Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018231 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3 0 crisprs RT,DEDDh 0 0 2 0
NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 0 crisprs RT,csa3 0 0 2 0
NZ_CP018228 Rhizobium leguminosarum strain Vaf-108 chromosome, complete genome 3 crisprs csa3,RT,DEDDh,cas3,WYL,cas2,cas1,cas4,cas3HD 10 8 12 0
NZ_CP018232 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP018234 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed6, complete sequence 0 crisprs RT 0 0 2 1
NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 0 crisprs NA 0 0 26 0
NZ_CP018236 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed8 0 crisprs RT 0 0 0 0
NZ_CP018235 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed7, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. NZ_CP018231
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 65909 : 177363 77 Leptospira_phage(14.81%) integrase,transposase attL 71106:71165|attR 178590:181062
DBSCAN-SWA_2 184688 : 251958 55 Salmonella_phage(30.0%) integrase,transposase attL 213194:213212|attR 226026:226044

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP018228
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018228_1 1025717-1026867 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018228_2 4204850-4205148 Unclear NA
4 spacers
cas3HD,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018228_3 4205293-4205661 Unclear NA
3 spacers
cas3HD,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018228.1 1025627-1025644 0 1.0
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018228.1 1025639-1025656 0 1.0
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018228.1 1025651-1025668 0 1.0
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018228.1 1025663-1025680 0 1.0
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018228.1 1025675-1025692 0 1.0
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018228.1 1025687-1025704 0 1.0
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018228.1 1025699-1025716 0 1.0
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018228.1 1025711-1025728 0 1.0
NZ_CP018228_1 1.7|1026508|18|NZ_CP018228|CRT 1026508-1026525 18 NZ_CP018228.1 4656716-4656733 1 0.944
NZ_CP018228_1 1.7|1026508|18|NZ_CP018228|CRT 1026508-1026525 18 NZ_CP018230.1 293927-293944 1 0.944
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018228.1 1025627-1025644 1 0.944
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018228.1 1025639-1025656 1 0.944
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018228.1 1025651-1025668 1 0.944
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018228.1 1025663-1025680 1 0.944
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018228.1 1025675-1025692 1 0.944
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018228.1 1025687-1025704 1 0.944
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018228.1 1025699-1025716 1 0.944
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018228.1 1025711-1025728 1 0.944
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018228.1 807251-807268 1 0.944
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018228.1 1025627-1025644 1 0.944
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018228.1 1025639-1025656 1 0.944
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018228.1 1025651-1025668 1 0.944
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018228.1 1025663-1025680 1 0.944
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018228.1 1025675-1025692 1 0.944
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018228.1 1025687-1025704 1 0.944
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018228.1 1025699-1025716 1 0.944
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018228.1 1025711-1025728 1 0.944
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018228.1 2510729-2510746 1 0.944
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018229.1 383476-383493 1 0.944
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018230.1 68058-68075 1 0.944
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_CP018228.1 1025627-1025680 2 0.963
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_CP018228.1 1025639-1025692 2 0.963
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_CP018228.1 1025651-1025704 2 0.963
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_CP018228.1 1025663-1025716 2 0.963
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_CP018228.1 1025675-1025728 2 0.963
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_CP018228.1 1025687-1025740 2 0.963
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_CP018228.1 1025699-1025752 2 0.963
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_CP018228.1 1025711-1025764 2 0.963
NZ_CP018228_1 1.7|1026508|18|NZ_CP018228|CRT 1026508-1026525 18 NZ_CP018229.1 539031-539048 2 0.889
NZ_CP018228_1 1.7|1026508|18|NZ_CP018228|CRT 1026508-1026525 18 NZ_CP018233.1 75762-75779 2 0.889
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018229.1 383476-383493 2 0.889
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018229.1 722859-722876 2 0.889
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018229.1 1314258-1314275 2 0.889
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018230.1 68058-68075 2 0.889
NZ_CP018228_1 1.9|1026616|18|NZ_CP018228|CRT 1026616-1026633 18 NZ_CP018233.1 92995-93012 2 0.889
NZ_CP018228_1 1.11|1026724|18|NZ_CP018228|CRT 1026724-1026741 18 NZ_CP018230.1 345552-345569 2 0.889
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018229.1 207366-207383 2 0.889
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018229.1 1164382-1164399 2 0.889
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018230.1 68058-68075 2 0.889
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018230.1 436152-436169 2 0.889
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018230.1 502949-502966 2 0.889
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018232.1 212623-212640 2 0.889
NZ_CP018228_1 1.12|1026772|18|NZ_CP018228|CRT 1026772-1026789 18 NZ_CP018234.1 44090-44107 2 0.889
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018229.1 425998-426015 2 0.889
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018229.1 481893-481910 2 0.889
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018229.1 737153-737170 2 0.889
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018229.1 1043882-1043899 2 0.889
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018230.1 62729-62746 2 0.889
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018230.1 436152-436169 2 0.889
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018230.1 449744-449761 2 0.889
NZ_CP018228_1 1.13|1026820|18|NZ_CP018228|CRT 1026820-1026837 18 NZ_CP018232.1 185938-185955 2 0.889
NZ_CP018228_1 1.5|1026328|66|NZ_CP018228|CRT 1026328-1026393 66 NZ_CP018228.1 1025627-1025692 7 0.894
NZ_CP018228_1 1.5|1026328|66|NZ_CP018228|CRT 1026328-1026393 66 NZ_CP018228.1 1025639-1025704 7 0.894
NZ_CP018228_1 1.5|1026328|66|NZ_CP018228|CRT 1026328-1026393 66 NZ_CP018228.1 1025651-1025716 7 0.894
NZ_CP018228_1 1.5|1026328|66|NZ_CP018228|CRT 1026328-1026393 66 NZ_CP018228.1 1025663-1025728 7 0.894
NZ_CP018228_1 1.5|1026328|66|NZ_CP018228|CRT 1026328-1026393 66 NZ_CP018228.1 1025675-1025740 7 0.894
NZ_CP018228_1 1.5|1026328|66|NZ_CP018228|CRT 1026328-1026393 66 NZ_CP018228.1 1025687-1025752 7 0.894
NZ_CP018228_1 1.5|1026328|66|NZ_CP018228|CRT 1026328-1026393 66 NZ_CP018228.1 1025699-1025764 7 0.894
NZ_CP018228_1 1.5|1026328|66|NZ_CP018228|CRT 1026328-1026393 66 NZ_CP018228.1 1025711-1025776 7 0.894
NZ_CP018228_1 1.4|1026208|90|NZ_CP018228|CRT 1026208-1026297 90 NZ_CP018228.1 1025627-1025716 30 0.667
NZ_CP018228_1 1.4|1026208|90|NZ_CP018228|CRT 1026208-1026297 90 NZ_CP018228.1 1025639-1025728 30 0.667
NZ_CP018228_1 1.4|1026208|90|NZ_CP018228|CRT 1026208-1026297 90 NZ_CP018228.1 1025651-1025740 30 0.667
NZ_CP018228_1 1.4|1026208|90|NZ_CP018228|CRT 1026208-1026297 90 NZ_CP018228.1 1025663-1025752 30 0.667
NZ_CP018228_1 1.4|1026208|90|NZ_CP018228|CRT 1026208-1026297 90 NZ_CP018228.1 1025675-1025764 30 0.667
NZ_CP018228_1 1.4|1026208|90|NZ_CP018228|CRT 1026208-1026297 90 NZ_CP018228.1 1025687-1025776 30 0.667
NZ_CP018228_1 1.4|1026208|90|NZ_CP018228|CRT 1026208-1026297 90 NZ_CP018228.1 1025699-1025788 30 0.667
NZ_CP018228_1 1.4|1026208|90|NZ_CP018228|CRT 1026208-1026297 90 NZ_CP018228.1 1025711-1025800 30 0.667
NZ_CP018228_1 1.2|1025915|126|NZ_CP018228|CRT 1025915-1026040 126 NZ_CP018228.1 1025627-1025752 66 0.476
NZ_CP018228_1 1.2|1025915|126|NZ_CP018228|CRT 1025915-1026040 126 NZ_CP018228.1 1025639-1025764 66 0.476
NZ_CP018228_1 1.2|1025915|126|NZ_CP018228|CRT 1025915-1026040 126 NZ_CP018228.1 1025651-1025776 66 0.476
NZ_CP018228_1 1.2|1025915|126|NZ_CP018228|CRT 1025915-1026040 126 NZ_CP018228.1 1025663-1025788 66 0.476
NZ_CP018228_1 1.2|1025915|126|NZ_CP018228|CRT 1025915-1026040 126 NZ_CP018228.1 1025675-1025800 66 0.476
NZ_CP018228_1 1.2|1025915|126|NZ_CP018228|CRT 1025915-1026040 126 NZ_CP018228.1 1025687-1025812 66 0.476
NZ_CP018228_1 1.2|1025915|126|NZ_CP018228|CRT 1025915-1026040 126 NZ_CP018228.1 1025699-1025824 66 0.476
NZ_CP018228_1 1.2|1025915|126|NZ_CP018228|CRT 1025915-1026040 126 NZ_CP018228.1 1025711-1025836 66 0.476
NZ_CP018228_1 1.1|1025747|138|NZ_CP018228|CRT 1025747-1025884 138 NZ_CP018228.1 1025627-1025764 78 0.435
NZ_CP018228_1 1.1|1025747|138|NZ_CP018228|CRT 1025747-1025884 138 NZ_CP018228.1 1025639-1025776 78 0.435
NZ_CP018228_1 1.1|1025747|138|NZ_CP018228|CRT 1025747-1025884 138 NZ_CP018228.1 1025651-1025788 78 0.435
NZ_CP018228_1 1.1|1025747|138|NZ_CP018228|CRT 1025747-1025884 138 NZ_CP018228.1 1025663-1025800 78 0.435
NZ_CP018228_1 1.1|1025747|138|NZ_CP018228|CRT 1025747-1025884 138 NZ_CP018228.1 1025675-1025812 78 0.435
NZ_CP018228_1 1.1|1025747|138|NZ_CP018228|CRT 1025747-1025884 138 NZ_CP018228.1 1025687-1025824 78 0.435
NZ_CP018228_1 1.1|1025747|138|NZ_CP018228|CRT 1025747-1025884 138 NZ_CP018228.1 1025699-1025836 78 0.435
NZ_CP018228_1 1.1|1025747|138|NZ_CP018228|CRT 1025747-1025884 138 NZ_CP018228.1 1025711-1025848 78 0.435

1. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 1025627-1025644, mismatch: 0, identity: 1.0 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
******************

2. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 1025639-1025656, mismatch: 0, identity: 1.0 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
******************

3. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 1025651-1025668, mismatch: 0, identity: 1.0 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
******************

4. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 1025663-1025680, mismatch: 0, identity: 1.0 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
******************

5. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 1025675-1025692, mismatch: 0, identity: 1.0 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
******************

6. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 1025687-1025704, mismatch: 0, identity: 1.0 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
******************

7. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 1025699-1025716, mismatch: 0, identity: 1.0 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
******************

8. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 1025711-1025728, mismatch: 0, identity: 1.0 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
******************

9. spacer 1.7|1026508|18|NZ_CP018228|CRT matches to position: 4656716-4656733, mismatch: 1, identity: 0.944 

tcaccgttgccgccaccg	CRISPR spacer
tcatcgttgccgccaccg	Protospacer
***.**************

10. spacer 1.7|1026508|18|NZ_CP018228|CRT matches to position: 293927-293944, mismatch: 1, identity: 0.944 

tcaccgttgccgccaccg	CRISPR spacer
tcaccgtttccgccaccg	Protospacer
******** *********

11. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 1025627-1025644, mismatch: 1, identity: 0.944 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*********.********

12. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 1025639-1025656, mismatch: 1, identity: 0.944 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*********.********

13. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 1025651-1025668, mismatch: 1, identity: 0.944 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*********.********

14. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 1025663-1025680, mismatch: 1, identity: 0.944 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*********.********

15. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 1025675-1025692, mismatch: 1, identity: 0.944 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*********.********

16. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 1025687-1025704, mismatch: 1, identity: 0.944 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*********.********

17. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 1025699-1025716, mismatch: 1, identity: 0.944 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*********.********

18. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 1025711-1025728, mismatch: 1, identity: 0.944 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*********.********

19. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 807251-807268, mismatch: 1, identity: 0.944 

ccgccattgccgccgccg	CRISPR spacer
ccgcgattgccgccgccg	Protospacer
**** *************

20. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 1025627-1025644, mismatch: 1, identity: 0.944 

ccgccattgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*****.************

21. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 1025639-1025656, mismatch: 1, identity: 0.944 

ccgccattgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*****.************

22. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 1025651-1025668, mismatch: 1, identity: 0.944 

ccgccattgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*****.************

23. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 1025663-1025680, mismatch: 1, identity: 0.944 

ccgccattgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*****.************

24. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 1025675-1025692, mismatch: 1, identity: 0.944 

ccgccattgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*****.************

25. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 1025687-1025704, mismatch: 1, identity: 0.944 

ccgccattgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*****.************

26. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 1025699-1025716, mismatch: 1, identity: 0.944 

ccgccattgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*****.************

27. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 1025711-1025728, mismatch: 1, identity: 0.944 

ccgccattgccgccgccg	CRISPR spacer
ccgccgttgccgccgccg	Protospacer
*****.************

28. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 2510729-2510746, mismatch: 1, identity: 0.944 

ccgccgttgccgccgccg	CRISPR spacer
ccgcggttgccgccgccg	Protospacer
**** *************

29. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 383476-383493, mismatch: 1, identity: 0.944 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgttgccggcgccg	Protospacer
************ *****

30. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 68058-68075, mismatch: 1, identity: 0.944 

ccgccgttgccgccgccg	CRISPR spacer
ccgccggtgccgccgccg	Protospacer
****** ***********

31. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to position: 1025627-1025680, mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccg	Protospacer
*****************************************.********.***

32. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to position: 1025639-1025692, mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccg	Protospacer
*****************************************.********.***

33. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to position: 1025651-1025704, mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccg	Protospacer
*****************************************.********.***

34. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to position: 1025663-1025716, mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccg	Protospacer
*****************************************.********.***

35. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to position: 1025675-1025728, mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccg	Protospacer
*****************************************.********.***

36. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to position: 1025687-1025740, mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccg	Protospacer
*****************************************.********.***

37. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to position: 1025699-1025752, mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccg	Protospacer
*****************************************.********.***

38. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to position: 1025711-1025764, mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccg	Protospacer
*****************************************.********.***

39. spacer 1.7|1026508|18|NZ_CP018228|CRT matches to position: 539031-539048, mismatch: 2, identity: 0.889 

tcaccgttgccgccaccg	CRISPR spacer
tcaccgttgcctccaacg	Protospacer
*********** *** **

40. spacer 1.7|1026508|18|NZ_CP018228|CRT matches to position: 75762-75779, mismatch: 2, identity: 0.889 

tcaccgttgccgccaccg	CRISPR spacer
tctccgttgccgccagcg	Protospacer
** ************ **

41. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 383476-383493, mismatch: 2, identity: 0.889 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgttgccggcgccg	Protospacer
*********.** *****

42. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 722859-722876, mismatch: 2, identity: 0.889 

ccgccgttgtcgccgccg	CRISPR spacer
ccgcccttatcgccgccg	Protospacer
***** **.*********

43. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 1314258-1314275, mismatch: 2, identity: 0.889 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgtattcgccgccg	Protospacer
*******  *********

44. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 68058-68075, mismatch: 2, identity: 0.889 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccggtgccgccgccg	Protospacer
****** **.********

45. spacer 1.9|1026616|18|NZ_CP018228|CRT matches to position: 92995-93012, mismatch: 2, identity: 0.889 

ccgccgttgtcgccgccg	CRISPR spacer
ccgccgtcgtcggcgccg	Protospacer
*******.**** *****

46. spacer 1.11|1026724|18|NZ_CP018228|CRT matches to position: 345552-345569, mismatch: 2, identity: 0.889 

ccaccatggccgccgcca	CRISPR spacer
cctccatgcccgccgcca	Protospacer
** ***** *********

47. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 207366-207383, mismatch: 2, identity: 0.889 

ccgccattgccgccgccg	CRISPR spacer
ccgcgagtgccgccgccg	Protospacer
**** * ***********

48. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 1164382-1164399, mismatch: 2, identity: 0.889 

ccgccattgccgccgccg	CRISPR spacer
ccgccatcgctgccgccg	Protospacer
*******.**.*******

49. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 68058-68075, mismatch: 2, identity: 0.889 

ccgccattgccgccgccg	CRISPR spacer
ccgccggtgccgccgccg	Protospacer
*****. ***********

50. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 436152-436169, mismatch: 2, identity: 0.889 

ccgccattgccgccgccg	CRISPR spacer
ccgcccatgccgccgccg	Protospacer
*****  ***********

51. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 502949-502966, mismatch: 2, identity: 0.889 

ccgccattgccgccgccg	CRISPR spacer
ccgacattgccgccaccg	Protospacer
*** **********.***

52. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 212623-212640, mismatch: 2, identity: 0.889 

ccgccattgccgccgccg	CRISPR spacer
ccggcatcgccgccgccg	Protospacer
*** ***.**********

53. spacer 1.12|1026772|18|NZ_CP018228|CRT matches to position: 44090-44107, mismatch: 2, identity: 0.889 

ccgccattgccgccgccg	CRISPR spacer
ccgcaattgctgccgccg	Protospacer
**** *****.*******

54. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 425998-426015, mismatch: 2, identity: 0.889 

ccgccgttgccgccgccg	CRISPR spacer
ccgacgttgccggcgccg	Protospacer
*** ******** *****

55. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 481893-481910, mismatch: 2, identity: 0.889 

ccgccgttgccgccgccg	CRISPR spacer
ccgtcgttgccgtcgccg	Protospacer
***.********.*****

56. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 737153-737170, mismatch: 2, identity: 0.889 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgaagccgccgccg	Protospacer
******  **********

57. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 1043882-1043899, mismatch: 2, identity: 0.889 

ccgccgttgccgccgccg	CRISPR spacer
ccgacgatgccgccgccg	Protospacer
*** ** ***********

58. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 62729-62746, mismatch: 2, identity: 0.889 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgccgccgccgccg	Protospacer
******..**********

59. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 436152-436169, mismatch: 2, identity: 0.889 

ccgccgttgccgccgccg	CRISPR spacer
ccgcccatgccgccgccg	Protospacer
*****  ***********

60. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 449744-449761, mismatch: 2, identity: 0.889 

ccgccgttgccgccgccg	CRISPR spacer
ccgccgatgccgccaccg	Protospacer
****** *******.***

61. spacer 1.13|1026820|18|NZ_CP018228|CRT matches to position: 185938-185955, mismatch: 2, identity: 0.889 

ccgccgttgccgccgccg	CRISPR spacer
ccgccggtgccgccgacg	Protospacer
****** ******** **

62. spacer 1.5|1026328|66|NZ_CP018228|CRT matches to position: 1025627-1025692, mismatch: 7, identity: 0.894 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgtcg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
*********************************************************.**

63. spacer 1.5|1026328|66|NZ_CP018228|CRT matches to position: 1025639-1025704, mismatch: 7, identity: 0.894 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgtcg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
*********************************************************.**

64. spacer 1.5|1026328|66|NZ_CP018228|CRT matches to position: 1025651-1025716, mismatch: 7, identity: 0.894 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgtcg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
*********************************************************.**

65. spacer 1.5|1026328|66|NZ_CP018228|CRT matches to position: 1025663-1025728, mismatch: 7, identity: 0.894 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgtcg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
*********************************************************.**

66. spacer 1.5|1026328|66|NZ_CP018228|CRT matches to position: 1025675-1025740, mismatch: 7, identity: 0.894 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgtcg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
*********************************************************.**

67. spacer 1.5|1026328|66|NZ_CP018228|CRT matches to position: 1025687-1025752, mismatch: 7, identity: 0.894 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgtcg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
*********************************************************.**

68. spacer 1.5|1026328|66|NZ_CP018228|CRT matches to position: 1025699-1025764, mismatch: 7, identity: 0.894 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgtcg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
*********************************************************.**

69. spacer 1.5|1026328|66|NZ_CP018228|CRT matches to position: 1025711-1025776, mismatch: 7, identity: 0.894 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgtcg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
*********************************************************.**

70. spacer 1.4|1026208|90|NZ_CP018228|CRT matches to position: 1025627-1025716, mismatch: 30, identity: 0.667 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

71. spacer 1.4|1026208|90|NZ_CP018228|CRT matches to position: 1025639-1025728, mismatch: 30, identity: 0.667 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

72. spacer 1.4|1026208|90|NZ_CP018228|CRT matches to position: 1025651-1025740, mismatch: 30, identity: 0.667 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

73. spacer 1.4|1026208|90|NZ_CP018228|CRT matches to position: 1025663-1025752, mismatch: 30, identity: 0.667 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

74. spacer 1.4|1026208|90|NZ_CP018228|CRT matches to position: 1025675-1025764, mismatch: 30, identity: 0.667 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

75. spacer 1.4|1026208|90|NZ_CP018228|CRT matches to position: 1025687-1025776, mismatch: 30, identity: 0.667 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

76. spacer 1.4|1026208|90|NZ_CP018228|CRT matches to position: 1025699-1025788, mismatch: 30, identity: 0.667 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

77. spacer 1.4|1026208|90|NZ_CP018228|CRT matches to position: 1025711-1025800, mismatch: 30, identity: 0.667 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

78. spacer 1.2|1025915|126|NZ_CP018228|CRT matches to position: 1025627-1025752, mismatch: 66, identity: 0.476 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

79. spacer 1.2|1025915|126|NZ_CP018228|CRT matches to position: 1025639-1025764, mismatch: 66, identity: 0.476 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

80. spacer 1.2|1025915|126|NZ_CP018228|CRT matches to position: 1025651-1025776, mismatch: 66, identity: 0.476 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

81. spacer 1.2|1025915|126|NZ_CP018228|CRT matches to position: 1025663-1025788, mismatch: 66, identity: 0.476 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

82. spacer 1.2|1025915|126|NZ_CP018228|CRT matches to position: 1025675-1025800, mismatch: 66, identity: 0.476 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

83. spacer 1.2|1025915|126|NZ_CP018228|CRT matches to position: 1025687-1025812, mismatch: 66, identity: 0.476 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

84. spacer 1.2|1025915|126|NZ_CP018228|CRT matches to position: 1025699-1025824, mismatch: 66, identity: 0.476 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

85. spacer 1.2|1025915|126|NZ_CP018228|CRT matches to position: 1025711-1025836, mismatch: 66, identity: 0.476 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

86. spacer 1.1|1025747|138|NZ_CP018228|CRT matches to position: 1025627-1025764, mismatch: 78, identity: 0.435 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

87. spacer 1.1|1025747|138|NZ_CP018228|CRT matches to position: 1025639-1025776, mismatch: 78, identity: 0.435 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

88. spacer 1.1|1025747|138|NZ_CP018228|CRT matches to position: 1025651-1025788, mismatch: 78, identity: 0.435 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

89. spacer 1.1|1025747|138|NZ_CP018228|CRT matches to position: 1025663-1025800, mismatch: 78, identity: 0.435 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

90. spacer 1.1|1025747|138|NZ_CP018228|CRT matches to position: 1025675-1025812, mismatch: 78, identity: 0.435 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

91. spacer 1.1|1025747|138|NZ_CP018228|CRT matches to position: 1025687-1025824, mismatch: 78, identity: 0.435 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

92. spacer 1.1|1025747|138|NZ_CP018228|CRT matches to position: 1025699-1025836, mismatch: 78, identity: 0.435 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

93. spacer 1.1|1025747|138|NZ_CP018228|CRT matches to position: 1025711-1025848, mismatch: 78, identity: 0.435 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccg	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_LR723676 Rhizobium sp. TCK plasmid 2 121444-121497 2 0.963
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 444876-444929 2 0.963
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 390831-390860 2 0.933
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 390912-390941 2 0.933
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 1017176-1017205 2 0.933
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR723676 Rhizobium sp. TCK plasmid 2 121480-121509 2 0.933
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR723676 Rhizobium sp. TCK plasmid 2 121492-121521 2 0.933
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR723676 Rhizobium sp. TCK plasmid 2 121552-121581 2 0.933
NZ_CP018228_3 3.4|4205460|34|NZ_CP018228|PILER-CR 4205460-4205493 34 NZ_CP050084 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence 287965-287998 2 0.941
NZ_CP018228_3 3.4|4205460|34|NZ_CP018228|PILER-CR 4205460-4205493 34 NZ_CP053209 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence 445100-445133 2 0.941
NZ_CP018228_3 3.4|4205460|34|NZ_CP018228|PILER-CR 4205460-4205493 34 NZ_CP050090 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b4, complete sequence 63927-63960 2 0.941
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 1016972-1017001 3 0.9
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 1016996-1017025 3 0.9
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 446201-446230 3 0.9
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 601021-601050 3 0.9
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 484850-484879 3 0.9
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 382494-382523 3 0.9
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 390984-391013 4 0.867
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 1017008-1017037 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1442727-1442756 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1508949-1508978 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1130866-1130895 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 669624-669653 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 721994-722023 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1560250-1560279 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1336602-1336631 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1442733-1442762 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 298642-298671 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 298157-298186 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1535062-1535091 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 293668-293697 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 293401-293430 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 910546-910575 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 639433-639462 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 543400-543429 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1082195-1082224 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 446722-446751 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 297315-297344 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1051618-1051647 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_041916 Vibrio phage pTD1 DNA, complete genome 130780-130809 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1357196-1357225 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1351655-1351684 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 544799-544828 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1587589-1587618 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1044316-1044345 4 0.867
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 643185-643214 4 0.867
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 388010-388039 5 0.833
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP041044 Paracoccus sp. AK26 plasmid pAK2, complete sequence 85659-85688 5 0.833
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 299736-299765 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1145443-1145472 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445326-445355 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 190748-190777 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 438096-438125 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 390703-390732 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 187125-187154 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 195747-195776 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1499853-1499882 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1991107-1991136 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1436080-1436109 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1738658-1738687 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 640888-640917 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 MN234179 Gordonia phage Pipp, complete genome 49254-49283 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1619735-1619764 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 437939-437968 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 455903-455932 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 440819-440848 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 501092-501121 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 592052-592081 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 92927-92956 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 442905-442934 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1050708-1050737 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 669505-669534 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 442080-442109 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1385273-1385302 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 453554-453583 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 439326-439355 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 334960-334989 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 112206-112235 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 438417-438446 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 432943-432972 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 439073-439102 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 442098-442127 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 454361-454390 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 438705-438734 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 435161-435190 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 454361-454390 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 438705-438734 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 454361-454390 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 435164-435193 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 454365-454394 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 438705-438734 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 438705-438734 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 438705-438734 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1655799-1655828 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 435164-435193 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 453535-453564 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 453493-453522 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 445699-445728 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 445312-445341 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 437216-437245 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 435164-435193 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 454361-454390 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 498350-498379 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 454817-454846 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 435164-435193 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 435164-435193 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 438707-438736 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1637866-1637895 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 454818-454847 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1637866-1637895 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1758553-1758582 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_015169 Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence 278064-278093 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 189954-189983 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1760763-1760792 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 501125-501154 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP016451 Sinorhizobium sp. RAC02 plasmid pBSY16_2, complete sequence 52078-52107 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 KX683428 Mycobacterium phage TBond007, complete genome 30264-30293 5 0.833
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_042325 Mycobacterium virus Pixie, complete genome 30265-30294 5 0.833
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1562977-1563006 6 0.8
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 41385-41414 6 0.8
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_008758 Polaromonas naphthalenivorans CJ2 plasmid pPNAP02, complete sequence 42965-42994 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 1017248-1017277 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 382482-382511 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 129494-129523 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 191764-191793 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 MT740732 Ralstonia phage Darius, complete genome 936-965 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 MT740731 Ralstonia phage Claudette, complete genome 48999-49028 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP000664 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence 118603-118632 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 51539-51568 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 843689-843718 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_041931 Arthrobacter phage Jawnski, complete genome 31010-31039 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 MT740740 Ralstonia phage Gervaise, complete genome 48896-48925 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 MT740727 Ralstonia phage Alix, complete genome 27190-27219 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 MF324907 Arthrobacter phage Beans, complete genome 31041-31070 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 682688-682717 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 171275-171304 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 342159-342188 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 MF495477 Aeromonas salmonicida plasmid pS28-3, complete sequence 10190-10219 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 544542-544571 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 755609-755638 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP015091 Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence 99336-99365 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 293031-293060 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 385927-385956 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1589409-1589438 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 475205-475234 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 543391-543420 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 185823-185852 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 303904-303933 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 666139-666168 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 249281-249310 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 247286-247315 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 544636-544665 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 242248-242277 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 464356-464385 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 134865-134894 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 257457-257486 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 228431-228460 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_008758 Polaromonas naphthalenivorans CJ2 plasmid pPNAP02, complete sequence 144248-144277 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 327199-327228 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 208559-208588 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 173644-173673 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 36946-36975 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1532897-1532926 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 82946-82975 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 336537-336566 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 181920-181949 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 902489-902518 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 654196-654225 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 110428-110457 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 100228-100257 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1257894-1257923 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 585020-585049 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1532895-1532924 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 283670-283699 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 227159-227188 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 440229-440258 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 232962-232991 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 930420-930449 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 394864-394893 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 930375-930404 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1440336-1440365 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1246330-1246359 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 123753-123782 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1385596-1385625 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 411647-411676 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 58178-58207 6 0.8
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 307154-307183 6 0.8
NZ_CP018228_3 3.3|4205450|44|NZ_CP018228|CRISPRCasFinder 4205450-4205493 44 NZ_CP050084 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence 287965-288008 6 0.864
NZ_CP018228_3 3.3|4205450|44|NZ_CP018228|CRISPRCasFinder 4205450-4205493 44 NZ_CP053209 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence 445090-445133 6 0.864
NZ_CP018228_3 3.3|4205450|44|NZ_CP018228|CRISPRCasFinder 4205450-4205493 44 NZ_CP050090 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b4, complete sequence 63917-63960 6 0.864
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1726639-1726668 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 342159-342188 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1813612-1813641 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1733890-1733919 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1728710-1728739 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1813614-1813643 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 335069-335098 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 196587-196616 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 83775-83804 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_012849 Ralstonia pickettii 12D plasmid pRp12D02, complete sequence 178725-178754 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 103377-103406 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP026518 Deinococcus sp. NW-56 plasmid unnamed2, complete sequence 209751-209780 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 501334-501363 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP010871 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence 39719-39748 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 421445-421474 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1396598-1396627 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 594757-594786 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1486355-1486384 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1675252-1675281 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 293064-293093 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 493692-493721 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1486362-1486391 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1675250-1675279 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1341870-1341899 7 0.767
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 542947-542976 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 391131-391160 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 484838-484867 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1054966-1054995 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 404794-404823 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 652142-652171 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 454168-454197 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032328 Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence 147708-147737 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 2013302-2013331 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 170658-170687 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 103924-103953 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 122870-122899 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 3726-3755 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 350313-350342 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 11192-11221 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1350792-1350821 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1396322-1396351 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 401617-401646 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 219192-219221 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 723544-723573 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 28593-28622 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_011892 Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence 332968-332997 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 401435-401464 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1730959-1730988 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 9691-9720 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1562977-1563006 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 211163-211192 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 999694-999723 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 576376-576405 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1219198-1219227 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_AP022558 Geobacillus subterraneus strain E55-1 plasmid pGspE55-1, complete sequence 56540-56569 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_014563 Pantoea vagans C9-1 plasmid pPag2, complete sequence 45473-45502 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022518 Pantoea vagans strain FBS135 plasmid pPant2, complete sequence 104957-104986 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 MH588547 Caulobacter phage CcrSC, complete genome 67098-67127 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 416370-416399 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 606377-606406 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_KR997898 Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence 35951-35980 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1553994-1554023 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 356551-356580 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 257124-257153 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1305099-1305128 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 497074-497103 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 580028-580057 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 545998-546027 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 193370-193399 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP015268 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence 122168-122197 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 382743-382772 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1655920-1655949 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 146558-146587 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 454117-454146 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 517147-517176 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 223974-224003 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 22830-22859 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1554129-1554158 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1305101-1305130 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1050241-1050270 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 792667-792696 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1305106-1305135 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1410580-1410609 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 449558-449587 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 239532-239561 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 685965-685994 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP049813 Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence 95567-95596 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 164952-164981 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1157424-1157453 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1157413-1157442 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1553700-1553729 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1553644-1553673 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 67829-67858 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1232046-1232075 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1041255-1041284 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 322160-322189 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1178547-1178576 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP034088 Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence 208435-208464 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 131993-132022 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 508951-508980 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP044073 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence 22529-22558 7 0.767
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 37590-37619 7 0.767
NZ_CP018228_2 2.5|4204882|34|NZ_CP018228|CRT 4204882-4204915 34 NZ_CP021811 Sinorhizobium meliloti strain Rm41 plasmid accessoryA, complete sequence 58014-58047 7 0.794
NZ_CP018228_2 2.5|4204882|34|NZ_CP018228|CRT 4204882-4204915 34 NC_018682 Sinorhizobium meliloti Rm41 plasmid pRM41A, complete sequence 215036-215069 7 0.794
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 233014-233043 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 233101-233130 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1808266-1808295 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1834507-1834536 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1867015-1867044 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1893712-1893741 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 2037960-2037989 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1519345-1519374 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1798625-1798654 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 409144-409173 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 771602-771631 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 498208-498237 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1876501-1876530 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1585268-1585297 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1815577-1815606 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1813391-1813420 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1810447-1810476 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1882448-1882477 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1811806-1811835 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1887981-1888010 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1882415-1882444 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1788737-1788766 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1866236-1866265 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1881158-1881187 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1893723-1893752 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1778888-1778917 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1789049-1789078 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1866236-1866265 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1881257-1881286 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1788737-1788766 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1779535-1779564 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1787940-1787969 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1866236-1866265 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1866236-1866265 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1866236-1866265 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1881253-1881282 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1881242-1881271 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1778911-1778940 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1793211-1793240 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1773848-1773877 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1833742-1833771 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1865730-1865759 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1863551-1863580 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1881242-1881271 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1778911-1778940 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1789048-1789077 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1816157-1816186 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1882239-1882268 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1778911-1778940 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1778911-1778940 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1881253-1881282 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1866241-1866270 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1881264-1881293 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1881065-1881094 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 832290-832319 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 251265-251294 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 837342-837371 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 26332-26361 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 618818-618847 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 596803-596832 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1817509-1817538 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1290126-1290155 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1939830-1939859 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 136258-136287 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 136258-136287 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1094363-1094392 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_021909 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence 519756-519785 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1145473-1145502 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP013071 Sphingobium indicum B90A plasmid pSRL1, complete sequence 80717-80746 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 524717-524746 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1753257-1753286 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 2473-2502 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1730959-1730988 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 832903-832932 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 80634-80663 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1653118-1653147 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 384038-384067 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 446252-446281 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 401435-401464 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR723676 Rhizobium sp. TCK plasmid 2 169975-170004 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445215-445244 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 795746-795775 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 MH834622 Arthrobacter phage Noely, complete genome 4246-4275 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 978406-978435 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 15885-15914 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 389500-389529 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 525491-525520 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 501232-501261 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 1144653-1144682 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1631161-1631190 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 AY328853 Vibrio parahaemolyticus phage VP16C, partial sequence 34161-34190 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 KF854250 UNVERIFIED: Vibrio phage VP_EVC_2013, partial genome 34066-34095 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1214287-1214316 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 210471-210500 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 233362-233391 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 436994-437023 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 77163-77192 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1203185-1203214 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 699249-699278 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_021347 Rhodococcus phage E3, complete genome 134438-134467 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP009293 Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence 108762-108791 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_017385 Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence 28110-28139 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP013108 Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence 144664-144693 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 1001166-1001195 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 200159-200188 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 643667-643696 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 643657-643686 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP042998 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence 39597-39626 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NC_014626 Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence 79203-79232 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 56488-56517 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1826378-1826407 8 0.733
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP041606 Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence 90509-90538 8 0.733
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 446662-446691 9 0.7
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 256638-256667 9 0.7
NZ_CP018228_1 1.8|1026556|30|NZ_CP018228|CRT 1026556-1026585 30 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 550006-550035 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR723676 Rhizobium sp. TCK plasmid 2 121648-121677 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 387980-388009 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 608801-608830 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP031358 Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence 306727-306756 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 250071-250100 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 245050-245079 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 635047-635076 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 885541-885570 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP014276 Martelella sp. AD-3 plasmid unnamed1, complete sequence 25927-25956 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 1203149-1203178 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 117757-117786 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 132708-132737 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 119198-119227 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 120667-120696 9 0.7
NZ_CP018228_1 1.10|1026664|30|NZ_CP018228|CRT 1026664-1026693 30 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 115990-116019 9 0.7
NZ_CP018228_2 2.5|4204882|34|NZ_CP018228|CRT 4204882-4204915 34 MT939492 Xanthomonas phage Xoo-sp14, complete genome 66081-66114 9 0.735
NZ_CP018228_3 3.1|4205316|43|NZ_CP018228|CRISPRCasFinder 4205316-4205358 43 MT778838 Rhizobium phage V1VFA-S, complete genome 18721-18763 9 0.791
NZ_CP018228_1 1.6|1026424|54|NZ_CP018228|CRT 1026424-1026477 54 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 232987-233040 10 0.815
NZ_CP018228_1 1.5|1026328|66|NZ_CP018228|CRT 1026328-1026393 66 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 444852-444917 15 0.773

1. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccaccattgccgccgccg	Protospacer
**************************************.***********.***

2. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 2, identity: 0.963 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccgttgccgccgccattaccgccgccg	Protospacer
********************************************.*****.***

3. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.933 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccattgccgccgccattgccgccgccg	Protospacer
**.**** **********************

4. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.933 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccgttgccgccgccattgccgccgccg	Protospacer
*****.* **********************

5. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.933 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccattgccgccgccattgccgccgccg	Protospacer
**.**** **********************

6. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 2, identity: 0.933 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccattgccgccgccgttgccgccgccg	Protospacer
******* *********.************

7. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 2, identity: 0.933 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccattgccgccaccattgccgccgccg	Protospacer
******* ******.***************

8. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 2, identity: 0.933 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccattgccgccaccattgccgccgccg	Protospacer
******* ******.***************

9. spacer 3.4|4205460|34|NZ_CP018228|PILER-CR matches to NZ_CP050084 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence) position: , mismatch: 2, identity: 0.941 

gccggtgcgttggtgttttgtccaccgcgccgct	CRISPR spacer
gccggtgcgtttgtgtcttgtccaccgcgccgct	Protospacer
*********** ****.*****************

10. spacer 3.4|4205460|34|NZ_CP018228|PILER-CR matches to NZ_CP053209 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence) position: , mismatch: 2, identity: 0.941 

gccggtgcgttggtgttttgtccaccgcgccgct	CRISPR spacer
gccggtgcgtttgtgtcttgtccaccgcgccgct	Protospacer
*********** ****.*****************

11. spacer 3.4|4205460|34|NZ_CP018228|PILER-CR matches to NZ_CP050090 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b4, complete sequence) position: , mismatch: 2, identity: 0.941 

gccggtgcgttggtgttttgtccaccgcgccgct	CRISPR spacer
gccggtgcgtttgtgtcttgtccaccgcgccgct	Protospacer
*********** ****.*****************

12. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccattgccgccgccattgccgccacca	Protospacer
******* ******************.**.

13. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.9 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccattgccgccgccgttgccgccgcca	Protospacer
******* *********.***********.

14. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.9 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccattgccgccgccattgccgccgcct	Protospacer
**.**** *********************

15. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.9 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccattgccgccgccattgccgccgcct	Protospacer
**.**** *********************

16. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 3, identity: 0.9 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccgttgccgccgccattgccgccgcca	Protospacer
*****.* *********************.

17. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 3, identity: 0.9 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccgttgccgccgccattgccgccgcca	Protospacer
*****.* *********************.

18. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.867 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ttgccgttgccgccgccatggccaccaccg	Protospacer
*..********************..*****

19. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.867 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccgccgttgccgccgccattgccgccaccg	Protospacer
.*.**************** ****.*****

20. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

21. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

22. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

23. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

24. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

25. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

26. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

27. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

28. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

29. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

30. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

31. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

32. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

33. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

34. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

35. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

36. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

37. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

38. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccgtggccgccgccattgccgccgccg	Protospacer
...**.************************

39. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccattgccgccgccattgccgccgccg	Protospacer
...**** **********************

40. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_041916 (Vibrio phage pTD1 DNA, complete genome) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccattgccgccgccattgccgccgttg	Protospacer
**.**** *******************..*

41. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatg--gccgccgccattgccgccgccg	CRISPR spacer
--accaggccgccgccgccatcgccgccgccg	Protospacer
  **** *  ***********.**********

42. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatg--gccgccgccattgccgccgccg	CRISPR spacer
--accaggccgccgccgccatcgccgccgccg	Protospacer
  **** *  ***********.**********

43. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatg--gccgccgccattgccgccgccg	CRISPR spacer
--accaggccgccgccgccatcgccgccgccg	Protospacer
  **** *  ***********.**********

44. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatg--gccgccgccattgccgccgccg	CRISPR spacer
--accaggccgccgccgccatcgccgccgccg	Protospacer
  **** *  ***********.**********

45. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatg--gccgccgccattgccgccgccg	CRISPR spacer
--accaggccgccgccgccatcgccgccgccg	Protospacer
  **** *  ***********.**********

46. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.867 

ccaccatggccgccgccattgcc-gccgccg	CRISPR spacer
ccaccatggccgccgccgtcgccggacgcc-	Protospacer
*****************.*.*** * ****

47. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.833 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ttgccgttgccgccgccattgccgccacca	Protospacer
*..**************** ****.****.

48. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP041044 (Paracoccus sp. AK26 plasmid pAK2, complete sequence) position: , mismatch: 5, identity: 0.833 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
gcgccgtgcccgccgccatggccgtcactg	Protospacer
 *.****  *******************.*

49. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
tcagcgttgccgccgccacggccggacccg	Protospacer
*** **************.*****   ***

50. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccattgccgccgccattgccgccgcca	Protospacer
...**** *********************.

51. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccatgaccgccgccgccgttgccgccgccg	Protospacer
***. *. *********.************

52. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggcgatggccgccgccatggccgccgccg	Protospacer
  .* ************** **********

53. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggcgatggccgccgccatggccgccgccg	Protospacer
  .* ************** **********

54. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccattgccgccgccattgccgcccttg	Protospacer
**.**** ****************** ..*

55. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

56. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

57. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

58. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

59. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

60. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

61. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

62. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to MN234179 (Gordonia phage Pipp, complete genome) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cccacatcgccgccaccattgccgccgccc	Protospacer
**  *** ******.**************

63. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

64. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

65. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

66. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

67. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

68. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

69. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

70. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

71. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

72. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

73. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

74. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccccaggggccgccgccattgccgccgcgg	Protospacer
** * . ********************* *

75. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

76. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

77. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

78. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaagccggccgccggcattgccgccgccg	Protospacer
***   .******** **************

79. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

80. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

81. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgccgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

82. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

83. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

84. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

85. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

86. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

87. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

88. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

89. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

90. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

91. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

92. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

93. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

94. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

95. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

96. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

97. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

98. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

99. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

100. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

101. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

102. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

103. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

104. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

105. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

106. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

107. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

108. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

109. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

110. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

111. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

112. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

113. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

114. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

115. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

116. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

117. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

118. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

119. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

120. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.833 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ggccatc--ggccgccgccatcgccgccgcca	Protospacer
  ***.*  ************.*********.

121. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 5, identity: 0.833 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ggccgc--tggccgccgccattcccggcgccg	Protospacer
  **.*  ************** *** *****

122. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgccgccgccgccatcgccgccgccg	Protospacer
**.**.. ***********.**********

123. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ggccatc--ggccgccgccatcgccgccgcca	Protospacer
  ***.*  ************.*********.

124. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctgccgccgccattgccgccaccg	Protospacer
**.**.. ******************.***

125. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP016451 (Sinorhizobium sp. RAC02 plasmid pBSY16_2, complete sequence) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccttcatggccgccgcgactgccgccgcgg	Protospacer
** .************ *.********* *

126. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to KX683428 (Mycobacterium phage TBond007, complete genome) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg-	CRISPR spacer
ccaccgaggccgccgccattgccg-ggctga	Protospacer
*****. *****************  **.*

127. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_042325 (Mycobacterium virus Pixie, complete genome) position: , mismatch: 5, identity: 0.833 

ccaccatggccgccgccattgccgccgccg-	CRISPR spacer
ccaccgaggccgccgccattgccg-ggctga	Protospacer
*****. *****************  **.*

128. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 6, identity: 0.8 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccaccgttgccgccgccattgccgtttttg	Protospacer
.****************** *****. ..*

129. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
gcacgaggtccgccgccatggccgtcaccg	Protospacer
 *** .   *********************

130. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_008758 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP02, complete sequence) position: , mismatch: 6, identity: 0.8 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
gcttcatcgccgccgccatgaccgtcaccg	Protospacer
 * .*.*.************.*********

131. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccgctaccgccgccattgccgccaccg	Protospacer
**.**.. .*****************.***

132. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccattgccgccgccattgccgcttttg	Protospacer
**.**** *****************. ..*

133. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggcgctggccgccgccattgccgccggcg	Protospacer
  .*  ********************* **

134. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
agggcatcgccgccgcctttgccgccgccg	Protospacer
  . *** ********* ************

135. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgctctggccgccgccattgccgccgctc	Protospacer
 *.*. **********************.

136. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to MT740731 (Ralstonia phage Claudette, complete genome) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgctctggccgccgccattgccgccgctc	Protospacer
 *.*. **********************.

137. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP000664 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggccacggccgccgccagtgccgccgcct	Protospacer
  .***.*********** **********

138. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggcgctggccgccgccattgccgccggcg	Protospacer
  .*  ********************* **

139. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccatggccgccaccattgccaccgcca	Protospacer
...***********.********.*****.

140. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_041931 (Arthrobacter phage Jawnski, complete genome) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgtactgcccgccgccattgccgccgccg	Protospacer
 *..  ** *********************

141. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgctctggccgccgccattgccgccgctc	Protospacer
 *.*. **********************.

142. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to MT740727 (Ralstonia phage Alix, complete genome) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgctctggccgccgccattgccgccgctc	Protospacer
 *.*. **********************.

143. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to MF324907 (Arthrobacter phage Beans, complete genome) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgtactgcccgccgccattgccgccgccg	Protospacer
 *..  ** *********************

144. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 6, identity: 0.8 

----ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gtggtcgcc----ccgccgccattgccgccgccg	Protospacer
    .*.**    *********************

145. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
accacgcggccgccgccatcgccgccgccg	Protospacer
 *  *..************.**********

146. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccgttgccgccgccattgccgcttttg	Protospacer
*****.* *****************. ..*

147. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to MF495477 (Aeromonas salmonicida plasmid pS28-3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcaccagcgccgccgccattgccgccctgg	Protospacer
.*****  ****************** . *

148. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaaccatcgccgccgcccttgccgccgaag	Protospacer
  ***** ********* *********  *

149. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8 

-ccaccatggccgccgccattgccgccgccg	CRISPR spacer
accagcgc-gctgccgccattgccgccgccc	Protospacer
 *** *.. **.******************

150. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP015091 (Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcggcagcgccgccgccatggccgccgccg	Protospacer
.*. **  *********** **********

151. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgcc--gccgccg	CRISPR spacer
acaccaaggccgccgccatggccgagcggc--	Protospacer
 ***** ************ ***  ** **

152. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggggccgccggcattgccgccgccc	Protospacer
 *.**. ******** *************

153. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.8 

-ccaccatggccgccgccattgccgccgccg	CRISPR spacer
accagcgc-gccaccgccattgccgccgccc	Protospacer
 *** *.. ***.*****************

154. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ctccgatggccgccgccatggccgccggca	Protospacer
*. * ************** ******* *.

155. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccat----ggccgccgccattgccgccgccg	CRISPR spacer
----catggccggccgccgccagtgccgccgcca	Protospacer
    ***    *********** **********.

156. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgacctggacgccgccgttgccgccgcct	Protospacer
**. * *** *******.***********

157. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 6, identity: 0.8 

-ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gagatcgt-gccgccgccattaccgccgccg	Protospacer
   *.*.* ************.*********

158. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cgccgatggccgccgccatggccgccggca	Protospacer
*  * ************** ******* *.

159. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cgcccacggccgccgacattgccgccgtca	Protospacer
*  ***.******** ***********.*.

160. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccattgccaccgccattgccgttccct	Protospacer
******* ***.************.. **

161. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cgccgatggccgccgccatggccgccggca	Protospacer
*  * ************** ******* *.

162. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccattgccaccgccattgccgttccct	Protospacer
******* ***.************.. **

163. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
caaccaaggccgccgtcattgccgccttcc	Protospacer
* **** ********.********** .*

164. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cgagcgcgaccgccgccatggccgccgccg	Protospacer
* * *..*.********** **********

165. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatg-gccgccgccattgccgccgccg	CRISPR spacer
-gaggacgagccgccgccatcgccgccgccg	Protospacer
  *  *.* ***********.**********

166. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgatctggccgccgccttggccgccgccg	Protospacer
**. . *********** * **********

167. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_008758 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP02, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cccgaacggccgccgccatagccgccgcca	Protospacer
**   *.************ *********.

168. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgcc--gccgccg	CRISPR spacer
acaccaaggccgccgccatggccgagcggc--	Protospacer
 ***** ************ ***  ** **

169. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgcgcggcg	Protospacer
 ****** **************   ** **

170. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgtgcggcg	Protospacer
 ****** **************   ** **

171. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgcc--gccgccg	CRISPR spacer
acaccaaggccgccgccatggccgagcggc--	Protospacer
 ***** ************ ***  ** **

172. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaccgc--tggccgccgccctcgccgccgcca	Protospacer
  **.*  *********** *.*********.

173. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccagtgcggccgacgccatcgccgccgccg	Protospacer
*** ...***** ******.**********

174. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgcgcggcg	Protospacer
 ****** **************   ** **

175. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgtgcggcg	Protospacer
 ****** **************   ** **

176. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
acgccgcgcccgccgccattgccgcccccg	Protospacer
 *.**..* ***************** ***

177. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgcc--gccgccg	CRISPR spacer
acaccaaggccgccgccatggccgagcggc--	Protospacer
 ***** ************ ***  ** **

178. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccgtggcggccgccattgccgaggcgg	Protospacer
 ****.**** *************  ** *

179. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgcgcggcg	Protospacer
 ****** **************   ** **

180. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaccgc--tggccgccgccctcgccgccgcca	Protospacer
  **.*  *********** *.*********.

181. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaccgc--tggccgccgccctcgccgccgcca	Protospacer
  **.*  *********** *.*********.

182. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaccgc--tggccgccgccctcgccgccgcca	Protospacer
  **.*  *********** *.*********.

183. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgacctggccgccgacactgccgccgcca	Protospacer
**. * ********* **.**********.

184. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgcgcggcg	Protospacer
 ****** **************   ** **

185. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgcgcggcg	Protospacer
 ****** **************   ** **

186. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 6, identity: 0.8 

----ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gggacca----ggccgccgccatggccggcgccg	Protospacer
    ***    ************ **** *****

187. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaccgc--tggccgccgccctcgccgccgcca	Protospacer
  **.*  *********** *.*********.

188. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgcgcggcg	Protospacer
 ****** **************   ** **

189. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaccgc--tggccgccgccctcgccgccgcca	Protospacer
  **.*  *********** *.*********.

190. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaccgc--tggccgccgccctcgccgccgcca	Protospacer
  **.*  *********** *.*********.

191. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaccgc--tggccgccgccctcgccgccgcca	Protospacer
  **.*  *********** *.*********.

192. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgcc--gccgccg	CRISPR spacer
acaccaaggccgccgccatggccgagcggc--	Protospacer
 ***** ************ ***  ** **

193. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

--ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aaccgc--tggccgccgccctcgccgccgcca	Protospacer
  **.*  *********** *.*********.

194. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgcc--gccgccg	CRISPR spacer
acaccaaggccgccgccatggccgagcggc--	Protospacer
 ***** ************ ***  ** **

195. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgcgcggcg	Protospacer
 ****** **************   ** **

196. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 6, identity: 0.8 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgcgcggcg	Protospacer
 ****** **************   ** **

197. spacer 3.3|4205450|44|NZ_CP018228|CRISPRCasFinder matches to NZ_CP050084 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence) position: , mismatch: 6, identity: 0.864 

--ggcgggcgacgccggtgcgttggtgttttgtccaccgcgccgct	CRISPR spacer
ctgacgagcg--gccggtgcgtttgtgtcttgtccaccgcgccgct	Protospacer
  *.**.***  *********** ****.*****************

198. spacer 3.3|4205450|44|NZ_CP018228|CRISPRCasFinder matches to NZ_CP053209 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence) position: , mismatch: 6, identity: 0.864 

--ggcgggcgacgccggtgcgttggtgttttgtccaccgcgccgct	CRISPR spacer
ctgacgagcg--gccggtgcgtttgtgtcttgtccaccgcgccgct	Protospacer
  *.**.***  *********** ****.*****************

199. spacer 3.3|4205450|44|NZ_CP018228|CRISPRCasFinder matches to NZ_CP050090 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b4, complete sequence) position: , mismatch: 6, identity: 0.864 

--ggcgggcgacgccggtgcgttggtgttttgtccaccgcgccgct	CRISPR spacer
ctgacgagcg--gccggtgcgtttgtgtcttgtccaccgcgccgct	Protospacer
  *.**.***  *********** ****.*****************

200. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
gcacctttgccgccgccatgcccgcgttcg	Protospacer
 **** ************** ***.  .**

201. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccaccgttgccgccgccattgccgcttttg	Protospacer
.****************** ****.. ..*

202. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
gcacctttgccgccgccatgcccgcgttcg	Protospacer
 **** ************** ***.  .**

203. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
gcacctttgccgccgccatgcccgcgttcg	Protospacer
 **** ************** ***.  .**

204. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
gcacctttgccgccgccatgcccgcgttcg	Protospacer
 **** ************** ***.  .**

205. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
gcacctttgccgccgccatgcccgcgttcg	Protospacer
 **** ************** ***.  .**

206. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
gcacctttgccgccgccatgcccgcgttcg	Protospacer
 **** ************** ***.  .**

207. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
tgccctttgccgccgccatggccgttttcc	Protospacer
*  ** *******************. .*

208. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
atactgttgccgccgccatcgccgtccgtg	Protospacer
 .**.************** ******  .*

209. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
cagcgattgccgtcgccgtggccgtcaccg	Protospacer
. .* .******.****.************

210. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
aaaccgttgccgccgccatcgccatcgcgc	Protospacer
  ***************** ***.**.*

211. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
tcaccgttgccgccgcgctggccggtggtg	Protospacer
****************  ****** .. .*

212. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
tcgatcccgccgccgccaaggccgtcaccg	Protospacer
**. . ..********** ***********

213. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP010871 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6002, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccaccgttgccgccgacatggcgctggcag	Protospacer
.************** ******  * .* *

214. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
acgaggatgccgccggcatgcccgtcaccg	Protospacer
 *.  * ******** **** *********

215. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg-	CRISPR spacer
aaaccgatgccgccgccaaggccgt-gctgc	Protospacer
  **** *********** ****** .*.*

216. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
cgagcgcgaccgccgccatggccgccaccg	Protospacer
. * **. .***************.*****

217. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg-	CRISPR spacer
aaaccgatgccgccgccaaggccgt-gctgc	Protospacer
  **** *********** ****** .*.*

218. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
acgaggatgccgccggcatgcccgtcaccg	Protospacer
 *.  * ******** **** *********

219. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccgcgctacccgccgccatggccggcaccg	Protospacer
.*.*  *  *************** *****

220. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatg-----gccgtcaccg	CRISPR spacer
tcaccgtcgccgccgccatgggcaagctgt-----	Protospacer
*******.************     **.**

221. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg-	CRISPR spacer
aaaccgatgccgccgccaaggccgt-gctgc	Protospacer
  **** *********** ****** .*.*

222. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
acgaggatgccgccggcatgcccgtcaccg	Protospacer
 *.  * ******** **** *********

223. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg-	CRISPR spacer
aaaccgatgccgccgccaaggccgt-gctgc	Protospacer
  **** *********** ****** .*.*

224. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
cgagcgcgaccgccgccatggccgccaccg	Protospacer
. * **. .***************.*****

225. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgttaccgccgccgccgttgccgccgcca	Protospacer
**...*. *********.***********.

226. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgccattgccgccgccattgccgcttttt	Protospacer
**.**** *****************. ..

227. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggcccaggccgccggcattgccgcggccg	Protospacer
  .**  ******** ********* ****

228. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgatgcggccggcgcctttgccgccgccg	Protospacer
**. ...***** **** ************

229. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgatgcggccggcgcctttgccgccgccg	Protospacer
**. ...***** **** ************

230. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgctctggcctccgccattgccgccaccg	Protospacer
...*. ***** **************.***

231. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032328 (Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ggcgcatggccgccgccatcgccgccgcga	Protospacer
    ***************.******** .

232. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgctctggcctccgccattgccgccaccg	Protospacer
...*. ***** **************.***

233. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tctcgatcgccgccgcctttgccgccgcga	Protospacer
.* * ** ********* ********** .

234. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcgccatcgccgccgccattcccgccatcc	Protospacer
.*.**** ************ *****..*

235. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

-ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gctggcgc-accgccgccattgccgccgccg	Protospacer
 *.. *.. .*********************

236. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
taggcatggacgccgccattggcgccgcct	Protospacer
. . ***** *********** *******

237. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcgcgctggccgtcgccatcgccgccgccc	Protospacer
.*.*  ******.******.*********

238. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgtgatggccgccgccattcccgtcgccg	Protospacer
.... *************** ***.*****

239. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

240. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgatctggccgacgccatcgccgccgccg	Protospacer
 *. . ****** ******.**********

241. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ctgtcgtctccgccgccatcgccgccgccg	Protospacer
*...*.*  **********.**********

242. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgatctggccgacgccatcgccgccgccg	Protospacer
 *. . ****** ******.**********

243. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ctgtcgtctccgccgccatcgccgccgccg	Protospacer
*...*.*  **********.**********

244. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcgccatcgccgccgccattcccgccatcc	Protospacer
.*.**** ************ *****..*

245. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcggctccgccgccgccatggccgccgccg	Protospacer
.*. * . *********** **********

246. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aagcgactgccgccgccatggccgccgccg	Protospacer
  .* *. *********** **********

247. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aagcgactgccgccgccatggccgccgccg	Protospacer
  .* *. *********** **********

248. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccggggtggccgccgccattgccgcggcgc	Protospacer
**.  .******************* **

249. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccgttgccgccgccattgccgtttttg	Protospacer
*****.* ****************.. ..*

250. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cggagaaggccgccgccatcgtcgccgccg	Protospacer
* .  * ************.*.********

251. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgatctggccgacgccatcgccgccgccg	Protospacer
 *. . ****** ******.**********

252. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcgcggaggccgccgccctggccgccgccg	Protospacer
.*.* . ********** * **********

253. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcaccatgaccgccgccattgccattacca	Protospacer
.*******.**************....**.

254. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_AP022558 (Geobacillus subterraneus strain E55-1 plasmid pGspE55-1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcaacattgccgccgccattgccgcatttg	Protospacer
.** *** *****************  ..*

255. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_014563 (Pantoea vagans C9-1 plasmid pPag2, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggcgttggccgccgccatcgccgccggcg	Protospacer
  .*  *************.******* **

256. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022518 (Pantoea vagans strain FBS135 plasmid pPant2, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggcgctggccgccgccatcgccgccggcg	Protospacer
  .*  *************.******* **

257. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccgagcgcgccgccgccgttgccgccgccg	Protospacer
**.     *********.************

258. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

259. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

260. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
accgcgcggccgccgccatcgccgcggccg	Protospacer
 *  *..************.***** ****

261. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

262. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

263. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccggaaccgccgccgcccttgccgccgccc	Protospacer
**.  *. ********* ***********

264. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

265. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cggccatggccgccgccatcgccgacatgg	Protospacer
* .****************.**** *.. *

266. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

267. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

268. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cccacgactccgccgccgttgccgccgccg	Protospacer
**  *.   ********.************

269. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP015268 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
accgcgcggccgcagccatcgccgccgccg	Protospacer
 *  *..****** *****.**********

270. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

271. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ccaccatggccgccgccttggccttggcga	Protospacer
***************** * *** . ** .

272. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcgtcctggccgccgccatcgctgccgcca	Protospacer
.*..* *************.**.******.

273. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gaaccgccgccgccgcccttgccgccgccc	Protospacer
  ***.. ********* ***********

274. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

275. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcaccattgccgccgccattgcgcgcagcg	Protospacer
 ****** **************   *. **

276. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

277. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

278. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

279. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

280. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

281. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

282. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
acgccaaggccgcggccattgccgcccttg	Protospacer
 *.*** ****** ************ ..*

283. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

284. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cgccccatgccgccgccatcgccgccgcca	Protospacer
*  **   ***********.*********.

285. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cggccatggccgccgccatcgccgacatgg	Protospacer
* .****************.**** *.. *

286. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
agccgaagcccgccgccagtgccgccgccg	Protospacer
   * * * ********* ***********

287. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggcgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

288. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

289. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

290. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

291. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

292. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ctccaagcgccaccgccattgccgccgcca	Protospacer
*. * *  ***.*****************.

293. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

294. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

295. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggcgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

296. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccgcgtggccgccgccacggccgccgcca	Protospacer
.*  *.************. *********.

297. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cggcgtcggccgccgccagcgccgccgccg	Protospacer
* .*  .*********** .**********

298. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
accgcgcggccgccgccatcgccgcggccg	Protospacer
 *  *..************.***** ****

299. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgccggtgccgccggcattgccgccgccc	Protospacer
 *.**.  ******* *************

300. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP044073 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gccagatggccgccgccaatgccgccatcg	Protospacer
 *   ************* *******..**

301. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 7, identity: 0.767 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcaccatggccgccgccatgcccgtcatct	Protospacer
.******************  ***.*..*

302. spacer 2.5|4204882|34|NZ_CP018228|CRT matches to NZ_CP021811 (Sinorhizobium meliloti strain Rm41 plasmid accessoryA, complete sequence) position: , mismatch: 7, identity: 0.794 

aggcctttttcggcgcacagcaggattggatgac	CRISPR spacer
aagcttacctcggcgcccagcaggagtggatgac	Protospacer
*.**.* ..******* ******** ********

303. spacer 2.5|4204882|34|NZ_CP018228|CRT matches to NC_018682 (Sinorhizobium meliloti Rm41 plasmid pRM41A, complete sequence) position: , mismatch: 7, identity: 0.794 

aggcctttttcggcgcacagcaggattggatgac	CRISPR spacer
aagcttacctcggcgcccagcaggagtggatgac	Protospacer
*.**.* ..******* ******** ********

304. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccgttaccgccgccgccatggccgccaccg	Protospacer
.*......****************.*****

305. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccgttaccgccgccgccatggccgccaccg	Protospacer
.*......****************.*****

306. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

307. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

308. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

309. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

310. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

311. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

312. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

313. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

314. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

315. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

316. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

317. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

318. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

319. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

320. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

321. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

322. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

323. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

324. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

325. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

326. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

327. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

328. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

329. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

330. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

331. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

332. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

333. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

334. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

335. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

336. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

337. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

338. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

339. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

340. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

341. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

342. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

343. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

344. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

345. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

346. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

347. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

348. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

349. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

350. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

351. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

352. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

353. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

354. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

355. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

356. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

357. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

358. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

359. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

360. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

361. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

362. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

363. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

364. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ttgatcttgccgccgcaacggccgtcacct	Protospacer
*.. . ********** *.**********

365. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

366. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

367. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

368. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

369. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

370. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_021909 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ggtttcttgccgcggccatggccgtcgccg	Protospacer
   .. ******* ************.***

371. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ttgccgttgccgccgccattgccgttgttt	Protospacer
*..**************** *****....

372. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP013071 (Sphingobium indicum B90A plasmid pSRL1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ctggcgttgccgccggcatggccgccatag	Protospacer
... *********** ********.**. *

373. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
cgagcacgaccgccgccatggccgccaccg	Protospacer
. * *.. .***************.*****

374. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccagcgttgccgccgcgatggccgcttcgt	Protospacer
.** ************ *******.. *

375. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
tcaccgctgccgacgccatggcctatgttg	Protospacer
******.***** **********  ....*

376. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
aagcgactgccgccgccatggccgccgccg	Protospacer
  .* ..*****************.*.***

377. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ggggctctgccggcgccgtggccgtcaccg	Protospacer
  . * .***** ****.************

378. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccacccatgccgccgccatggccgagctgg	Protospacer
.****  *****************   . *

379. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccaccggtgccgccgccatcgccgcccgta	Protospacer
.***** ************ ****.*  ..

380. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
acacggtcgccgccgccatggccgcccttc	Protospacer
 *** **.****************.* ..

381. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccatcgttgccgccgccacggccgcgcggg	Protospacer
.**.**************.*****.    *

382. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
aagcgactgccgccgccatggccgccgccg	Protospacer
  .* ..*****************.*.***

383. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cagcaattgccgccgccattgccgcctttc	Protospacer
* .* ** ****************** ..

384. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg---	CRISPR spacer
---ccatggccgccgccgccgttgccgccgcca	Protospacer
   **************...*..*******

385. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgtgccggccgccgccattgcggtcgccg	Protospacer
 *..  .*************** *.*****

386. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to MH834622 (Arthrobacter phage Noely, complete genome) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggacgccgccgccgccattgccgccgccc	Protospacer
  . *.. *********************

387. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cgcggatggccgccgccgttggcgccgcgt	Protospacer
*    ************.*** ******

388. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcggcatggccgccgccagcgccgccgaga	Protospacer
.*. ************** .*******  .

389. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ctggatccgccgccgccatttccgccgccg	Protospacer
*..   . ************ *********

390. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gtggcatggccgccgccattgcgggcgacc	Protospacer
 .. ****************** * ** *

391. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gtgatctggccgacgccatcgccgccgccg	Protospacer
 .. . ****** ******.**********

392. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aagacgtcgccgccgccgttgccgccgcca	Protospacer
  . *.* *********.***********.

393. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gtgatctggccgacgccatcgccgccgccg	Protospacer
 .. . ****** ******.**********

394. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to AY328853 (Vibrio parahaemolyticus phage VP16C, partial sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tgcggttggccgccgccattgttgccgccg	Protospacer
.     ***************..*******

395. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to KF854250 (UNVERIFIED: Vibrio phage VP_EVC_2013, partial genome) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tgcggttggccgccgccattgttgccgccg	Protospacer
.     ***************..*******

396. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gtgttgtgaccgccgcgattgccgccgccg	Protospacer
 .....**.******* *************

397. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gtgacgtggccggcgccatcgccgccgccc	Protospacer
 .. *.****** ******.*********

398. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tccagacatccgccgcctttgccgccgccg	Protospacer
.*   *.. ******** ************

399. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cttaccccaccgccgccatcgccgccgccg	Protospacer
*.  * . .**********.**********

400. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgggctggccgcggccatcgccgccgcct	Protospacer
 *.   ******* *****.*********

401. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccattgccgccgccgttgccgccattg	Protospacer
...**** *********.********...*

402. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tgctggtggccgccgccatcgccggcgccg	Protospacer
.  . .*************.**** *****

403. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcgatcccgccgccgccactgccgccgccg	Protospacer
 *. . . **********.***********

404. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP009293 (Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
acgtcatgcccgccgcgattgccgccgtgt	Protospacer
 *..**** ******* **********.

405. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccatagccgccgccattgccggtgatg	Protospacer
...****.**************** .* .*

406. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP013108 (Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gccagacggccgccggcattgccgccgcgt	Protospacer
 *   *.******** ************

407. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aatccatgcccgccgccaatgccgcccggg	Protospacer
   ***** ********* *******   *

408. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gccaaacggccgccggcattgccgccgcgt	Protospacer
 *   *.******** ************

409. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ggaatgaggccggcggcattgccgccgccg	Protospacer
  * .. ***** ** **************

410. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ggaatgaggccggcggcattgccgccgccg	Protospacer
  * .. ***** ** **************

411. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tcgagcgggccgcggccatcgccgccgccg	Protospacer
.*.    ****** *****.**********

412. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccatagccgccgccattgccggtgatg	Protospacer
...****.**************** .* .*

413. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
cggagcaggccggcgccatcgccgccgccg	Protospacer
* .    ***** ******.**********

414. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tggcactggccgccggcattgccgccgtgg	Protospacer
. .*  ********* ***********. *

415. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP041606 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence) position: , mismatch: 8, identity: 0.733 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgctgtggccgccgcccttgccgctgcct	Protospacer
...*..*********** *******.***

416. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.7 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
cttcgcttgccgccgccatgcccgtcagtt	Protospacer
.. *  ************** ****** .

417. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 9, identity: 0.7 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
ccaccgttgccgccgccaccgccgatggat	Protospacer
.*****************. **** ..

418. spacer 1.8|1026556|30|NZ_CP018228|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.7 

tcaccgttgccgccgccatggccgtcaccg	CRISPR spacer
atccggttgccgccgacatggccgtccaga	Protospacer
 . * ********** **********   .

419. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttcttgttcccgccgccgttgccgccgccg	Protospacer
.. ...*  ********.************

420. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccattgccgccgccattgccaccattc	Protospacer
...**** ***************.**...

421. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
gcggatcggccgccgccatcgccgccgcat	Protospacer
 *.   .************.********

422. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP031358 (Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ctgttgccaccgccggcattgccgccgccg	Protospacer
*...... .****** **************

423. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tttccattgccgccgccatttccgcccttt	Protospacer
.. **** ************ ***** ..

424. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tttccattgccgccgccatttccgcccttt	Protospacer
.. **** ************ ***** ..

425. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttcacatggccccggccattgccgccgaat	Protospacer
..  ******* * *************

426. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
atgagatcgccgccgccatcgccgccgcga	Protospacer
 ..  ** ***********.******** .

427. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttcttgacgctgccgccattgccgccgccg	Protospacer
.. ...  **.*******************

428. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
ttgccattgccgccgccattgccgttgttt	Protospacer
...**** ****************..*..

429. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggctgccgctgccgccattgccgccgcct	Protospacer
  .*... **.******************

430. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tggtctctgccgccgcccttgccgccgccc	Protospacer
. ..* . ********* ***********

431. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tggtctctgccgccgcccttgccgccgccc	Protospacer
. ..* . ********* ***********

432. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
tggtctctgccgccgcccttgccgccgccc	Protospacer
. ..* . ********* ***********

433. spacer 1.10|1026664|30|NZ_CP018228|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 9, identity: 0.7 

ccaccatggccgccgccattgccgccgccg	CRISPR spacer
aggctgccgctgccgccattgccgccgcct	Protospacer
  .*... **.******************

434. spacer 2.5|4204882|34|NZ_CP018228|CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 9, identity: 0.735 

aggcctttttcggcgcacagcaggattggatgac-	CRISPR spacer
tggccttcttcggcgaacagcagga-cgaccggct	Protospacer
 ******.******* ********* .*. .*.*

435. spacer 3.1|4205316|43|NZ_CP018228|CRISPRCasFinder matches to MT778838 (Rhizobium phage V1VFA-S, complete genome) position: , mismatch: 9, identity: 0.791 

ggagacgacacacctggttgtcgccttcgtccgtcccgtgaac	CRISPR spacer
tgcggcagaagacctggttgtcgccttcgtccgtgccgtggac	Protospacer
 * *.*.. * *********************** *****.**

436. spacer 1.6|1026424|54|NZ_CP018228|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.815 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccattgccgccaccg	CRISPR spacer
ccgccgttgccgccgccgttaccgccgccgttaccgccgccgccatggccgcca	Protospacer
********************.***********.********..... ***.**.

437. spacer 1.5|1026328|66|NZ_CP018228|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 15, identity: 0.773 

ccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgccgccgccgttgtcg	CRISPR spacer
ccgccgttgccgccgccgttgccgccgccattaccgccgccgttgccgtgaccgccaccg	Protospacer
*****************************.**.***************. .***....**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 572649 : 630501 52 Bacillus_virus(20.0%) holin,protease,transposase NA
DBSCAN-SWA_2 738873 : 753532 12 Vibrio_phage(22.22%) transposase NA
DBSCAN-SWA_3 881923 : 946779 57 Streptococcus_phage(10.0%) integrase,protease,transposase attL 877870:877886|attR 942657:942673
DBSCAN-SWA_4 1828131 : 1838335 9 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_5 2099909 : 2113083 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_6 2474299 : 2483526 9 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_7 2851649 : 2907089 55 Klosneuvirus(22.22%) holin,protease,transposase NA
DBSCAN-SWA_8 2910727 : 2959177 55 Pseudomonas_phage(16.67%) capsid,terminase,transposase,tail NA
DBSCAN-SWA_9 3072673 : 3084965 19 uncultured_Mediterranean_phage(30.0%) terminase NA
DBSCAN-SWA_10 3102603 : 3113186 17 Rhizobium_phage(25.0%) integrase,transposase attL 3111853:3111867|attR 3113980:3113994
DBSCAN-SWA_11 3195072 : 3243703 50 Wolbachia_phage(25.0%) protease,transposase NA
DBSCAN-SWA_12 4817922 : 4829050 10 Mycobacterium_phage(22.22%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP018229
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 52234 : 196371 91 Stx2-converting_phage(12.9%) transposase,integrase attL 105568:105595|attR 199214:199233
DBSCAN-SWA_2 265487 : 352790 54 Shigella_phage(14.29%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP018230
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP018232
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP018234
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1560 : 60662 52 Salmonella_phage(20.0%) transposase NA
DBSCAN-SWA_2 71373 : 151261 57 Stx2-converting_phage(35.29%) transposase,integrase attL 87958:88017|attR 128312:128484

Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP018234.1|WP_155773530.1|28790_28937_+|hypothetical-protein 28790_28937_+ 48 aa aa NA NA NA 1560-60662 yes
7. NZ_CP018233
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1821 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_2 21160 : 23305 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_3 27859 : 38455 8 Brazilian_cedratvirus(25.0%) NA NA
DBSCAN-SWA_4 43382 : 44297 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_5 49428 : 50961 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_6 55045 : 55831 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_7 60388 : 61468 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_8 67764 : 79326 10 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_9 89233 : 89994 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_10 94078 : 95563 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_11 101735 : 108989 8 Planktothrix_phage(40.0%) NA NA
DBSCAN-SWA_12 119894 : 123328 2 Aureococcus_anophage(50.0%) NA NA
DBSCAN-SWA_13 129270 : 130353 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_14 136788 : 137619 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_15 152988 : 154077 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_16 157849 : 162614 4 Ochrobactrum_phage(50.0%) NA NA
DBSCAN-SWA_17 166048 : 172637 6 Halovirus(33.33%) NA NA
DBSCAN-SWA_18 182357 : 183980 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_19 188464 : 195090 6 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_20 202597 : 204148 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_21 209892 : 212026 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_22 218581 : 219679 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_23 222906 : 225672 1 Herpes_simplex_virus(100.0%) NA NA
DBSCAN-SWA_24 228983 : 231138 2 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_25 246962 : 248006 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_26 252886 : 253990 1 Bathycoccus_sp._RCC1105_virus(100.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_CP018235
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14965 : 60158 37 Streptococcus_phage(54.55%) integrase,transposase attL 22508:22523|attR 63345:63360
DBSCAN-SWA_2 151872 : 202114 39 Pseudomonas_phage(18.18%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage