Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018116 Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence 0 crisprs DEDDh,csa3,cas14j 0 0 1 0
NZ_CP018117 Escherichia coli strain MRSN346638 plasmid pMRSN346638_67.9, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP018119 Escherichia coli strain MRSN346638 plasmid pMRSN346638_61.1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP018118 Escherichia coli strain MRSN346638 plasmid pMRSN346638_64.5, complete sequence 0 crisprs c2c9_V-U4 0 0 1 0
NZ_CP018120 Escherichia coli strain MRSN346638 plasmid pMRSN346638_5.3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP018115 Escherichia coli strain MRSN346638 chromosome, complete genome 5 crisprs DinG,cas3,c2c9_V-U4,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,RT 0 10 9 0

Results visualization

1. NZ_CP018118
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7521 : 13976 9 Escherichia_phage(33.33%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP018116
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5003 : 43042 36 Escherichia_phage(33.33%) integrase,transposase attL 11666:11681|attR 48267:48282

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP018117
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 50697 : 61313 10 Escherichia_phage(71.43%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP018115
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018115_1 468474-468618 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018115_2 608663-608759 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018115_3 3034721-3034933 TypeI-E I-E
3 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018115_4 3063420-3064058 Orphan I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018115_5 4670851-4671000 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018115_4 4.2|3063510|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR 3063510-3063541 32 KT898133 Aeromonas phage phiARM81ld, complete genome 45655-45686 2 0.938
NZ_CP018115_3 3.1|3034753|29|NZ_CP018115|PILER-CR 3034753-3034781 29 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 295848-295876 6 0.793
NZ_CP018115_3 3.2|3034814|29|NZ_CP018115|PILER-CR 3034814-3034842 29 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347887 6 0.793
NZ_CP018115_4 4.8|3063876|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR 3063876-3063907 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP018115_4 4.6|3063754|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR 3063754-3063785 32 KC821619 Cellulophaga phage phi18:1, complete genome 6924-6955 7 0.781
NZ_CP018115_4 4.6|3063754|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR 3063754-3063785 32 KC821627 Cellulophaga phage phi18:2, complete genome 6924-6955 7 0.781
NZ_CP018115_3 3.5|3034812|32|NZ_CP018115|CRT 3034812-3034843 32 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347890 8 0.75
NZ_CP018115_4 4.2|3063510|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR 3063510-3063541 32 MN901520 Halorubrum coriense virus Hardycor2, complete genome 16524-16555 8 0.75
NZ_CP018115_4 4.7|3063815|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR 3063815-3063846 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP018115_4 4.10|3063998|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR 3063998-3064029 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP018115_4 4.10|3063998|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR 3063998-3064029 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP018115_3 3.4|3034751|32|NZ_CP018115|CRT 3034751-3034782 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 11267-11298 9 0.719
NZ_CP018115_4 4.6|3063754|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR 3063754-3063785 32 NZ_CP020483 Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence 383-414 9 0.719
NZ_CP018115_1 1.1|468517|59|NZ_CP018115|CRISPRCasFinder 468517-468575 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP018115_1 1.1|468517|59|NZ_CP018115|CRISPRCasFinder 468517-468575 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814

1. spacer 4.2|3063510|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR matches to KT898133 (Aeromonas phage phiARM81ld, complete genome) position: , mismatch: 2, identity: 0.938 

acgaacgcggcacaccagggcgtctcatcgtc	CRISPR spacer
acgaacgcggcgcaccagggcgtctcgtcgtc	Protospacer
***********.**************.*****

2. spacer 3.1|3034753|29|NZ_CP018115|PILER-CR matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 6, identity: 0.793 

gtcaataggcggcgtcccgtagccgtccc	CRISPR spacer
gtgttttcgcggcgtcccgtagccgcccc	Protospacer
**   *  *****************.***

3. spacer 3.2|3034814|29|NZ_CP018115|PILER-CR matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793 

gttgaggtcgataagtacgaacggtttcc	CRISPR spacer
gaagaggtcgatgagtacgaatggttaca	Protospacer
*  *********.********.**** *

4. spacer 4.8|3063876|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812 

gagagcgaggggagattccggcagggcgtgca	CRISPR spacer
aatcgtgaggggatcttccggcagggcgtgca	Protospacer
.*  *.*******  *****************

5. spacer 4.6|3063754|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR matches to KC821619 (Cellulophaga phage phi18:1, complete genome) position: , mismatch: 7, identity: 0.781 

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****

6. spacer 4.6|3063754|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR matches to KC821627 (Cellulophaga phage phi18:2, complete genome) position: , mismatch: 7, identity: 0.781 

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****

7. spacer 3.5|3034812|32|NZ_CP018115|CRT matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gttgaggtcgataagtacgaacggtttccctg	CRISPR spacer
gaagaggtcgatgagtacgaatggttacagcg	Protospacer
*  *********.********.**** *  .*

8. spacer 4.2|3063510|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR matches to MN901520 (Halorubrum coriense virus Hardycor2, complete genome) position: , mismatch: 8, identity: 0.75 

acgaacgcggcacaccagggcgtctcatcgtc--	CRISPR spacer
ccgaacgcggcacacccgagcg--tcggcggcgg	Protospacer
 *************** *.***  **. ** *

9. spacer 4.7|3063815|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75 

taatatccc----tggcgataatcaaccggcttact	CRISPR spacer
----acgccatggtggcgataatcatcctgcttact	Protospacer
    *. **    ************ ** *******

10. spacer 4.10|3063998|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75 

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.*

11. spacer 4.10|3063998|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.*

12. spacer 3.4|3034751|32|NZ_CP018115|CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcaataggcggcgtcccgtagccgtcccctt	CRISPR spacer
gtgctctggcggcgtgccgtagccatccccga	Protospacer
**   . ******** ********.*****

13. spacer 4.6|3063754|32|NZ_CP018115|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020483 (Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence) position: , mismatch: 9, identity: 0.719 

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
tagcctttattttcactcaaaacaataaaagt	Protospacer
    * ******** ** ***********. *

14. spacer 1.1|468517|59|NZ_CP018115|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831 

ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg-	CRISPR spacer
gagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgat-cgtgcactga	Protospacer
*.   ************ ****************************.**  **** *.*

15. spacer 1.1|468517|59|NZ_CP018115|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814 

-ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg	CRISPR spacer
tcgcacca-aaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgtacc	Protospacer
  *..*** ***********************.**************** ***.  * *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 201313 : 274157 58 uncultured_Caudovirales_phage(20.0%) plate,tRNA,transposase,protease NA
DBSCAN-SWA_2 281337 : 338880 45 Enterobacteria_phage(45.45%) transposase,integrase attL 275762:275777|attR 307962:307977
DBSCAN-SWA_3 1237311 : 1328804 112 Escherichia_phage(29.55%) tRNA,transposase,holin,tail,protease,terminase,integrase,portal,head,capsid attL 1254151:1254166|attR 1309952:1309967
DBSCAN-SWA_4 1332034 : 1338474 10 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_5 2597083 : 2603456 8 Enterobacteria_phage(33.33%) transposase,integrase attL 2598144:2598166|attR 2610992:2611014
DBSCAN-SWA_6 2857313 : 2974925 112 Erwinia_phage(20.75%) plate,tRNA,transposase,head,tail,terminase,integrase,portal,capsid attL 2854252:2854267|attR 2937402:2937417
DBSCAN-SWA_7 3011226 : 3018366 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_8 4000822 : 4011412 12 Enterobacteria_phage(88.89%) integrase attL 4000640:4000662|attR 4011889:4011911
DBSCAN-SWA_9 4644626 : 4699359 49 Enterobacteria_phage(26.32%) tRNA,transposase,holin,protease,integrase attL 4653550:4653565|attR 4681453:4681468

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage