Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018137 Streptococcus pneumoniae strain SP61 chromosome, complete genome 3 crisprs DEDDh,cas3,DinG 0 1 13 0

Results visualization

1. NZ_CP018137
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018137_1 1015065-1015168 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018137_2 1368151-1368283 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018137_3 1595419-1595503 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018137_1 1.1|1015098|38|NZ_CP018137|CRISPRCasFinder 1015098-1015135 38 KY065475 Streptococcus phage IPP35, complete genome 23044-23081 4 0.895
NZ_CP018137_1 1.1|1015098|38|NZ_CP018137|CRISPRCasFinder 1015098-1015135 38 MK448453 Streptococcus satellite phage Javan360, complete genome 13985-14022 5 0.868

1. spacer 1.1|1015098|38|NZ_CP018137|CRISPRCasFinder matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 4, identity: 0.895

agatattatggagcctattttattgtagaaaaaaaggg	CRISPR spacer
agatattatggagcctatttttgtgtagaaaaaaagtc	Protospacer
*********************  *************  

2. spacer 1.1|1015098|38|NZ_CP018137|CRISPRCasFinder matches to MK448453 (Streptococcus satellite phage Javan360, complete genome) position: , mismatch: 5, identity: 0.868

agatattatggagcctattttattgtagaaaaaaaggg	CRISPR spacer
gaatattatggagcctattttgttgtagaaaaaaagtc	Protospacer
..*******************.**************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39996 : 51307 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 92347 : 133782 42 Streptococcus_phage(40.0%) transposase,tRNA,bacteriocin NA
DBSCAN-SWA_3 178420 : 186246 13 Streptococcus_phage(75.0%) NA NA
DBSCAN-SWA_4 309442 : 364061 47 Streptococcus_phage(23.08%) holin,transposase,protease,integrase attL 312290:312303|attR 365443:365456
DBSCAN-SWA_5 435621 : 498515 55 Klosneuvirus(18.18%) transposase,protease,tRNA,bacteriocin NA
DBSCAN-SWA_6 728737 : 735743 10 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_7 849436 : 912510 57 Indivirus(15.79%) holin,transposase,protease NA
DBSCAN-SWA_8 1157118 : 1210906 45 Streptococcus_phage(44.44%) protease,integrase,transposase,holin,tRNA,bacteriocin attL 1161484:1161528|attR 1214568:1214612
DBSCAN-SWA_9 1273229 : 1323877 44 Streptococcus_phage(23.08%) transposase,tRNA,protease,bacteriocin NA
DBSCAN-SWA_10 1391667 : 1398426 9 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_11 1653292 : 1660707 11 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_12 1742157 : 1771578 33 Streptococcus_phage(89.29%) transposase,bacteriocin,integrase attL 1733857:1733872|attR 1774122:1774137
DBSCAN-SWA_13 2049997 : 2058751 9 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage