Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP016628 Escherichia coli strain FORC_041 chromosome, complete genome 6 crisprs csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,RT,DEDDh,c2c9_V-U4,DinG 0 11 6 0

Results visualization

1. NZ_CP016628
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016628_1 610792-610909 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016628_2 1118926-1119259 TypeI-E I-E
5 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016628_3 1134761-1135277 TypeI-E I-E
8 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016628_4 2264029-2264152 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016628_5 3002905-3002996 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP016628_6 3277718-3277857 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_KY020154 Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence 112539-112570 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_KY270851 Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence 180673-180704 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 213091-213122 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 160690-160721 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 256-287 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 15889-15920 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 237787-237818 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 227491-227522 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 229761-229792 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 16705-16736 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 45747-45778 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 96804-96835 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 156967-156998 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 89323-89354 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 171731-171762 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 121115-121146 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 237538-237569 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 31968-31999 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 308546-308577 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 235709-235740 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 141685-141716 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 206257-206288 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 161011-161042 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 58380-58411 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 102938-102969 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 162354-162385 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 154531-154562 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 217889-217920 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 160798-160829 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 161121-161152 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 161066-161097 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 27673-27704 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 302946-302977 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 159519-159550 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 39113-39144 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 160574-160605 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 160901-160932 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 162734-162765 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 160635-160666 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 161011-161042 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 160537-160568 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 158323-158354 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 152653-152684 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 152087-152118 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 160642-160673 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 160426-160457 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 98185-98216 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_KY020154 Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence 112539-112570 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_KY270851 Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence 180673-180704 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 213091-213122 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 160690-160721 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 256-287 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 15889-15920 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 237787-237818 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 227491-227522 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 229761-229792 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 16705-16736 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 45747-45778 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 96804-96835 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 156967-156998 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 89323-89354 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 171731-171762 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 121115-121146 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 237538-237569 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 31968-31999 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 308546-308577 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 235709-235740 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 141685-141716 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 206257-206288 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 161011-161042 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 58380-58411 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 102938-102969 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 162354-162385 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 154531-154562 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 217889-217920 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 160798-160829 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 161121-161152 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 161066-161097 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 27673-27704 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 302946-302977 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 159519-159550 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 39113-39144 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 160574-160605 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 160901-160932 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 160809-160840 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 162734-162765 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 160635-160666 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 161011-161042 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 160537-160568 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 158323-158354 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 152653-152684 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 152087-152118 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 160642-160673 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 160426-160457 0 1.0
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 98185-98216 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
NZ_CP016628_5 5.1|3002931|40|NZ_CP016628|CRISPRCasFinder 3002931-3002970 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 105238-105269 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 66553-66584 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 74796-74827 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 118045-118076 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 240380-240411 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 46729-46760 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 37723-37754 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 25676-25707 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 32465-32496 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 100635-100666 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 138368-138399 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 96788-96819 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 84184-84215 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 137391-137422 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 173749-173780 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 238532-238563 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 149374-149405 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 84184-84215 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 176730-176761 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 82749-82780 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 199740-199771 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 75569-75600 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 7793-7824 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 26064-26095 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 9386-9417 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 153222-153253 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 21836-21867 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 86682-86713 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 84185-84216 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 MH114596 Salmonella enterica strain 13-1681 plasmid p131681, complete sequence 146901-146932 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 227807-227838 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 194221-194252 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 100302-100333 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 213332-213363 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 67687-67718 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 116189-116220 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 124872-124903 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 93474-93505 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 93527-93558 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 185399-185430 1 0.969
NZ_CP016628_3 3.5|1135037|32|NZ_CP016628|PILER-CR 1135037-1135068 32 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 34232-34263 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 105238-105269 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 66553-66584 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 74796-74827 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 118045-118076 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 240380-240411 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 46729-46760 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 37723-37754 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 25676-25707 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 32465-32496 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 100635-100666 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 138368-138399 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 96788-96819 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 84184-84215 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 137391-137422 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 173749-173780 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 238532-238563 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 149374-149405 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 84184-84215 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 176730-176761 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 82749-82780 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 199740-199771 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 75569-75600 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 7793-7824 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 26064-26095 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 9386-9417 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 153222-153253 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 21836-21867 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 86682-86713 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 84185-84216 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 MH114596 Salmonella enterica strain 13-1681 plasmid p131681, complete sequence 146901-146932 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 227807-227838 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 194221-194252 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 100302-100333 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 213332-213363 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 67687-67718 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 116189-116220 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 124872-124903 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 93474-93505 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 93527-93558 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 185399-185430 1 0.969
NZ_CP016628_3 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT 1135034-1135065 32 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 34232-34263 1 0.969
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
NZ_CP016628_3 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT 1135217-1135248 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
NZ_CP016628_4 4.1|2264072|38|NZ_CP016628|CRISPRCasFinder 2264072-2264109 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP016628_3 3.8|1134912|32|NZ_CP016628|CRISPRCasFinder,CRT 1134912-1134943 32 MN693292 Marine virus AFVG_25M2, complete genome 18744-18775 5 0.844
NZ_CP016628_2 2.3|1119077|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT 1119077-1119108 32 NC_017140 Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence 5097-5128 9 0.719
NZ_CP016628_2 2.5|1119199|32|NZ_CP016628|CRISPRCasFinder,CRT 1119199-1119230 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
NZ_CP016628_3 3.6|1135098|32|NZ_CP016628|PILER-CR 1135098-1135129 32 NZ_CP041206 Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence 474256-474287 9 0.719
NZ_CP016628_3 3.11|1135095|32|NZ_CP016628|CRISPRCasFinder,CRT 1135095-1135126 32 NZ_CP041206 Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence 474256-474287 9 0.719
NZ_CP016628_2 2.4|1119138|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT 1119138-1119169 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33041-33072 10 0.688
NZ_CP016628_2 2.4|1119138|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT 1119138-1119169 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 217865-217896 10 0.688
NZ_CP016628_2 2.4|1119138|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT 1119138-1119169 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 208000-208031 10 0.688
NZ_CP016628_2 2.4|1119138|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT 1119138-1119169 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 208000-208031 10 0.688
NZ_CP016628_2 2.5|1119199|32|NZ_CP016628|CRISPRCasFinder,CRT 1119199-1119230 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688

1. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_KY020154 (Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

2. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_KY270851 (Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

3. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

4. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

5. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

6. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

7. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

8. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

9. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

10. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

11. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

12. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

13. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

14. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

15. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

16. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

17. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

18. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

19. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

20. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

21. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

22. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

23. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

24. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

25. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

26. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

27. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

28. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

29. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

30. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

31. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

32. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

33. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

34. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

35. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

36. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

37. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

38. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

39. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

40. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

41. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

42. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

43. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

44. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

45. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

46. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

47. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

48. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

49. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

50. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

51. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_KY020154 (Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

52. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_KY270851 (Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

53. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

54. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

55. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

56. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

57. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

58. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

59. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

60. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

61. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

62. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

63. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

64. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

65. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

66. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

67. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

68. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

69. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

70. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

71. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

72. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

73. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

74. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

75. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

76. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

77. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

78. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

79. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

80. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

81. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

82. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

83. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

84. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

85. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

86. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

87. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

88. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

89. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

90. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

91. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

92. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

93. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

94. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

95. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

96. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

97. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

98. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

99. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

100. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccagccgttcagtattgccggtgtcagcaaaa	Protospacer
********************************

101. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

102. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

103. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

104. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

105. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

106. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

107. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

108. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

109. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

110. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

111. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

112. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

113. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

114. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

115. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

116. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

117. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

118. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

119. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

120. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

121. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

122. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

123. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

124. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt	Protospacer
********************************

125. spacer 5.1|3002931|40|NZ_CP016628|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

126. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

127. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

128. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

129. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

130. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

131. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

132. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

133. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

134. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

135. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

136. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

137. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

138. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

139. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

140. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

141. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

142. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

143. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

144. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

145. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

146. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

147. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

148. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

149. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

150. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

151. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

152. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

153. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

154. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

155. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to MH114596 (Salmonella enterica strain 13-1681 plasmid p131681, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

156. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

157. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

158. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

159. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

160. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

161. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

162. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

163. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

164. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

165. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

166. spacer 3.5|1135037|32|NZ_CP016628|PILER-CR matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

167. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

168. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

169. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

170. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

171. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

172. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

173. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

174. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

175. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

176. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

177. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

178. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

179. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

180. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

181. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

182. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

183. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

184. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

185. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

186. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

187. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

188. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

189. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

190. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

191. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

192. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

193. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

194. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

195. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

196. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MH114596 (Salmonella enterica strain 13-1681 plasmid p131681, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

197. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

198. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

199. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

200. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

201. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

202. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

203. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

204. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

205. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

206. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

207. spacer 3.10|1135034|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 1, identity: 0.969

ccagccgttcagtattgccggtgtcagcaaaa	CRISPR spacer
ccaaccgttcagtattgccggtgtcagcaaaa	Protospacer
***.****************************

208. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

209. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt	Protospacer
***.******** *******************

210. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

211. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt	Protospacer
****************.***** *********

212. spacer 3.13|1135217|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938

ggtaaaaacacggtctgaaccgacattcatgt	CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt	Protospacer
************ * *****************

213. spacer 4.1|2264072|38|NZ_CP016628|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

214. spacer 3.8|1134912|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MN693292 (Marine virus AFVG_25M2, complete genome) position: , mismatch: 5, identity: 0.844

gtgtggta--attggtggtctggctggtggttta	CRISPR spacer
--ttggtagtatcggtggtttggctggtggttta	Protospacer
   *****  **.******.**************

215. spacer 2.3|1119077|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaagaagaaagggaaataatgcgaggaacg	CRISPR spacer
atggagaagaaagggaaacaaagcgagcgcgg	Protospacer
 .*.**************.** ***** .  *

216. spacer 2.5|1119199|32|NZ_CP016628|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* ***** 

217. spacer 3.6|1135098|32|NZ_CP016628|PILER-CR matches to NZ_CP041206 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence) position: , mismatch: 9, identity: 0.719

gaaaagctacttttgtgttcaactgatgcatt	CRISPR spacer
caatccgaccttttgtgttcgactgatggatt	Protospacer
 **      ***********.******* ***

218. spacer 3.11|1135095|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP041206 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence) position: , mismatch: 9, identity: 0.719

gaaaagctacttttgtgttcaactgatgcatt	CRISPR spacer
caatccgaccttttgtgttcgactgatggatt	Protospacer
 **      ***********.******* ***

219. spacer 2.4|1119138|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

220. spacer 2.4|1119138|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

221. spacer 2.4|1119138|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

222. spacer 2.4|1119138|32|NZ_CP016628|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

223. spacer 2.5|1119199|32|NZ_CP016628|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1151632 : 1158772 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_2 1504263 : 1543266 61 Enterobacteria_phage(55.17%) holin,portal,lysis,head,coat,tail,terminase NA
DBSCAN-SWA_3 1779595 : 1789037 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 2656118 : 2723461 74 Stx2-converting_phage(30.61%) portal,holin,integrase,head,protease,tail,terminase,capsid attL 2669897:2669924|attR 2723598:2723625
DBSCAN-SWA_5 2826545 : 2897493 88 Escherichia_phage(40.3%) tRNA,portal,integrase,holin,head,protease,tail,terminase,capsid attL 2850216:2850230|attR 2897595:2897609
DBSCAN-SWA_6 3495613 : 3557069 71 Enterobacteria_phage(62.5%) portal,integrase,lysis,head,protease,tail,transposase,terminase,capsid attL 3504094:3504140|attR 3557083:3557129
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage