Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018138 Streptococcus pneumoniae strain SP64 chromosome, complete genome 3 crisprs DEDDh,cas3,DinG 0 1 13 0

Results visualization

1. NZ_CP018138
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018138_1 1016778-1016881 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018138_2 1369880-1370012 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018138_3 1595811-1595895 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018138_1 1.1|1016811|38|NZ_CP018138|CRISPRCasFinder 1016811-1016848 38 KY065475 Streptococcus phage IPP35, complete genome 23044-23081 4 0.895
NZ_CP018138_1 1.1|1016811|38|NZ_CP018138|CRISPRCasFinder 1016811-1016848 38 MK448453 Streptococcus satellite phage Javan360, complete genome 13985-14022 5 0.868

1. spacer 1.1|1016811|38|NZ_CP018138|CRISPRCasFinder matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 4, identity: 0.895

agatattatggagcctattttattgtagaaaaaaaggg	CRISPR spacer
agatattatggagcctatttttgtgtagaaaaaaagtc	Protospacer
*********************  *************  

2. spacer 1.1|1016811|38|NZ_CP018138|CRISPRCasFinder matches to MK448453 (Streptococcus satellite phage Javan360, complete genome) position: , mismatch: 5, identity: 0.868

agatattatggagcctattttattgtagaaaaaaaggg	CRISPR spacer
gaatattatggagcctattttgttgtagaaaaaaagtc	Protospacer
..*******************.**************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39995 : 51306 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 92300 : 122971 33 Streptococcus_phage(40.0%) transposase,bacteriocin NA
DBSCAN-SWA_3 180083 : 187909 13 Streptococcus_phage(75.0%) NA NA
DBSCAN-SWA_4 311104 : 365723 47 Streptococcus_phage(23.08%) protease,transposase,holin,integrase attL 313952:313965|attR 367105:367118
DBSCAN-SWA_5 437289 : 500183 55 Klosneuvirus(18.18%) protease,transposase,bacteriocin,tRNA NA
DBSCAN-SWA_6 730450 : 737456 10 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_7 851149 : 914223 57 Indivirus(15.79%) protease,transposase,holin NA
DBSCAN-SWA_8 1158818 : 1212606 45 Streptococcus_phage(44.44%) tRNA,holin,protease,transposase,integrase,bacteriocin attL 1163184:1163228|attR 1216268:1216312
DBSCAN-SWA_9 1274937 : 1325585 44 Streptococcus_phage(23.08%) protease,transposase,bacteriocin,tRNA NA
DBSCAN-SWA_10 1393906 : 1400665 9 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_11 1653686 : 1661059 10 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_12 1742518 : 1771881 32 Streptococcus_phage(89.29%) transposase,bacteriocin,integrase attL 1734217:1734232|attR 1774425:1774440
DBSCAN-SWA_13 2051298 : 2060052 9 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage