1. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 10.15|1571642|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 10.15|1571642|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 10.15|1571642|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 10.15|1571642|22|NZ_CP018304|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 9.14|1211278|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909
ggacggtggtaccggcggtcag CRISPR spacer
tgacggtggtgccggcggtcag Protospacer
*********.***********
9. spacer 10.2|1570716|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 10.2|1570716|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 10.2|1570716|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 10.2|1570716|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 10.2|1570716|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
14. spacer 10.3|1570770|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
15. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
16. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
17. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
18. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
19. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
24. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
25. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
26. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
27. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
28. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
29. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
30. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
31. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
32. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
33. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
34. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
35. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
36. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
37. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
38. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
41. spacer 1.11|333946|27|NZ_CP018304|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
42. spacer 1.11|333946|27|NZ_CP018304|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
43. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
44. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
45. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
46. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
47. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
48. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
49. spacer 7.16|923545|24|NZ_CP018304|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
50. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
51. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
52. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
53. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
54. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
55. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
56. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
57. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
58. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
59. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
60. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
61. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccggcggtgccggcggcgggctg Protospacer
***************** *****
62. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccggcggtgccggcggcgggctg Protospacer
***************** *****
63. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP023976 (Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.1, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccggcggtgcaggcggctggctg Protospacer
*********** ***** ******
64. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggtgccggcgg--gtggctg CRISPR spacer
tgccggcggtgccggcggctgtagc-- Protospacer
****************** **.**
65. spacer 9.10|1211077|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
66. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
67. spacer 10.4|1570824|22|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
68. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
69. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
70. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
71. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
72. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
73. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
74. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
75. spacer 10.15|1571642|22|NZ_CP018304|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
76. spacer 12.5|2076032|24|NZ_CP018304|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
77. spacer 12.5|2076032|24|NZ_CP018304|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
78. spacer 3.1|366318|27|NZ_CP018304|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
79. spacer 3.1|366318|27|NZ_CP018304|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
80. spacer 3.7|366714|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
81. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
82. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
83. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
84. spacer 7.10|923260|27|NZ_CP018304|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
85. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
86. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
87. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
88. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
89. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
90. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
91. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
92. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
93. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
94. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
95. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
96. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
97. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
98. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
99. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
100. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
101. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
102. spacer 7.16|923545|24|NZ_CP018304|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
103. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
104. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
105. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
106. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
gtccggcggccttggcgtagcgcct Protospacer
**********.***********.
107. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
108. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
***********.****** ****
109. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtaatggtc Protospacer
*******************..* .*
110. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcatcggcgtagcggcg Protospacer
.********* *********** *
111. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcctccgcgtcgcgcct Protospacer
.************ **** *****.
112. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcgggc Protospacer
.*.******************* *
113. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggccgcgtcgtagcgcca Protospacer
.********** ** *********
114. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
115. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggtgtcctcggcgtagcgcga Protospacer
******.* **************
116. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
117. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggctgcctcggcatagcgccg Protospacer
****** ********.*******
118. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
119. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggtggcctcggcgtagccccg Protospacer
.*****.************** **
120. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
121. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tggcggcggcctcgccgtagcgctt Protospacer
** *********** ********..
122. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcggac Protospacer
.*.******************* *
123. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
agccggcggcctcggcctcgcgccg Protospacer
*************** * *****
124. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
125. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
126. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
127. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
128. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
129. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
130. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
131. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
132. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
133. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
134. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
135. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
136. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
137. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
138. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
139. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
140. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
141. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
142. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
143. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
144. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
145. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
146. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
147. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
148. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
149. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
150. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
151. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
152. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
cgccggcgatgccggcgggtggcaa Protospacer
.*******.************** .
153. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
154. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
155. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
156. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
157. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
158. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
159. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
160. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
161. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
162. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
163. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
164. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
165. spacer 9.7|1210921|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggtgccggcgggtggctg CRISPR spacer
ggccagccgtgccggcgggtggctc Protospacer
***.** ****************
166. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
167. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
168. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
169. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
170. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
171. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
172. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
173. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
174. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
175. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
176. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
177. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
178. spacer 10.14|1571585|25|NZ_CP018304|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
179. spacer 12.5|2076032|24|NZ_CP018304|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
180. spacer 12.5|2076032|24|NZ_CP018304|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
181. spacer 12.5|2076032|24|NZ_CP018304|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
182. spacer 1.2|333466|27|NZ_CP018304|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815
ccggcgcctagagcgttggcaccgctg CRISPR spacer
ctcgggcctagagcgttggcaccgtgg Protospacer
*. * *******************. *
183. spacer 1.11|333946|27|NZ_CP018304|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
ccgccgttggcgaccagtccgcaatca Protospacer
************* ******** .*..
184. spacer 1.11|333946|27|NZ_CP018304|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gggtcgtcggagaacagtccgccgttg Protospacer
*.***.** ****************
185. spacer 1.11|333946|27|NZ_CP018304|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gtggcgttgtcgaacagaccgccgttg Protospacer
.* ***** ******* *********
186. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggtcaccgccagcggggccagga Protospacer
********* ************ ***. *.
187. spacer 1.12|333991|30|NZ_CP018304|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccgatccagacaccgccagcggcgccgagg Protospacer
***..* .******************* **
188. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcg-ccgtgg CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg- Protospacer
***************** ***** **.*
189. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
190. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
191. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
192. spacer 3.1|366318|27|NZ_CP018304|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
193. spacer 3.1|366318|27|NZ_CP018304|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
194. spacer 3.7|366714|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
195. spacer 3.7|366714|27|NZ_CP018304|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
196. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
197. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
198. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
199. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
200. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
201. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
202. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
203. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
204. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
205. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
206. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
207. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
208. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
209. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
210. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
211. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
212. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
213. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
214. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
215. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
216. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
217. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
218. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
219. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
220. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
221. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
222. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
223. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
224. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
225. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
226. spacer 7.5|923050|27|NZ_CP018304|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
227. spacer 7.5|923050|27|NZ_CP018304|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
228. spacer 7.5|923050|27|NZ_CP018304|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
229. spacer 7.5|923050|27|NZ_CP018304|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
230. spacer 7.5|923050|27|NZ_CP018304|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
231. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
232. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
233. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
234. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
235. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
236. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
237. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
238. spacer 7.10|923260|27|NZ_CP018304|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
239. spacer 7.10|923260|27|NZ_CP018304|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
240. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
241. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
242. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
243. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
244. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
245. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
246. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
247. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
248. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
249. spacer 7.15|923497|30|NZ_CP018304|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
250. spacer 7.16|923545|24|NZ_CP018304|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
251. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
252. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
gcgcggcggcctcggcgtagagccg Protospacer
***************** ***
253. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
254. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
caccggcggcctcggcgtagcttgc Protospacer
..******************* . *
255. spacer 9.4|1210741|25|NZ_CP018304|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
256. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
257. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
258. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
259. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
260. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
261. spacer 10.5|1570878|25|NZ_CP018304|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
262. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
263. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
264. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
265. spacer 10.13|1571519|34|NZ_CP018304|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
266. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
267. spacer 1.3|333511|30|NZ_CP018304|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
tcagcggagccgaagatcacgccgccgagc Protospacer
.*.************* ** ******* *
268. spacer 1.12|333991|30|NZ_CP018304|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg Protospacer
*************** ** ***** * *
269. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg---- CRISPR spacer
ccagccgggagaccgccagcggc----tggctct Protospacer
**.******* ************ ***
270. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc Protospacer
.**** ******.**************
271. spacer 3.1|366318|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
272. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
273. spacer 3.7|366714|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
274. spacer 3.9|366864|27|NZ_CP018304|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
275. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
276. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
277. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
278. spacer 3.10|366924|27|NZ_CP018304|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
279. spacer 4.1|577662|36|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 6, identity: 0.833
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggcaccacccgcttgcgggggaggatcgaacg Protospacer
***************************..* * .*
280. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
281. spacer 5.2|628363|30|NZ_CP018304|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
282. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
283. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
284. spacer 5.2|628363|30|NZ_CP018304|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
285. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
286. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
287. spacer 5.2|628363|30|NZ_CP018304|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
288. spacer 5.2|628363|30|NZ_CP018304|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
289. spacer 5.2|628363|30|NZ_CP018304|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
290. spacer 5.2|628363|30|NZ_CP018304|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
291. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
292. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
293. spacer 5.2|628363|30|NZ_CP018304|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
294. spacer 5.2|628363|30|NZ_CP018304|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
295. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
296. spacer 7.5|923050|27|NZ_CP018304|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
gatggccggtaggctgttgaacggcgc Protospacer
.. *******.******* *******
297. spacer 7.5|923050|27|NZ_CP018304|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
298. spacer 7.5|923050|27|NZ_CP018304|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
299. spacer 7.5|923050|27|NZ_CP018304|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
300. spacer 7.5|923050|27|NZ_CP018304|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
301. spacer 7.5|923050|27|NZ_CP018304|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
302. spacer 7.5|923050|27|NZ_CP018304|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
303. spacer 7.5|923050|27|NZ_CP018304|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
304. spacer 7.10|923260|27|NZ_CP018304|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
305. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
306. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
307. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
308. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
309. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
310. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
311. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
312. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
313. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
314. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
315. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
316. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
317. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
318. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
319. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
320. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
321. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
322. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
323. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
324. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
325. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
326. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
327. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
328. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
329. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
330. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
331. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
332. spacer 7.15|923497|30|NZ_CP018304|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
333. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
334. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
335. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
336. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
337. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
338. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
339. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
340. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
341. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
342. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
343. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
344. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
345. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
346. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
347. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
348. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
349. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
350. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
351. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
352. spacer 7.15|923497|30|NZ_CP018304|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
353. spacer 7.17|923587|36|NZ_CP018304|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
354. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
355. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
356. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
357. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
358. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
359. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
360. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
361. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
362. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
363. spacer 10.13|1571519|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
364. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
365. spacer 1.3|333511|30|NZ_CP018304|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc Protospacer
******.******** ******** .. *
366. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca Protospacer
******.******** ********* . .
367. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca Protospacer
..**** ** *****************. .
368. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc Protospacer
* ******.***************. . *
369. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc Protospacer
.** *.. *** *****************
370. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacaccga Protospacer
******.*************.**.* .*.
371. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
372. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
373. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
374. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg Protospacer
******** **.*********** .**
375. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
accgcatcgaccccgccagcggcgccgtga Protospacer
* ** *** *****************.
376. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
377. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
378. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
379. spacer 3.4|366513|27|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
380. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
381. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
382. spacer 5.2|628363|30|NZ_CP018304|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
383. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
384. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
385. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
386. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
387. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
388. spacer 5.2|628363|30|NZ_CP018304|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
389. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
390. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
391. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
392. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
393. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
394. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
395. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
396. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
397. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
398. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
399. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
400. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
401. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
402. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
403. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
404. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
405. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
406. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
407. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
408. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
409. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
410. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
411. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
412. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
413. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
414. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
415. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
416. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
417. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
418. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
419. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
420. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
421. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
422. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
423. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
424. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
425. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
426. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
427. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
428. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
429. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
430. spacer 7.13|923401|30|NZ_CP018304|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
431. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
432. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
433. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
434. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
435. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
436. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
437. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
438. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
439. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
440. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
441. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
442. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
443. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
444. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
445. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
446. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
447. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
448. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
449. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
450. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
451. spacer 7.13|923401|30|NZ_CP018304|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
452. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
453. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
454. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
455. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
456. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
457. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
458. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
459. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
460. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
461. spacer 7.13|923401|30|NZ_CP018304|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
462. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
463. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
464. spacer 7.13|923401|30|NZ_CP018304|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
465. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
466. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
467. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
468. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
469. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
470. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
471. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
472. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
473. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
474. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
475. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
476. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
477. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
478. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
479. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
480. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
481. spacer 7.13|923401|30|NZ_CP018304|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
482. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
483. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
484. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
485. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
486. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
487. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
488. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
489. spacer 7.13|923401|30|NZ_CP018304|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
490. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
491. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
492. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
493. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
494. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
495. spacer 7.13|923401|30|NZ_CP018304|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
496. spacer 7.13|923401|30|NZ_CP018304|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
497. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
498. spacer 7.13|923401|30|NZ_CP018304|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
499. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
500. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
501. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
502. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
503. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
504. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
505. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
506. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
507. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
508. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
509. spacer 7.15|923497|30|NZ_CP018304|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
510. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
511. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
512. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
513. spacer 7.15|923497|30|NZ_CP018304|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
514. spacer 7.15|923497|30|NZ_CP018304|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
515. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
516. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
517. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
518. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
519. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
520. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
521. spacer 7.17|923587|36|NZ_CP018304|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
522. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
523. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
524. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
525. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
526. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
527. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
528. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
529. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
530. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
531. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
532. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
533. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
534. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
535. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
536. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
537. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
538. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
539. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
540. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
541. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
542. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
543. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
544. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
545. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
546. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
547. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
548. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
549. spacer 10.1|1570656|28|NZ_CP018304|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
550. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
551. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
552. spacer 12.3|2075942|30|NZ_CP018304|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
553. spacer 12.3|2075942|30|NZ_CP018304|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
554. spacer 12.3|2075942|30|NZ_CP018304|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
555. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
556. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
557. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
558. spacer 1.3|333511|30|NZ_CP018304|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
agcacgaagccgaagagaaagccgccgatg Protospacer
.**.********** ********* *
559. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcaccctggacaccgcctgcggcgccggac Protospacer
.*. ** ********** ********* .
560. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcacgaaca Protospacer
******.******** *******.* . .
561. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga Protospacer
.** **************** ****.
562. spacer 1.12|333991|30|NZ_CP018304|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcg----gcgccgtgg CRISPR spacer
agggccgggacaccgcccgcggccagcgct---- Protospacer
*************** *** ****.
563. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
564. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
565. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
566. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
567. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
568. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
569. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
570. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
571. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
572. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
573. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
574. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
575. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
576. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
577. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
578. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
579. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
580. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
581. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
582. spacer 7.13|923401|30|NZ_CP018304|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
583. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
584. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
585. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
586. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
587. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
588. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
589. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
590. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
591. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
592. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
593. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
594. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
595. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
596. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
597. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
598. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
599. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
600. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
601. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
602. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
603. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
604. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
605. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
606. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
607. spacer 7.17|923587|36|NZ_CP018304|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
608. spacer 7.17|923587|36|NZ_CP018304|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
609. spacer 7.17|923587|36|NZ_CP018304|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
610. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
611. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
612. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
613. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
614. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
615. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
616. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
617. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
618. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
619. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
620. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
621. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
622. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
623. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
624. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
625. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
626. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
627. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
628. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
629. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
630. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
631. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
632. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
633. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
634. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
635. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
636. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
637. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
638. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
639. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
640. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
641. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
642. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
643. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
644. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
645. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
646. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
647. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
648. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
649. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
650. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
651. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
652. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
653. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
654. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
655. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
656. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
657. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
658. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
659. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
660. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
661. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
662. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
663. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
664. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
665. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
666. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
667. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
668. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
669. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
670. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
671. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
672. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
673. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
674. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
675. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
676. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
677. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
678. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
679. spacer 12.3|2075942|30|NZ_CP018304|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
680. spacer 12.3|2075942|30|NZ_CP018304|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
681. spacer 15.21|3109646|29|NZ_CP018304|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
682. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
683. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
684. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
685. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
686. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
687. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
688. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
689. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
690. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
691. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
692. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
693. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
694. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
695. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
696. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
697. spacer 16.7|3726673|31|NZ_CP018304|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
698. spacer 1.13|334039|39|NZ_CP018304|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag Protospacer
***. *. **************** *** *******
699. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
700. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
701. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
702. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
703. spacer 4.1|577662|36|NZ_CP018304|CRISPRCasFinder matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 9, identity: 0.75
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggcacctcccgctcgcgggggaccatcgccac Protospacer
********** ******.******** .* ** .
704. spacer 4.1|577662|36|NZ_CP018304|CRISPRCasFinder matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 9, identity: 0.75
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggcacctcccgctcgcgggggaccatcgccac Protospacer
********** ******.******** .* ** .
705. spacer 5.2|628363|30|NZ_CP018304|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
706. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
707. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
708. spacer 6.1|689066|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
709. spacer 7.13|923401|30|NZ_CP018304|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
710. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
711. spacer 7.15|923497|30|NZ_CP018304|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
712. spacer 7.17|923587|36|NZ_CP018304|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
713. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
714. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
715. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
716. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
717. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
718. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
719. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
720. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
721. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
722. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
723. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
724. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
725. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
726. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
727. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
728. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
729. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
730. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
731. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
732. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
733. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
734. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
735. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
736. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
737. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
738. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
739. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
740. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
741. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
742. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
743. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
744. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
745. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
746. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
747. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
748. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
749. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
750. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
751. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
752. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
753. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
754. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
755. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
756. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
757. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
758. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
759. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
760. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
761. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
762. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
763. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
764. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
765. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
766. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
767. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
768. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
769. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
770. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
771. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
772. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
773. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
774. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
775. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
776. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
777. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
778. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
779. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
780. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
781. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
782. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
783. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
784. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
785. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
786. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
787. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
788. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
789. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
790. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
791. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
792. spacer 16.5|3726532|34|NZ_CP018304|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
793. spacer 16.5|3726532|34|NZ_CP018304|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
794. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
795. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
796. spacer 3.6|366648|33|NZ_CP018304|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
797. spacer 4.1|577662|36|NZ_CP018304|CRISPRCasFinder matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 10, identity: 0.722
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggcacctcccgcgtgcgggggaacatcatttt Protospacer
********** ***** *********. .* .. .*
798. spacer 7.2|922897|39|NZ_CP018304|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
799. spacer 7.17|923587|36|NZ_CP018304|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
800. spacer 7.17|923587|36|NZ_CP018304|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
801. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
802. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
803. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
804. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
805. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
806. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
807. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
808. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
809. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
810. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
811. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
812. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
813. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
814. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
815. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
816. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
817. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
818. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
819. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
820. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
821. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
822. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
823. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
824. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
825. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
826. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
827. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
828. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
829. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
830. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
831. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
832. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
833. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
834. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
835. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
836. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
837. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
838. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
839. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
840. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
841. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
842. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
843. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
844. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
845. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
846. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
847. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
848. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
849. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
850. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
851. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
852. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
853. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
854. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
855. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
856. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
857. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
858. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
859. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
860. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
861. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
862. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
863. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
864. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
865. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
866. spacer 10.10|1571270|31|NZ_CP018304|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
867. spacer 10.13|1571519|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
868. spacer 14.9|3107337|35|NZ_CP018304|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
869. spacer 15.17|3110519|34|NZ_CP018304|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
870. spacer 15.33|3110523|34|NZ_CP018304|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
871. spacer 16.5|3726532|34|NZ_CP018304|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
872. spacer 16.5|3726532|34|NZ_CP018304|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
873. spacer 16.5|3726532|34|NZ_CP018304|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
874. spacer 16.5|3726532|34|NZ_CP018304|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
875. spacer 16.9|3726805|37|NZ_CP018304|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.73
cttgccggcggtgccggcgaccgcggtgccgccggtg CRISPR spacer
ggagacggcggtgccggagaccgcggtgtcgctgccc Protospacer
* ************ **********.***.* .
876. spacer 4.1|577662|36|NZ_CP018304|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 11, identity: 0.694
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggtacctcccgcttgcgggggacgacctccgc Protospacer
******.*** *************** ... * .
877. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
878. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
879. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
880. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
881. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
882. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
883. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
884. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
885. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
886. spacer 9.5|1210789|40|NZ_CP018304|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725
tgccggcggcgccggcggtgtcggcggacccgccgggttg CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc Protospacer
*..******.***************** *** .*. *
887. spacer 16.5|3726532|34|NZ_CP018304|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
888. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
889. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
890. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
891. spacer 9.3|1210684|34|NZ_CP018304|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*