1. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043507 (Acetobacter sp. KACC 21233 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggcccagacgctgtccctgacgctggccc CRISPR spacer
gctggcccaggcgctggccctgacgcatgcgc Protospacer
**********.***** ********* ** *
2. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040642 (Agrobacterium sp. T29 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
cagagcgaggatatcggccatctcacgatcgc-- Protospacer
**** **************** * ******.
3. spacer 1.3|1531052|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038237 (Leisingera sp. NJS201 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
caccgcatc--gaagaccctcaccgcatcgagcg CRISPR spacer
--ctgcagcaggaagaccctgaccggatcgagcg Protospacer
*.*** * ********* **** ********
4. spacer 2.11|1541382|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.818
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
gcggcggggcccagcaattccagcgccgcgcgc Protospacer
*** .* **********.*************
5. spacer 2.29|1541384|33|NZ_CP018192|PILER-CR matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.818
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
gcggcggggcccagcaattccagcgccgcgcgc Protospacer
*** .* **********.*************
6. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to NC_001271 (Yersinia phage phiYeO3-12, complete genome) position: , mismatch: 6, identity: 0.786
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgatagggtgc Protospacer
******** ** ***********.*.
7. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to AJ251805 (Bacteriophage phiYeO3-12 complete genome) position: , mismatch: 6, identity: 0.786
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgatagggtgc Protospacer
******** ** ***********.*.
8. spacer 5.28|1843954|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017887 (Pseudomonas frederiksbergensis strain ERDD5:01 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
gccgagcaagccgcgttgatccgcgcagggcgg CRISPR spacer
gtcgagcaagccgcgttgatcctcgcgctgctg Protospacer
*.******************** ***. ** *
9. spacer 6.11|1927669|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818
--ctgggtcaaaaaatgcgcttgcaggcacatcta CRISPR spacer
gactgag--aaaaaatgcggttgcaggcaaatcaa Protospacer
***.* ********** ********* *** *
10. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gctggcccagacgctgtccctgacgctggccc CRISPR spacer
gcagcgccagacgctgtggctgacgctggcga Protospacer
** * *********** ***********
11. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781
gctggcccagacgctgtccctgacgctggccc CRISPR spacer
gcgcggcgagacgccgtcgctgacgctggccg Protospacer
** * * ******.*** ************
12. spacer 1.3|1531052|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 7, identity: 0.781
caccgcatcgaagaccctcaccg-catcgagcg CRISPR spacer
caccgcatcgaagaccgtctccgaggacgggc- Protospacer
**************** ** *** . **.**
13. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
14. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
15. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
16. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
17. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
18. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
19. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
20. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
21. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
22. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
23. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
gcgaacagcggcagcatcgccaccatgcgcag Protospacer
* * *** *************** *****
24. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to KY000037 (Agrobacterium sp. strain LBA4404 plasmid pTi_LBA4404, complete sequence) position: , mismatch: 7, identity: 0.781
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
gagagcgaggatatcggccatctcgcgatcac-- Protospacer
*** **************** * *****..
25. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to KY000037 (Agrobacterium sp. strain LBA4404 plasmid pTi_LBA4404, complete sequence) position: , mismatch: 7, identity: 0.781
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
gagagcgaggatatcggccatctcgcgatcac-- Protospacer
*** **************** * *****..
26. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026926 (Agrobacterium tumefaciens strain 1D1609 plasmid pTi1D1609, complete sequence) position: , mismatch: 7, identity: 0.781
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
gagagcgaggatatcggccatctcgcgatcac-- Protospacer
*** **************** * *****..
27. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011249 (Agrobacterium tumefaciens strain Ach5 plasmid pTi, complete sequence) position: , mismatch: 7, identity: 0.781
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
gagagcgaggatatcggccatctcgcgatcac-- Protospacer
*** **************** * *****..
28. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_002377 (Agrobacterium tumefaciens plasmid Ti, complete sequence) position: , mismatch: 7, identity: 0.781
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
gagagcgaggatatcggccatctcgcgatcac-- Protospacer
*** **************** * *****..
29. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032920 (Agrobacterium tumefaciens strain 15955 plasmid pTi15955, complete sequence) position: , mismatch: 7, identity: 0.781
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
gagagcgaggatatcggccatctcgcgatcac-- Protospacer
*** **************** * *****..
30. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033030 (Agrobacterium tumefaciens strain A6 plasmid pTiA6, complete sequence) position: , mismatch: 7, identity: 0.781
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
gagagcgaggatatcggccatctcgcgatcac-- Protospacer
*** **************** * *****..
31. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY000030 (Agrobacterium genomosp. 1 strain CFBP5767 plasmid pTi_CFBP5767, complete sequence) position: , mismatch: 7, identity: 0.781
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
gagagcgaggatatcggccatctcgcgatcac-- Protospacer
*** **************** * *****..
32. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY000061 (Agrobacterium tumefaciens strain CFBP2413 plasmid pTi_CFBP2413, complete sequence) position: , mismatch: 7, identity: 0.781
cagatcgaggatatcggccatat--cgatcgtcc CRISPR spacer
gagagcgaggatatcggccatctcgcgatcac-- Protospacer
*** **************** * *****..
33. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.781
cagatc---gaggatatcggccatatcgatcgtcc CRISPR spacer
---atcccggtagatatcggtcatctcgatcgtcc Protospacer
*** * .********.*** **********
34. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to KP313531 (Citrobacter phage phiCFP-1, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
35. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to MT813142 (Klebsiella phage NL_ZS_3, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
36. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to MF285617 (Leclercia phage 10164RH, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
37. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to KT008108 (Yersinia phage phiYe-F10, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
38. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to MT419366 (Serratia phage SALSA, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
39. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to NC_010807 (Salmonella phage phiSG-JL2, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
40. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to MK608335 (Klebsiella phage Patroon, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
41. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to MN013074 (Klebsiella phage vB_KpnP_Emp27, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
42. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to KU687348 (Citrobacter phage SH2, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
43. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to MH717709 (Escherichia phage LL2, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
44. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to MF285616 (Leclercia phage 10164-302, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
45. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to NC_047774 (Serratia phage SM9-3Y, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
46. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to NC_025451 (Yersinia phage vB_YenP_AP5, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
47. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to NC_031066 (Citrobacter phage SH1, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
48. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to KP791807 (Enterobacter phage E-4, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
49. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to KP791805 (Enterobacter phage E-2, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
50. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to NC_047856 (UNVERIFIED: Enterobacter phage KNP3 genomic sequence) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
51. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to KX452696 (UNVERIFIED: Enterobacter phage KPN3 genomic sequence) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
52. spacer 3.1|1796845|28|NZ_CP018192|CRISPRCasFinder matches to NC_028795 (Enterobacter phage E-3, complete genome) position: , mismatch: 7, identity: 0.75
gccattgatggaagcactgatagagctg CRISPR spacer
gccattgaaggcagcactgataggatgc Protospacer
******** ** ***********...
53. spacer 3.2|1796896|28|NZ_CP018192|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.75
acctgccaccagaatgttggaagcacta CRISPR spacer
gcctgccgccagaatgctggaagccgat Protospacer
.******.********.*******
54. spacer 5.15|1843161|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.788
gccacggcacagagcggcgcgaggcggatatcg- CRISPR spacer
tggacgacacagagcggcgcaaggcgg-tgtcga Protospacer
***.*************.****** *.***
55. spacer 6.9|1927547|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 7, identity: 0.788
tcaggatcagcctgccgcaagacccgggccagg CRISPR spacer
taaagatcagcgtgccgcaagacccggggttcg Protospacer
* *.******* **************** . *
56. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034838 (Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence) position: , mismatch: 8, identity: 0.75
gctggcccagacgctgtccctgacgctggccc CRISPR spacer
gctggcccagccgctgtccgtgaccgccgcag Protospacer
********** ******** **** . **
57. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034839 (Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence) position: , mismatch: 8, identity: 0.75
gctggcccagacgctgtccctgacgctggccc CRISPR spacer
gctggcccagccgctgtccgtgaccgccgcag Protospacer
********** ******** **** . **
58. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75
gctggcccagacgctgtccctgacgctggccc CRISPR spacer
gtcgaggcagacgccgtcgctgacgctggcac Protospacer
*..*. *******.*** *********** *
59. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75
gctggcccagacgctgtccctgacgctggccc CRISPR spacer
gtcgaggcagacgccgtcgctgacgctggcac Protospacer
*..*. *******.*** *********** *
60. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to MF472896 (Mycobacterium phage JoshKayV, complete genome) position: , mismatch: 8, identity: 0.75
--gctggcccagacgctgtccctgacgctggccc CRISPR spacer
caact--tccagacgctctcccagacgctggtca Protospacer
.** .********* **** ********.*
61. spacer 1.3|1531052|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.75
caccgcatcgaagaccctcaccgcatcgagcg CRISPR spacer
gaccgcatcgacgaccttcaccgcggtggccg Protospacer
********** ****.*******. .*. **
62. spacer 1.3|1531052|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 8, identity: 0.75
caccgcatcgaagaccctcaccgcatcgagcg CRISPR spacer
caccgcaacgaagaacctcaccggcgcggtca Protospacer
******* ****** ******** **. *.
63. spacer 1.3|1531052|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
caccgca-tcgaagaccctcaccgcatcgagcg CRISPR spacer
-gccgtgctcgaacaccatcaccgcatcgagtc Protospacer
.***.. ***** *** *************.
64. spacer 1.3|1531052|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.75
caccgcatcgaagaccctcaccgcatcgagcg CRISPR spacer
gaccgcatcgacgaccttcaccgcggtggccg Protospacer
********** ****.*******. .*. **
65. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cagta-gagccgcagcatcgccaccaagcgcat CRISPR spacer
-aatatcgaccgcagcagcgccaccatgcgcac Protospacer
*.** ..******** ******** *****.
66. spacer 5.4|1842490|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgattccatcacctggctggcctcggcgg-- CRISPR spacer
ttggcgatttcatcatctggctggc--cgaccgca Protospacer
..*******.*****.********* **.* *
67. spacer 5.4|1842490|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgattccatcacctggctggcctcggcgg-- CRISPR spacer
ttggcgatttcatcatctggctggc--cgaccgca Protospacer
..*******.*****.********* **.* *
68. spacer 5.4|1842490|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgattccatcacctggctggcctcggcgg-- CRISPR spacer
ttggcgatttcatcatctggctggc--cgaccgca Protospacer
..*******.*****.********* **.* *
69. spacer 5.9|1842795|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_048201 (Pseudomonas phage 17A genome assembly 17A, chromosome : 1) position: , mismatch: 8, identity: 0.758
gcga-ttgctgttccttggcgatttccgcaggac CRISPR spacer
-cgacctgatgttccttggcgatgtccgcatcca Protospacer
*** .** ************** ******
70. spacer 6.15|1927913|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_016655 (Rhodococcus phage REQ1, complete genome) position: , mismatch: 8, identity: 0.758
ctggtcattcagggcgcggaactcggcagccag CRISPR spacer
gtcgtccttcagggcgcggtactcggccccctt Protospacer
* *** ************ ******* **
71. spacer 6.32|1928950|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013204 (Paenibacillus sp. IHB B 3084 plasmid pHD01, complete sequence) position: , mismatch: 8, identity: 0.758
tgcgtcacgtatgtaggaaatattcgctatccg CRISPR spacer
ttcacaccgtatggaggaaatattcgcaatctg Protospacer
* *.. ****** ************* ***.*
72. spacer 6.35|1927122|31|NZ_CP018192|PILER-CR matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 8, identity: 0.742
tcaccatgacagagctgtcagccccgccagc CRISPR spacer
acgccataacagagctgtcagcaccgttaat Protospacer
*.****.************** ***..*..
73. spacer 6.35|1927122|31|NZ_CP018192|PILER-CR matches to MF479730 (Aeromonas phage AS-gz, complete genome) position: , mismatch: 8, identity: 0.742
tcaccatgacagagctgtcagccccgccagc CRISPR spacer
tcaccatgacagagtggtcagccgtaacaat Protospacer
**************. ******* .. **..
74. spacer 1.1|1530930|32|NZ_CP018192|CRISPRCasFinder,CRT matches to MN855665 (Bacteriophage sp. isolate 358, complete genome) position: , mismatch: 9, identity: 0.719
ggcgattaaggtcggcatcggctgactgactg CRISPR spacer
tgcgataaaggtctgcatcggctggtaggttc Protospacer
***** ****** **********.. *..*
75. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to KX641263 (Mycobacterium phage Kalpine, complete genome) position: , mismatch: 9, identity: 0.719
--gctggcccagacgctgtccctgacgctggccc CRISPR spacer
caact--tccagacgctctcccagacgctggtga Protospacer
.** .********* **** ********.
76. spacer 1.3|1531052|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014601 (Yangia sp. CCB-MM3 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
caccgcatcgaagaccctcaccgcatcgagcg CRISPR spacer
caccgcatcgaacaccctcgccgatgtcgacg Protospacer
************ ******.*** . ..**
77. spacer 1.3|1531052|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014601 (Yangia sp. CCB-MM3 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
caccgcatcgaagaccctcaccgcatcgagcg CRISPR spacer
caccgcatcgaacaccctcgccgatgtcgacg Protospacer
************ ******.*** . ..**
78. spacer 1.3|1531052|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014601 (Yangia sp. CCB-MM3 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
caccgcatcgaagaccctcaccgcatcgagcg CRISPR spacer
caccgcatcgaacaccctcgccgatgtcgacg Protospacer
************ ******.*** . ..**
79. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 9, identity: 0.719
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
atgtagagccgcaggaacgccaccagcgccag Protospacer
************ * ********. **
80. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cagatcgaggatatcggccatatcgatcgtcc-- CRISPR spacer
caggtcgaagatatcggccatat--gctggctga Protospacer
***.****.************** ...* *.
81. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.719
cagatcgaggatatcggccatatcgatcgtcc CRISPR spacer
ggcatcgaggagatcggccatctcgagcaggc Protospacer
. ******** ********* **** *. *
82. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.719
cagatcgaggatatcggccatatcgatcgtcc CRISPR spacer
ggcatcgaggagatcggccatctcgagcaggc Protospacer
. ******** ********* **** *. *
83. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.719
cagatcgaggatatcggccatatcgatcgtcc CRISPR spacer
ggcatcgaggagatcggccatctcgagcaggc Protospacer
. ******** ********* **** *. *
84. spacer 1.10|1531479|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 9, identity: 0.719
cagatcgaggatatcggccatatcgatcgtcc CRISPR spacer
ctgatcgaggatttcggctatatcgccgacct Protospacer
* ********** *****.****** . ..*.
85. spacer 1.15|1531784|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719
attctccggtccggtgtcgaaaagcgcctctg CRISPR spacer
cggcaccggcccggtggcgaaaagcgcctgca Protospacer
* ****.****** ************ ..
86. spacer 2.1|1540772|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
cagccagcaggcattggcggatcgtgtcggcac CRISPR spacer
ctagcttcaggttttggcggatcgtgtcggcga Protospacer
* . * ****. ******************.
87. spacer 2.7|1541138|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.727
gcccttccacagcctctggaaatcgggaccaca CRISPR spacer
gcccttccacagcttctggacatccacgacgcg Protospacer
*************.****** *** . . *.*.
88. spacer 2.7|1541138|33|NZ_CP018192|CRISPRCasFinder,CRT matches to LR606152 (Rhizobium sp. Q54 genome assembly, plasmid: 9) position: , mismatch: 9, identity: 0.727
gcccttccacagcctctggaaatcgggaccaca CRISPR spacer
gcccttccacagcttctggacatccacgacgcg Protospacer
*************.****** *** . . *.*.
89. spacer 2.11|1541382|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
tccggctcgcgcagcaaccccagcgccgcgcgc Protospacer
* .*** ******.**************
90. spacer 2.11|1541382|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
tccggctcgcgcagcaaccccagcgccgcgcgc Protospacer
* .*** ******.**************
91. spacer 2.11|1541382|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
tccggctcgcgcagcaaccccagcgccgcgcgc Protospacer
* .*** ******.**************
92. spacer 2.11|1541382|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
tccggctcgcgcagcaaccccagcgccgcgcgc Protospacer
* .*** ******.**************
93. spacer 2.11|1541382|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP021357 (Rhodococcus sp. S2-17 plasmid pRB11, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg------ CRISPR spacer
tcgcggccgcccagcaagcccagcg------ggtgtatt Protospacer
*** ************ ******* **
94. spacer 2.11|1541382|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg------ CRISPR spacer
tcgcggccgcccagcaagcccagcg------ggtgtatt Protospacer
*** ************ ******* **
95. spacer 2.14|1541565|33|NZ_CP018192|CRISPRCasFinder,CRT matches to MN850581 (Escherichia phage sortkaff, complete genome) position: , mismatch: 9, identity: 0.727
cggcaatagagccgcaggtaggcgacgagtgga CRISPR spacer
tgccgcctaagccgcagttaggcgacgagggga Protospacer
.* *. . .******** *********** ***
96. spacer 2.14|1541565|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NC_047862 (Klebsiella phage vB_KpnS_IME279, complete genome) position: , mismatch: 9, identity: 0.727
cggcaatagagccgcaggtaggcgacgagtgga CRISPR spacer
tgccgcctaagccgcagttaggcgacgagggga Protospacer
.* *. . .******** *********** ***
97. spacer 2.19|1540774|33|NZ_CP018192|PILER-CR matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
cagccagcaggcattggcggatcgtgtcggcac CRISPR spacer
ctagcttcaggttttggcggatcgtgtcggcga Protospacer
* . * ****. ******************.
98. spacer 2.25|1541140|33|NZ_CP018192|PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.727
gcccttccacagcctctggaaatcgggaccaca CRISPR spacer
gcccttccacagcttctggacatccacgacgcg Protospacer
*************.****** *** . . *.*.
99. spacer 2.25|1541140|33|NZ_CP018192|PILER-CR matches to LR606152 (Rhizobium sp. Q54 genome assembly, plasmid: 9) position: , mismatch: 9, identity: 0.727
gcccttccacagcctctggaaatcgggaccaca CRISPR spacer
gcccttccacagcttctggacatccacgacgcg Protospacer
*************.****** *** . . *.*.
100. spacer 2.29|1541384|33|NZ_CP018192|PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
tccggctcgcgcagcaaccccagcgccgcgcgc Protospacer
* .*** ******.**************
101. spacer 2.29|1541384|33|NZ_CP018192|PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
tccggctcgcgcagcaaccccagcgccgcgcgc Protospacer
* .*** ******.**************
102. spacer 2.29|1541384|33|NZ_CP018192|PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
tccggctcgcgcagcaaccccagcgccgcgcgc Protospacer
* .*** ******.**************
103. spacer 2.29|1541384|33|NZ_CP018192|PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg CRISPR spacer
tccggctcgcgcagcaaccccagcgccgcgcgc Protospacer
* .*** ******.**************
104. spacer 2.29|1541384|33|NZ_CP018192|PILER-CR matches to NZ_CP021357 (Rhodococcus sp. S2-17 plasmid pRB11, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg------ CRISPR spacer
tcgcggccgcccagcaagcccagcg------ggtgtatt Protospacer
*** ************ ******* **
105. spacer 2.29|1541384|33|NZ_CP018192|PILER-CR matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 9, identity: 0.727
gcgctgccgcccagcaatcccagcgccgcgcgg------ CRISPR spacer
tcgcggccgcccagcaagcccagcg------ggtgtatt Protospacer
*** ************ ******* **
106. spacer 2.32|1541567|33|NZ_CP018192|PILER-CR matches to MN850581 (Escherichia phage sortkaff, complete genome) position: , mismatch: 9, identity: 0.727
cggcaatagagccgcaggtaggcgacgagtgga CRISPR spacer
tgccgcctaagccgcagttaggcgacgagggga Protospacer
.* *. . .******** *********** ***
107. spacer 2.32|1541567|33|NZ_CP018192|PILER-CR matches to NC_047862 (Klebsiella phage vB_KpnS_IME279, complete genome) position: , mismatch: 9, identity: 0.727
cggcaatagagccgcaggtaggcgacgagtgga CRISPR spacer
tgccgcctaagccgcagttaggcgacgagggga Protospacer
.* *. . .******** *********** ***
108. spacer 3.3|1796947|34|NZ_CP018192|CRISPRCasFinder matches to NC_005893 (Lactobacillus phage phiAT3, complete genome) position: , mismatch: 9, identity: 0.735
actgccactgatcagtcccatattgctggtattg CRISPR spacer
acagtgctgaatcaggcacatattgctggtattg Protospacer
** *. . .***** * ****************
109. spacer 3.3|1796947|34|NZ_CP018192|CRISPRCasFinder matches to AY605066 (Bacteriophage phi AT3, complete sequence) position: , mismatch: 9, identity: 0.735
actgccactgatcagtcccatattgctggtattg CRISPR spacer
acagtgctgaatcaggcacatattgctggtattg Protospacer
** *. . .***** * ****************
110. spacer 5.4|1842490|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025432 (Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgattccatcacctggctggcctcggcgg CRISPR spacer
acgcgtcgtccatcacccggctggcctcgtcga Protospacer
** *********.*********** **.
111. spacer 5.16|1843222|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_017443 (Erwinia sp. Ejp617 plasmid pJE03, complete sequence) position: , mismatch: 9, identity: 0.727
cgcaccagcgggacacgggacaggcccgggcgt CRISPR spacer
cgcaccagcgggccacgcgacagggagaagggc Protospacer
************ **** ****** ..* *.
112. spacer 5.28|1843954|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.727
gccgagcaagccgcgttgatccgcgcagggcgg CRISPR spacer
cacggcgtcgccgcgctgatccgcgaagggcgg Protospacer
**. ******.********* *******
113. spacer 5.28|1843954|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to AP014345 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S38-C47, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.727
gccgagcaagccgcgttgatccgcgcagggcgg CRISPR spacer
gcgcagcaagccgcgcagatccgcgcagctgaa Protospacer
** ***********. *********** ..
114. spacer 6.3|1927181|33|NZ_CP018192|CRISPRCasFinder,CRT matches to MK737942 (Microbacterium phage Sucha, complete genome) position: , mismatch: 9, identity: 0.727
cgccggtcacgcggcggaggctatctatgccgc CRISPR spacer
cgccggtaacgcggcggcggctattcagtcgaa Protospacer
******* ********* ******..* * .
115. spacer 6.9|1927547|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
tcaggatcagcctgccgcaagacccgggccagg CRISPR spacer
cccggatgagcctgccgcaaggcccggttgatc Protospacer
.* **** *************.***** . *
116. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to MN585968 (Mycobacterium phage Leogania, complete genome) position: , mismatch: 10, identity: 0.688
gctggcccagacgctgtccctgacgctggccc CRISPR spacer
gaacttccagacgctctcccagacgctggtaa Protospacer
* .********* **** ********.
117. spacer 1.2|1530991|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to MN586002 (Mycobacterium phage BiancaTri92, complete genome) position: , mismatch: 10, identity: 0.688
gctggcccagacgctgtccctgacgctggccc CRISPR spacer
gaacttccagacgctctcccagacgctggtaa Protospacer
* .********* **** ********.
118. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.688
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
aggtagagccgcagcagcgcctccaccgccgg Protospacer
.************** **** *** *.
119. spacer 1.11|1531540|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 10, identity: 0.688
gcccgggatgtcagctgccagcgcagcatgtc CRISPR spacer
ttgcgggatgtgagctgccagtgcagcggcat Protospacer
. ******** *********.*****. .
120. spacer 2.6|1541077|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP034238 (Aliivibrio salmonicida strain VS224 plasmid pRVS1-224, complete sequence) position: , mismatch: 10, identity: 0.697
tcaaatggcggccgtattacagcggccccattt CRISPR spacer
gtaaatgacgggcgtattacagcggccagcgaa Protospacer
.*****.*** ***************
121. spacer 2.14|1541565|33|NZ_CP018192|CRISPRCasFinder,CRT matches to MN855787 (Bacteriophage sp. isolate 71, complete genome) position: , mismatch: 10, identity: 0.697
cggcaatagagccgcaggtaggcgacgagtgga CRISPR spacer
tacctcctaagccgcagttaggcgacgagggga Protospacer
.. * . .******** *********** ***
122. spacer 2.14|1541565|33|NZ_CP018192|CRISPRCasFinder,CRT matches to NC_048178 (Escherichia phage Sortsne, complete genome) position: , mismatch: 10, identity: 0.697
cggcaatagagccgcaggtaggcgacgagtgga CRISPR spacer
tacctcctaagccgcagttaggcgacgagggga Protospacer
.. * . .******** *********** ***
123. spacer 2.17|1541748|34|NZ_CP018192|CRISPRCasFinder,CRT matches to NZ_CP026168 (Leclercia sp. LSNIH1 plasmid pLEC-b38d, complete sequence) position: , mismatch: 10, identity: 0.706
cgtttgattgcccgcagaatcatggcgctggcgc CRISPR spacer
agagccagcgccggcagaaccatggcgctggcga Protospacer
* . * .*** ******.*************
124. spacer 2.24|1541079|33|NZ_CP018192|PILER-CR matches to NZ_CP034238 (Aliivibrio salmonicida strain VS224 plasmid pRVS1-224, complete sequence) position: , mismatch: 10, identity: 0.697
tcaaatggcggccgtattacagcggccccattt CRISPR spacer
gtaaatgacgggcgtattacagcggccagcgaa Protospacer
.*****.*** ***************
125. spacer 2.32|1541567|33|NZ_CP018192|PILER-CR matches to MN855787 (Bacteriophage sp. isolate 71, complete genome) position: , mismatch: 10, identity: 0.697
cggcaatagagccgcaggtaggcgacgagtgga CRISPR spacer
tacctcctaagccgcagttaggcgacgagggga Protospacer
.. * . .******** *********** ***
126. spacer 2.32|1541567|33|NZ_CP018192|PILER-CR matches to NC_048178 (Escherichia phage Sortsne, complete genome) position: , mismatch: 10, identity: 0.697
cggcaatagagccgcaggtaggcgacgagtgga CRISPR spacer
tacctcctaagccgcagttaggcgacgagggga Protospacer
.. * . .******** *********** ***
127. spacer 2.35|1541750|34|NZ_CP018192|PILER-CR matches to NZ_CP026168 (Leclercia sp. LSNIH1 plasmid pLEC-b38d, complete sequence) position: , mismatch: 10, identity: 0.706
cgtttgattgcccgcagaatcatggcgctggcgc CRISPR spacer
agagccagcgccggcagaaccatggcgctggcga Protospacer
* . * .*** ******.*************
128. spacer 3.5|1797055|34|NZ_CP018192|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.706
ggcaccactgtcgaccgagacaccatcatcaagg CRISPR spacer
atcctcggcgtcgaccgcgacaccatcatccagt Protospacer
. * .*. .******** ************ **
129. spacer 3.5|1797055|34|NZ_CP018192|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.706
ggcaccactgtcgaccgagacaccatcatcaagg CRISPR spacer
atcctcggcgtcgaccgcgacaccatcatccagt Protospacer
. * .*. .******** ************ **
130. spacer 6.12|1927730|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 10, identity: 0.697
gtgctcggcatgggcaagctcggtgcgcgggaa CRISPR spacer
aagcccggcatgggcaagcgcggtgccgaaggc Protospacer
. **.************** ****** ..*.
131. spacer 6.12|1927730|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 10, identity: 0.697
gtgctcggcatgggcaagctcggtgcgcgggaa CRISPR spacer
aagcccggcatgggcaagcgcggtgccgaaggc Protospacer
. **.************** ****** ..*.
132. spacer 6.12|1927730|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 10, identity: 0.697
gtgctcggcatgggcaagctcggtgcgcgggaa CRISPR spacer
aagcccggcatgggcaagcgcggtgccgaaggc Protospacer
. **.************** ****** ..*.
133. spacer 1.7|1531296|32|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 11, identity: 0.656
cagtagagccgcagcatcgccaccaagcgcat CRISPR spacer
tgcgcgagccgcagcatcggcaccaggccagc Protospacer
.. ************** *****.** ..
134. spacer 6.11|1927669|33|NZ_CP018192|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045303 (Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.667
ctgggtcaaaaaatgcgcttgcaggcacatcta CRISPR spacer
tgttttcaaaaaatgctctagcaggcacagtgc Protospacer
. *********** ** ********* .
