Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017952 Streptococcus iniae strain 89353 chromosome, complete genome 2 crisprs DEDDh,cas3,cas9,cas1,cas2,csn2,csm6,DinG,csa3 0 4 9 0

Results visualization

1. NZ_CP017952
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017952_1 810005-810634 TypeII II-A,II-B
9 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017952_2 1175127-1175268 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NC_024214 Lactococcus phage P162, complete genome 53210-53239 1 0.967
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NC_024215 Lactococcus phage P078, complete genome 52079-52108 2 0.933
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NC_024208 Lactococcus phage P118, complete genome 51800-51829 2 0.933
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NC_024203 Lactococcus phage P092, complete genome 51140-51169 2 0.933
NZ_CP017952_1 1.1|810041|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810041-810070 30 MK448887 Streptococcus phage Javan258, complete genome 37766-37795 5 0.833
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 NZ_CP045608 Bacillus cereus strain SB1 plasmid p2, complete sequence 89439-89468 5 0.833
NZ_CP017952_1 1.4|810239|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810239-810268 30 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 887525-887554 6 0.8
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 NZ_LR134432 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 23 2056-2085 6 0.8
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_LR214999 Mycoplasma conjunctivae strain NCTC10147 plasmid 3 92331-92360 6 0.8
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 LR214965 Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11 81923-81952 6 0.8
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NC_015418 Clostridium botulinum BKT015925 plasmid p3BKT015925, complete sequence 33576-33605 6 0.8
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 AP014355 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C68, *** SEQUENCING IN PROGRESS *** 2647-2676 6 0.8
NZ_CP017952_1 1.1|810041|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810041-810070 30 MN855587 Siphoviridae sp. isolate 137, complete genome 2435-2464 7 0.767
NZ_CP017952_1 1.1|810041|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810041-810070 30 KX397365 Erwinia phage vB_EamM_Caitlin, complete genome 106422-106451 7 0.767
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 AP011616 Thermus phage phiYS40 DNA, complete genome 61410-61439 7 0.767
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 DQ997624 Thermus thermophilus phage YS40, complete genome 61411-61440 7 0.767
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 NC_015937 Thermus phage TMA, complete genome 61209-61238 7 0.767
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 NC_008584 Thermus phage phiYS40, complete genome 61411-61440 7 0.767
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 AP011617 Thermus phage TMA DNA, complete genome 61209-61238 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_CP045792 Campylobacter coli strain CFSAN032805 plasmid p2CFSAN032805, complete sequence 21070-21099 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_CP023547 Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_2, complete sequence 3254-3283 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_CP040242 Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence 7980-8009 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NC_022656 Campylobacter coli 15-537360 plasmid pCC42yr, complete sequence 25353-25382 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 CP013736 Campylobacter coli strain OR12 plasmid pOR12CC42, complete sequence 23646-23675 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_CP017867 Campylobacter coli strain YF2105 plasmid pCCDM105S, complete sequence 14281-14310 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_CP017880 Campylobacter coli strain BG2108 plasmid pCCDM108S, complete sequence 19495-19524 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_CP017874 Campylobacter coli strain WA333 plasmid pCCDM33S, complete sequence 21449-21478 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_MH634990 Campylobacter coli strain XK3140 plasmid pCCDM140S, complete sequence 9178-9207 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_CP028188 Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence 18573-18602 7 0.767
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 MT774393 CrAssphage cr127_1, complete genome 59253-59282 7 0.767
NZ_CP017952_1 1.1|810041|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810041-810070 30 MN693543 Marine virus AFVG_25M469, complete genome 15879-15908 8 0.733
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NZ_CP017256 Clostridium taeniosporum strain 1/k plasmid pCt3, complete sequence 64886-64915 8 0.733
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 MN693959 Marine virus AFVG_250M1110, complete genome 36135-36164 8 0.733
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 110744-110773 9 0.7
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 MT708547 Klebsiella phage Muenster, complete genome 232419-232448 9 0.7
NZ_CP017952_1 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT 810305-810334 30 AB897757 Klebsiella phage K64-1 DNA, complete genome 110689-110718 9 0.7
NZ_CP017952_1 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT 810503-810532 30 NC_010183 Bacillus mycoides KBAB4 plasmid pBWB404, complete sequence 32766-32795 9 0.7

1. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NC_024214 (Lactococcus phage P162, complete genome) position: , mismatch: 1, identity: 0.967

ttagtattaaatataatatcaacaccttta	CRISPR spacer
ttagtattaaatataacatcaacaccttta	Protospacer
****************.*************

2. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NC_024215 (Lactococcus phage P078, complete genome) position: , mismatch: 2, identity: 0.933

ttagtattaaatataatatcaacaccttta	CRISPR spacer
ttagtattgaatataacatcaacaccttta	Protospacer
********.*******.*************

3. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NC_024208 (Lactococcus phage P118, complete genome) position: , mismatch: 2, identity: 0.933

ttagtattaaatataatatcaacaccttta	CRISPR spacer
ttagtattgaatataacatcaacaccttta	Protospacer
********.*******.*************

4. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NC_024203 (Lactococcus phage P092, complete genome) position: , mismatch: 2, identity: 0.933

ttagtattaaatataatatcaacaccttta	CRISPR spacer
ttagtattgaatataacatcaacaccttta	Protospacer
********.*******.*************

5. spacer 1.1|810041|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to MK448887 (Streptococcus phage Javan258, complete genome) position: , mismatch: 5, identity: 0.833

cctcaccatcaggcaaagaccttgatacct	CRISPR spacer
caagcccatcaggcaaaaaccttgatacct	Protospacer
*    ************.************

6. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045608 (Bacillus cereus strain SB1 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.833

atatatatcaatggaaataccaa-aacgttt	CRISPR spacer
atatatatctatcgaaataccaataacatc-	Protospacer
********* ** ********** ***.*. 

7. spacer 1.4|810239|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 6, identity: 0.8

caagtcttgcaacaacaagtatccactaca----	CRISPR spacer
caagacttgcaacaacaagt----actagattat	Protospacer
**** ***************    **** *    

8. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134432 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 23) position: , mismatch: 6, identity: 0.8

atatatatcaatggaaataccaaaacgttt	CRISPR spacer
atcaatttccatggaaataccaaaacgggt	Protospacer
**  ** ** *****************  *

9. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_LR214999 (Mycoplasma conjunctivae strain NCTC10147 plasmid 3) position: , mismatch: 6, identity: 0.8

ttagtattaaatataatatcaacaccttta----	CRISPR spacer
ttagtattaaatttaatatcaa----ttgaaaga	Protospacer
************ *********    ** *    

10. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to LR214965 (Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11) position: , mismatch: 6, identity: 0.8

ttagtattaaatataatatcaacaccttta----	CRISPR spacer
ttagtattaaatttaatatcaa----ttgaaaga	Protospacer
************ *********    ** *    

11. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NC_015418 (Clostridium botulinum BKT015925 plasmid p3BKT015925, complete sequence) position: , mismatch: 6, identity: 0.8

ttagtattaaatataatatcaacaccttta	CRISPR spacer
tttaatttaaatataatatcaccaacttta	Protospacer
** .  *************** ** *****

12. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to AP014355 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

----ttagtattaaatataatatcaacaccttta	CRISPR spacer
aattttggt----aagataatatcaacaccttta	Protospacer
    **.**    ** ******************

13. spacer 1.1|810041|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to MN855587 (Siphoviridae sp. isolate 137, complete genome) position: , mismatch: 7, identity: 0.767

cctcaccatcaggcaaagaccttgatacct	CRISPR spacer
gcaaaccatctggctaagaccttgatagtt	Protospacer
 *  ****** *** ************ .*

14. spacer 1.1|810041|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to KX397365 (Erwinia phage vB_EamM_Caitlin, complete genome) position: , mismatch: 7, identity: 0.767

cctcaccatcaggcaaagaccttgatacct	CRISPR spacer
gctccccatcagggaaagaccttgttcgat	Protospacer
 *** ******** ********** *   *

15. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to AP011616 (Thermus phage phiYS40 DNA, complete genome) position: , mismatch: 7, identity: 0.767

atatatatcaatggaaataccaaaacgttt	CRISPR spacer
taatatatcaatggaaacactaaaacagct	Protospacer
  ***************.**.*****. .*

16. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to DQ997624 (Thermus thermophilus phage YS40, complete genome) position: , mismatch: 7, identity: 0.767

atatatatcaatggaaataccaaaacgttt	CRISPR spacer
taatatatcaatggaaacactaaaacagct	Protospacer
  ***************.**.*****. .*

17. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to NC_015937 (Thermus phage TMA, complete genome) position: , mismatch: 7, identity: 0.767

atatatatcaatggaaataccaaaacgttt	CRISPR spacer
taatatatcaatggaaacactaaaacaact	Protospacer
  ***************.**.*****. .*

18. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to NC_008584 (Thermus phage phiYS40, complete genome) position: , mismatch: 7, identity: 0.767

atatatatcaatggaaataccaaaacgttt	CRISPR spacer
taatatatcaatggaaacactaaaacagct	Protospacer
  ***************.**.*****. .*

19. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to AP011617 (Thermus phage TMA DNA, complete genome) position: , mismatch: 7, identity: 0.767

atatatatcaatggaaataccaaaacgttt	CRISPR spacer
taatatatcaatggaaacactaaaacaact	Protospacer
  ***************.**.*****. .*

20. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_CP045792 (Campylobacter coli strain CFSAN032805 plasmid p2CFSAN032805, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

21. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_CP023547 (Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_2, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

22. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_CP040242 (Campylobacter coli strain S9 plasmid pCcS9_3, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

23. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NC_022656 (Campylobacter coli 15-537360 plasmid pCC42yr, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

24. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to CP013736 (Campylobacter coli strain OR12 plasmid pOR12CC42, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

25. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_CP017867 (Campylobacter coli strain YF2105 plasmid pCCDM105S, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

26. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_CP017880 (Campylobacter coli strain BG2108 plasmid pCCDM108S, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

27. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_CP017874 (Campylobacter coli strain WA333 plasmid pCCDM33S, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

28. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_MH634990 (Campylobacter coli strain XK3140 plasmid pCCDM140S, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

29. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_CP028188 (Campylobacter coli strain CFSAN054106 plasmid pGMI16-001, complete sequence) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagtaataaatataatatccacactatga	Protospacer
  **** ************* ****. * *

30. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to MT774393 (CrAssphage cr127_1, complete genome) position: , mismatch: 7, identity: 0.767

ttagtattaaatataatatc-aacaccttta	CRISPR spacer
atagtattaaatataatattaaatataatt-	Protospacer
 ******************. **.*.  ** 

31. spacer 1.1|810041|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to MN693543 (Marine virus AFVG_25M469, complete genome) position: , mismatch: 8, identity: 0.733

cctcaccatcaggcaaagaccttgatacct	CRISPR spacer
tgcatccatcaggctacgaccttgatacat	Protospacer
. .  ********* * *********** *

32. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NZ_CP017256 (Clostridium taeniosporum strain 1/k plasmid pCt3, complete sequence) position: , mismatch: 8, identity: 0.733

ttagtattaaatataatatcaacaccttta	CRISPR spacer
aaagaattaaatataatatcaacaaccaac	Protospacer
  ** ******************* *.   

33. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to MN693959 (Marine virus AFVG_250M1110, complete genome) position: , mismatch: 8, identity: 0.733

ttagtattaaatataatatcaacaccttta	CRISPR spacer
gacatattatatataatatcaaaacctaaa	Protospacer
   .***** ************ ****  *

34. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 9, identity: 0.7

atatatatcaatggaaataccaaaacgttt	CRISPR spacer
gaagatataaatggaaataccaaaagtagg	Protospacer
. * **** ****************     

35. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 9, identity: 0.7

atatatatcaatggaaataccaaaacgttt	CRISPR spacer
gaagatataaatggaaataccaaaagtagg	Protospacer
. * **** ****************     

36. spacer 1.5|810305|30|NZ_CP017952|PILER-CR,CRISPRCasFinder,CRT matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 9, identity: 0.7

atatatatcaatggaaataccaaaacgttt	CRISPR spacer
gaagatataaatggaaataccaaaagtagg	Protospacer
. * **** ****************     

37. spacer 1.8|810503|30|NZ_CP017952|CRISPRCasFinder,CRT matches to NC_010183 (Bacillus mycoides KBAB4 plasmid pBWB404, complete sequence) position: , mismatch: 9, identity: 0.7

ttagtattaaatataatatcaacaccttta	CRISPR spacer
gggaaattaaaaataatatcgacaccttag	Protospacer
  .. ****** ********.******* .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4321 : 71656 48 Bacillus_phage(28.57%) transposase,protease,tRNA NA
DBSCAN-SWA_2 83943 : 133113 39 Bacillus_phage(33.33%) transposase,tRNA NA
DBSCAN-SWA_3 184796 : 244120 55 Bacillus_phage(27.27%) transposase,protease,holin NA
DBSCAN-SWA_4 621567 : 688023 56 Enterococcus_phage(21.43%) transposase,tRNA NA
DBSCAN-SWA_5 915880 : 924253 8 Bacillus_virus(16.67%) NA NA
DBSCAN-SWA_6 935802 : 984035 44 Streptococcus_phage(21.43%) transposase,bacteriocin,tRNA NA
DBSCAN-SWA_7 1021879 : 1143758 111 Bacillus_phage(15.62%) transposase,integrase,protease,tRNA attL 1020894:1020915|attR 1069776:1069797
DBSCAN-SWA_8 1351963 : 1406313 51 Staphylococcus_phage(35.0%) transposase,tRNA NA
DBSCAN-SWA_9 1453481 : 1469291 20 Streptococcus_phage(80.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage