Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid unnamed 0 crisprs NA 0 0 0 0
NZ_CP018074 Streptomyces venezuelae strain NRRL B-65442 chromosome 22 crisprs csa3,WYL,DEDDh,cas4,cas3,DinG,RT 3 6 7 0

Results visualization

1. NZ_CP018074
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_1 791497-791604 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_2 860811-860879 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_3 1637684-1637798 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_4 1681962-1682023 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_5 1682123-1682281 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_6 1692729-1692808 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_7 1865998-1866089 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_8 2237815-2237919 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_9 2264401-2264488 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_10 2428793-2428897 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_11 2533852-2533992 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_12 3119812-3119986 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_13 3518725-3518832 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_14 3593366-3593563 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_16 4465035-4465102 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_15 4464894-4464971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_17 4535821-4535920 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_18 5475434-5475552 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_19 5587858-5587973 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_20 5787431-5787533 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_21 7448049-7448220 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018074_22 7761209-7761294 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP018074_12 12.2|3119866|18|NZ_CP018074|CRT 3119866-3119883 18 NZ_CP018074.1 5534737-5534754 1 0.944
NZ_CP018074_2 2.1|860836|19|NZ_CP018074|CRISPRCasFinder 860836-860854 19 NZ_CP018074.1 4505305-4505323 2 0.895
NZ_CP018074_5 5.2|1682198|22|NZ_CP018074|CRISPRCasFinder 1682198-1682219 22 NZ_CP018074.1 2951607-2951628 2 0.909

1. spacer 12.2|3119866|18|NZ_CP018074|CRT matches to position: 5534737-5534754, mismatch: 1, identity: 0.944

ctctcagggctctacctc	CRISPR spacer
ctctccgggctctacctc	Protospacer
***** ************

2. spacer 2.1|860836|19|NZ_CP018074|CRISPRCasFinder matches to position: 4505305-4505323, mismatch: 2, identity: 0.895

tccacccgggggcgggtgc	CRISPR spacer
tccacccggggccgggcgc	Protospacer
*********** ****.**

3. spacer 5.2|1682198|22|NZ_CP018074|CRISPRCasFinder matches to position: 2951607-2951628, mismatch: 2, identity: 0.909

cggggcgggcggtgacggcacc	CRISPR spacer
cggagcgggcggtgacggaacc	Protospacer
***.************** ***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018074_12 12.4|3119938|31|NZ_CP018074|CRT 3119938-3119968 31 KU958700 Streptomyces phage Chymera, complete genome 29429-29459 0 1.0
NZ_CP018074_5 5.2|1682198|22|NZ_CP018074|CRISPRCasFinder 1682198-1682219 22 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 410566-410587 2 0.909
NZ_CP018074_5 5.2|1682198|22|NZ_CP018074|CRISPRCasFinder 1682198-1682219 22 NZ_CP022194 Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence 83926-83947 3 0.864
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013412 Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence 34198-34226 5 0.828
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP010016 Burkholderia thailandensis 34 plasmid unnamed, complete sequence 251708-251736 5 0.828
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 32791-32819 5 0.828
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 58761-58789 5 0.828
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 279337-279365 5 0.828
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 302733-302761 5 0.828
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 251673-251701 5 0.828
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 709984-710012 5 0.828
NZ_CP018074_14 14.1|3593384|30|NZ_CP018074|CRT 3593384-3593413 30 NZ_CP018077 Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence 168908-168937 5 0.833
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 190179-190207 5 0.828
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 81811-81839 5 0.828
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 132499-132527 5 0.828
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1373622-1373650 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5463077-5463105 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1124494-1124522 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1007884-1007912 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1705238-1705266 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP022192 Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence 55158-55186 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1823234-1823262 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 140803-140831 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1572990-1573018 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1823232-1823260 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 26926-26954 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 199381-199409 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 656519-656547 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_008383 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL8, complete sequence 96625-96653 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 276810-276838 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 257152-257180 6 0.793
NZ_CP018074_12 12.4|3119938|31|NZ_CP018074|CRT 3119938-3119968 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 93706-93736 6 0.806
NZ_CP018074_14 14.1|3593384|30|NZ_CP018074|CRT 3593384-3593413 30 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 252258-252287 6 0.8
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 511813-511841 6 0.793
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 582999-583027 6 0.793
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NC_010851 Streptomyces sp. FR1 plasmid pFRL1, complete sequence 7825-7853 6 0.793
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 21182-21210 6 0.793
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 883190-883218 6 0.793
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 MH746817 Achromobacter phage vB_Ade_ART, complete genome 82591-82619 6 0.793
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 107091-107119 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_001759 Streptomyces phaeochromogenes plasmid pJV1, complete sequence 6925-6953 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 26128-26156 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 160153-160181 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 264417-264445 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 401206-401234 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 177134-177162 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 16419-16447 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_007950 Polaromonas sp. JS666 plasmid 2, complete sequence 9216-9244 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 333123-333151 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 314124-314152 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_016972 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence 43523-43551 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 326992-327020 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_004688 Mycobacterium phage Omega, complete genome 9899-9927 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 AY129338 Mycobacterium virus Omega, complete genome 9899-9927 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 JF937101 Mycobacterium virus LittleE, complete genome 8372-8400 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 KM400683 Mycobacterium phage Ariel, complete genome 7371-7399 7 0.759
NZ_CP018074_14 14.1|3593384|30|NZ_CP018074|CRT 3593384-3593413 30 NZ_CP018077 Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence 137872-137901 7 0.767
NZ_CP018074_14 14.1|3593384|30|NZ_CP018074|CRT 3593384-3593413 30 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1264032-1264061 7 0.767
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1695126-1695154 7 0.759
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 KX758539 Mycobacterium phage Jaan, complete genome 34881-34909 7 0.759
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 MK279857 Mycobacterium phage IronMan, complete genome 34709-34737 7 0.759
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 EU744250 Mycobacterium virus Pukovnik, complete genome 34378-34406 7 0.759
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NC_031279 Mycobacterium phage Bactobuster, complete genome 34526-34554 7 0.759
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 20536-20564 7 0.759
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 104677-104705 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 385835-385863 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 306056-306084 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_017805 Deinococcus gobiensis I-0 plasmid P1, complete sequence 280468-280496 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 543002-543030 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 595779-595807 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 598322-598350 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 637639-637667 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 591671-591699 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 623974-624002 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 612262-612290 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 606094-606122 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 623974-624002 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 591671-591699 8 0.724
NZ_CP018074_5 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder 1682146-1682174 29 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 597519-597547 8 0.724
NZ_CP018074_12 12.4|3119938|31|NZ_CP018074|CRT 3119938-3119968 31 KU958700 Streptomyces phage Chymera, complete genome 29330-29360 8 0.742
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 106408-106436 8 0.724
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_LR723678 Arsenite-oxidising bacterium NT-25 plasmid 2 30147-30175 8 0.724
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_FO082821 Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence 111368-111396 8 0.724
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_FO082821 Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence 314212-314240 8 0.724
NZ_CP018074_6 6.1|1692753|32|NZ_CP018074|CRISPRCasFinder 1692753-1692784 32 MT701587 Burkholderia phage Magia, complete genome 16105-16136 9 0.719
NZ_CP018074_21 21.2|7448149|29|NZ_CP018074|PILER-CR 7448149-7448177 29 NZ_LN809998 Pseudomonas aeruginosa strain MH19 plasmid pPAMH19, complete sequence 27193-27221 9 0.69

1. spacer 12.4|3119938|31|NZ_CP018074|CRT matches to KU958700 (Streptomyces phage Chymera, complete genome) position: , mismatch: 0, identity: 1.0

tcaggtagggggacagtcccccgagggggtg	CRISPR spacer
tcaggtagggggacagtcccccgagggggtg	Protospacer
*******************************

2. spacer 5.2|1682198|22|NZ_CP018074|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.909

cggggcgggcggtgacggcacc	CRISPR spacer
cggggcgggcggtgtcggcacg	Protospacer
************** ****** 

3. spacer 5.2|1682198|22|NZ_CP018074|CRISPRCasFinder matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.864

cggggcgggcggtgacggcacc	CRISPR spacer
cggggcgggcggtgacggcctg	Protospacer
******************* . 

4. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 5, identity: 0.828

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcacagctcgtggcggcgggcatc	Protospacer
********* *****.*********.. *

5. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcacagctcgtggcggcgggcatc	Protospacer
********* *****.*********.. *

6. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcggtgctcgcggcggcgggcctc	Protospacer
*******. ****************.  *

7. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 5, identity: 0.828

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcgctgcttgcggcggcggtcgcc	Protospacer
*******.*****.********** .* *

8. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 5, identity: 0.828

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
aggcggaacttctcgcggcggcgggcgcc	Protospacer
 ***** *** **************.* *

9. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 5, identity: 0.828

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
gggcggcactgctgggggcggcgggcgcc	Protospacer
 ************ * *********.* *

10. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

cggcggcactgctcgcggcggcgggtgac-	CRISPR spacer
cggcggcgctgctcgcggcgg-acgtgtcg	Protospacer
*******.************* . *** * 

11. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 5, identity: 0.828

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cgatggcgctgctggcggcggcgggtgcc	Protospacer
**..***.***** ************* *

12. spacer 14.1|3593384|30|NZ_CP018074|CRT matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

gcatccgcgccggccttcctaccggccacc	CRISPR spacer
gggcccgcgccggccttcataccggcctcc	Protospacer
* ..************** ******** **

13. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

cacccggccggcgcccaagccggtcacca	CRISPR spacer
gatccggtcggcgcccgagccggtcaccg	Protospacer
 *.****.********.***********.

14. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 5, identity: 0.828

cacccggccggcgcccaagccggtcacca	CRISPR spacer
gatccggtcggcgcccgagccggtcaccg	Protospacer
 *.****.********.***********.

15. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

cacccggccggcgcccaagccggtcacca	CRISPR spacer
gatccggtcggcgcccgagccggtcaccg	Protospacer
 *.****.********.***********.

16. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcactgctcgctgcggcgagccga	Protospacer
**************** ******.*. . 

17. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tcgaggcactggtcgcggccgcgggtggc	Protospacer
. * ******* ******* *******.*

18. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcactgatcgccgcggcggggctg	Protospacer
*********** **** ********    

19. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcactgatcgccgcggcggggctg	Protospacer
*********** **** ********    

20. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcagcactggtcgcggcggcggaaggg	Protospacer
****.****** ************. *. 

21. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tggcggcacggctcgaggcggcggggctc	Protospacer
.******** ***** *********   *

22. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcaccggtcgcggcggcgcctgct	Protospacer
*********.* ***********  ** .

23. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
ccgcggcgctgctcggggcggcgggattc	Protospacer
* *****.******* *********   *

24. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcactgcacgaggcggcgatcgag	Protospacer
************ ** *******. .** 

25. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcaccggtcgcggcggcgcctgct	Protospacer
*********.* ***********  ** .

26. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tggcgggcctgctcgcggcggcggcgcac	Protospacer
.*****  ****************   **

27. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tggcggcgctgctcgccgcggcggtcgag	Protospacer
.******.******** ******* .** 

28. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
gggcggcgctgctggcggcggcggtttcc	Protospacer
 ******.***** ********** *  *

29. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_008383 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL8, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
ctgcggcactgcttgctgcggcgggcacc	Protospacer
* ***********.** ********.. *

30. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcaccggtcgcggcggcgcctgct	Protospacer
*********.* ***********  ** .

31. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcaccggtcgcggcggcgcctgct	Protospacer
*********.* ***********  ** .

32. spacer 12.4|3119938|31|NZ_CP018074|CRT matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 6, identity: 0.806

tcaggtagggggacagtcccccgagggggtg	CRISPR spacer
ttagttgagggggcagtcccccgagggggtt	Protospacer
*.** *..****.***************** 

33. spacer 14.1|3593384|30|NZ_CP018074|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 6, identity: 0.8

gcatccgcgccggccttcctaccg-gccacc	CRISPR spacer
tcatccgcgccggccttgccaccgtgccgg-	Protospacer
 **************** *.**** ***.  

34. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 6, identity: 0.793

cacccggccggcgcccaagccggtcacca	CRISPR spacer
ctttccgccgccgcccaagccggccacca	Protospacer
* ..* **** ************.*****

35. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 6, identity: 0.793

cacccggccggcgcccaagccggtcacca	CRISPR spacer
catccggccggcgcgcaagccggtgccgc	Protospacer
**.*********** *********  *  

36. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NC_010851 (Streptomyces sp. FR1 plasmid pFRL1, complete sequence) position: , mismatch: 6, identity: 0.793

cacccggccggcgcccaagccggtcacca	CRISPR spacer
cacccgcccggcgcccaagtcggccggcg	Protospacer
****** ************.***.*. *.

37. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 6, identity: 0.793

cacccggccggcgcccaagccggtcacca	CRISPR spacer
gatctggtcggcgcccgagccggtcaccg	Protospacer
 *.*.**.********.***********.

38. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

cacccggccggcgcccaagccggtcacca	CRISPR spacer
caccgggccggcgcgcaagccggcgccct	Protospacer
**** ********* ********.  ** 

39. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to MH746817 (Achromobacter phage vB_Ade_ART, complete genome) position: , mismatch: 6, identity: 0.793

cacccggccggcgcccaagccggtcacca	CRISPR spacer
ctcccggctggggcccaagccggtctctt	Protospacer
* ******.** ************* *. 

40. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggccgcactgctcgccgcggcggcgctg	Protospacer
**** *********** *******     

41. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_001759 (Streptomyces phaeochromogenes plasmid pJV1, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcagtactcgcggcggcggcctgt	Protospacer
******** *.************* . ..

42. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tggcggccctgctagcggcggcggcggtt	Protospacer
.****** ***** **********  * .

43. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
gggcggcgctgctggcggcggcggtttcg	Protospacer
 ******.***** ********** *   

44. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
gcggggcagtgcccgcggcggcgggtgcg	Protospacer
  * **** ***.**************  

45. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
gggcggcgctgctggcggcggcggtttcg	Protospacer
 ******.***** ********** *   

46. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tggcggcatcgctcgcggcggcggccatc	Protospacer
.*******..************** .. *

47. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tcgcggcactgctggcggtggcgggcgtg	Protospacer
. *********** ****.******.*  

48. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
aggcggcgctgctggcggcggcggcccgc	Protospacer
 ******.***** ********** . .*

49. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
gggcggccctgctggcggcggcggcggcg	Protospacer
 ****** ***** **********  *  

50. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
aggcggcactgcttgcggcggtggagagc	Protospacer
 ************.*******.**. ..*

51. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_016972 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
gggccgcgctgctcgcggcggcggccctc	Protospacer
 *** **.**************** .  *

52. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
gggcggcgctgctggcggcggcggtttcg	Protospacer
 ******.***** ********** *   

53. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_004688 (Mycobacterium phage Omega, complete genome) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tgcgcgcactgcgcgcggcggcggttgaa	Protospacer
.*   ******* *********** *** 

54. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to AY129338 (Mycobacterium virus Omega, complete genome) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tgcgcgcactgcgcgcggcggcggttgaa	Protospacer
.*   ******* *********** *** 

55. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to JF937101 (Mycobacterium virus LittleE, complete genome) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tgcgcgcactgcgcgcggcggcggttgaa	Protospacer
.*   ******* *********** *** 

56. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to KM400683 (Mycobacterium phage Ariel, complete genome) position: , mismatch: 7, identity: 0.759

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
tgcgcgcactgcgcgcggcggcggttgaa	Protospacer
.*   ******* *********** *** 

57. spacer 14.1|3593384|30|NZ_CP018074|CRT matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gcatccgcgccggccttcctaccggccacc	CRISPR spacer
ggcagcgcgccggccttcatcccggccagc	Protospacer
*    ************* * ******* *

58. spacer 14.1|3593384|30|NZ_CP018074|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.767

gcatccgcgccggccttcctaccggccacc	CRISPR spacer
acgaccgcgccggcctttctaccagccgct	Protospacer
.*. *************.*****.***.*.

59. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

cacccggccggcgcccaagccggtcacca	CRISPR spacer
ggcggtgccggtgcccacgccggtcacca	Protospacer
 .*   *****.***** ***********

60. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to KX758539 (Mycobacterium phage Jaan, complete genome) position: , mismatch: 7, identity: 0.759

cacccggccggcgcccaagccggtcacca	CRISPR spacer
gtcccagccggcccccaagccggtcgtcg	Protospacer
  ***.****** ************..*.

61. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to MK279857 (Mycobacterium phage IronMan, complete genome) position: , mismatch: 7, identity: 0.759

cacccggccggcgcccaagccggtcacca	CRISPR spacer
gtcccagccggcccccaagccggtcgtcg	Protospacer
  ***.****** ************..*.

62. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to EU744250 (Mycobacterium virus Pukovnik, complete genome) position: , mismatch: 7, identity: 0.759

cacccggccggcgcccaagccggtcacca	CRISPR spacer
gtcccagccggcccccaagccggtcgtcg	Protospacer
  ***.****** ************..*.

63. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NC_031279 (Mycobacterium phage Bactobuster, complete genome) position: , mismatch: 7, identity: 0.759

cacccggccggcgcccaagccggtcacca	CRISPR spacer
gtcccagccggcccccaagccggtcgtcg	Protospacer
  ***.****** ************..*.

64. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.759

cacccggccggcgcccaagccggtcacca	CRISPR spacer
atggccgccggcgccgaagcgggtcacca	Protospacer
    * ********* **** ********

65. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
ccctttgtctgcgcgcggcggcgggtgac	Protospacer
*  .    **** ****************

66. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
cggcggcgctgctcgcggcggtcacgctc	Protospacer
*******.*************. .    *

67. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

68. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
aggcggcgctgctcgcggcggcccagacc	Protospacer
 ******.**************  . . *

69. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

70. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

71. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

72. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

73. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

74. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

75. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

76. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

77. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

78. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

79. spacer 5.1|1682146|29|NZ_CP018074|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 8, identity: 0.724

cggcggcactgctcgcggcggcgggtgac	CRISPR spacer
atccggcaccgctcgcggcggcggctctg	Protospacer
   ******.************** *   

80. spacer 12.4|3119938|31|NZ_CP018074|CRT matches to KU958700 (Streptomyces phage Chymera, complete genome) position: , mismatch: 8, identity: 0.742

tcaggtagggggacagtcccccgagggggtg	CRISPR spacer
agaggtaggggcactgtcccccgaggtatcg	Protospacer
  ********* ** *********** . .*

81. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 8, identity: 0.724

cacccggccggcgcccaagccggtcacca	CRISPR spacer
gacccggccggcgccgaagccgaaggtcg	Protospacer
 ************** ******.  ..*.

82. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_LR723678 (Arsenite-oxidising bacterium NT-25 plasmid 2) position: , mismatch: 8, identity: 0.724

cacccggccggcgcccaagccggtcacca	CRISPR spacer
ttcccggccggcgcccgagccgggagcgc	Protospacer
. **************.******  .*  

83. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 8, identity: 0.724

cacccggccggcgcccaagccggtcacca	CRISPR spacer
ttcccggccggcgcccgagccgggagcgc	Protospacer
. **************.******  .*  

84. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 8, identity: 0.724

cacccggccggcgcccaagccggtcacca	CRISPR spacer
ttcccggccggcgcccgagccgggagcgc	Protospacer
. **************.******  .*  

85. spacer 6.1|1692753|32|NZ_CP018074|CRISPRCasFinder matches to MT701587 (Burkholderia phage Magia, complete genome) position: , mismatch: 9, identity: 0.719

cccgccgcg------cggctgctagggcgtgacggtcg	CRISPR spacer
------gtgggacatcggctgctggggcgagacggtcg	Protospacer
      *.*      ********.***** ********

86. spacer 21.2|7448149|29|NZ_CP018074|PILER-CR matches to NZ_LN809998 (Pseudomonas aeruginosa strain MH19 plasmid pPAMH19, complete sequence) position: , mismatch: 9, identity: 0.69

cacccggccggcgcccaagccggtcacca	CRISPR spacer
cacccggccggcgcgcaagccttcggtgg	Protospacer
************** ******  . .. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1565075 : 1572267 8 Bacillus_virus(16.67%) NA NA
DBSCAN-SWA_2 2287502 : 2295540 17 Mycobacterium_phage(28.57%) NA NA
DBSCAN-SWA_3 2314970 : 2322901 9 Streptomyces_phage(33.33%) capsid,portal,terminase NA
DBSCAN-SWA_4 2327586 : 2338597 8 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_5 3115017 : 3150791 54 Streptomyces_phage(98.11%) capsid,portal,head,integrase,terminase,tail attL 3114817:3114841|attR 3149559:3149583
DBSCAN-SWA_6 4697734 : 4716058 14 Streptomyces_phage(72.73%) tail NA
DBSCAN-SWA_7 6319947 : 6372584 40 uncultured_Caudovirales_phage(25.0%) plate,tail,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage