  *

564. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP020087 (Shigella flexneri 1a strain 0670 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

565. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP020337 (Shigella flexneri 4c strain 1602 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

566. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP020343 (Shigella flexneri 1a strain 0439 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

567. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP045942 (Shigella flexneri 2a strain AUSMDU00010535 plasmid pAUSMDU00010535_01, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

568. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_004851 (Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

569. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_LR213456 (Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 2) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

570. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP044157 (Shigella flexneri strain AR-0424 plasmid pAR-0424-2, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

571. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP044154 (Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

572. spacer 7.10|263767|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP034933 (Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-2, complete sequence) position: , mismatch: 9, identity: 0.71 

tcaagggggacccccgcttgcggtgggccga	CRISPR spacer
ggttgggggcccgccgcttgcggtgggaggt	Protospacer
    ***** ** **************  *

573. spacer 7.13|263949|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 9, identity: 0.719 

agggcgatgcggttcttgtggtggtaggagtc	CRISPR spacer
ggactattgcggtttttgtggtggtagtaggc	Protospacer
.*. .. *******.************ ** *

574. spacer 7.15|264071|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

acaggctcaccgccgtgcctaggtccaagagc	CRISPR spacer
ggcggctcaccgccgtgccctggtcctggcac	Protospacer
.  ****************. ***** .* .*

575. spacer 7.18|264254|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719 

ccgcgtggcgccccctccgccacctatgaccc	CRISPR spacer
gagaatggcgcccgctacgccacctatgccta	Protospacer
  * .******** ** *********** *.

576. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

577. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

578. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

579. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

580. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

581. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

582. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

583. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

584. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
tcgcaaatcacgccgcagcaatgggcggcact	Protospacer
  *.  *** **** ************** .*

585. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

586. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

587. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

588. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

589. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

590. spacer 7.19|264315|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aagtctatcccgccccagcaatgggcggcttt	CRISPR spacer
ataccgttcccgccccagccaagggcggctcc	Protospacer
* ..*  ************ * ********..

591. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
cgcgagcgccgaggccgaggcgaaggcgattc	Protospacer
   .************* *********  . .

592. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
cgcgagcgccgaggccgaggcgaaggcgattc	Protospacer
   .************* *********  . .

593. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 10, identity: 0.688 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
tctgacggccgagacggtggcgaaggctccca	Protospacer
 . .*  ******.* **************

594. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to MK249183 (Blackfly microvirus SF02 isolate 115, complete genome) position: , mismatch: 10, identity: 0.688 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
gttggatgccatggccgtggcgaaggctccga	Protospacer
.* ....***. ******************.

595. spacer 6.4|252164|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP016850 (Pseudomonas sp. TMW 2.1634 plasmid pL21564-1, complete sequence) position: , mismatch: 10, identity: 0.688 

atgttgccgtactggtcaaggtcggcccacac	CRISPR spacer
gtgttgccgttctggccaaggtcgaattggtc	Protospacer
.********* ****.********. ...  *

596. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 10, identity: 0.677 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
cggcctcggcgatggccggcgccgccttctg	Protospacer
   ****** *.**************.

597. spacer 6.14|252773|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 10, identity: 0.677 

gctcctcggaggtggccggcgccgcccaggt	CRISPR spacer
atgtgctggcggtggccggcgccgccaagga	Protospacer
.. . ..** **************** ***

598. spacer 6.32|252348|32|NZ_CP016313|PILER-CR matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tcgctatcggggtgccgttgtgggggcctttc	CRISPR spacer
cccggccttgggtgctgtggtgggggcctttc	Protospacer
.*    .. ******.** *************

599. spacer 6.32|252348|32|NZ_CP016313|PILER-CR matches to MN304818 (Phage 71_18, complete genome) position: , mismatch: 10, identity: 0.688 

tcgctatcggggtgccgttgtgggggcctttc	CRISPR spacer
tcactctcggggtgccgttgtggaacaccagg	Protospacer
**.** *****************..  *.

600. spacer 6.34|252469|34|NZ_CP016313|PILER-CR matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.706 

actgtctgggctaactcctgcttgatgctcatcc	CRISPR spacer
ctgggatagggtaacccctgcttgatgctcatag	Protospacer
 . *  *.** ****.****************

601. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 10, identity: 0.688 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
agcggacggatgtggccggcgccgtccaggct	Protospacer
. .   **** *************.*****..

602. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 10, identity: 0.688 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtgctggcggtggccggcgccgccaaggag	Protospacer
.* . ..** **************** ***

603. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
acgtgctggcggtggccggcgccgccaaggag	Protospacer
.* . ..** **************** ***

604. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.688 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
tgacctcggcggtggccggtgccgcctgcgcg	Protospacer
   ****** *********.******.. *.

605. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
cgccctcggaggtggcgcgcgccgccgcgcca	Protospacer
  .*************  ********  * .

606. spacer 7.3|263344|31|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_049851 (Burkholderia phage BcepSauron, complete genome) position: , mismatch: 10, identity: 0.677 

aggatgagcccggtggagaacgcatcggcaa	CRISPR spacer
tcagtgagcccggcgcagaacgcatcgtagc	Protospacer
  ..*********.* ***********  .

607. spacer 7.26|264741|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 10, identity: 0.688 

aggacggggtgaaggcgctaggcgcttccccc	CRISPR spacer
aggtcggggtgaaggcgccaggcagcgagaac	Protospacer
*** **************.****. .     *

608. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 11, identity: 0.656 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
cctccccgcccaggccgtggcggaggctctgg	Protospacer
 .    **** ***********.******..

609. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 11, identity: 0.656 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
tgccagcgccgaggccagggcgaaggcagagg	Protospacer
    ************. *********   .

610. spacer 6.2|252042|32|NZ_CP016313|CRISPRCasFinder,CRT matches to MK392368 (Arthrobacter phage Elesar, complete genome) position: , mismatch: 11, identity: 0.656 

atgaagcgccgaggccgtggcgaaggctccat	CRISPR spacer
caagagcgcccaggccgaggcgaaggccggca	Protospacer
  ..****** ****** *********.

611. spacer 6.39|252774|32|NZ_CP016313|PILER-CR matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 11, identity: 0.656 

gctcctcggaggtggccggcgccgcccaggtc	CRISPR spacer
atgtgctggcggtggccggcgccgccaaggag	Protospacer
.. . ..** **************** ***

612. spacer 7.23|264560|32|NZ_CP016313|CRISPRCasFinder,CRT,PILER-CR matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 11, identity: 0.656 

gacagggttccctccggcttgacggtggtttt	CRISPR spacer
cggctggttccctccagcgtgacggtgggcga	Protospacer
 .   **********.** ********* .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage