Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010127 Escherichia coli strain C8 plasmid B, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP010126 Escherichia coli strain C8 plasmid A, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP010128 Escherichia coli strain C8 plasmid C, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010125 Escherichia coli strain C8 chromosome, complete genome 6 crisprs DEDDh,DinG,cas3,c2c9_V-U4,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 12 6 0

Results visualization

1. NZ_CP010127
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010127_1 33205-33324 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 63874-63907 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 64169-64202 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 38215-38248 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 37006-37039 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP010164 Escherichia coli strain H2 plasmid A, complete sequence 20751-20784 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 239581-239614 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP022964 Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence 30266-30299 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP024467 Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence 17630-17663 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 16611-16644 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 53074-53107 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 32601-32634 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 1762-1795 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 23725-23758 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 35337-35370 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 26770-26803 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 41390-41423 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 60962-60995 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 39391-39424 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032389 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence 9889-9922 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_LT904873 Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2 5696-5729 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_KT754163 Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence 12265-12298 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 7366-7399 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP020836 Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence 20407-20440 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 93494-93527 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP043216 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence 32193-32226 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 25537-25570 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP031361 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence 27033-27066 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 25749-25782 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 2187-2220 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP033386 Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence 34721-34754 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 4942-4975 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 47580-47613 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 14631-14664 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP047339 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence 28949-28982 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_010860 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence 32623-32656 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP022453 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence 5893-5926 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 53536-53569 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 39815-39848 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP005994 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence 30028-30061 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 29110-29143 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 14497-14530 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 58667-58700 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP029061 Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence 10786-10819 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 29459-29492 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 79278-79311 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 54169-54202 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 29459-29492 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 61147-61180 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 99797-99830 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 88012-88045 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 41949-41982 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 53619-53652 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 32551-32584 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP010127 Escherichia coli strain C8 plasmid B, complete genome 33248-33281 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 85971-86004 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP022072 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence 18650-18683 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 20398-20431 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 147056-147089 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 35339-35372 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032394 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence 32800-32833 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 2112-2145 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 16816-16849 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 68260-68293 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 90-123 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 33434-33467 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 96892-96925 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 63333-63366 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 238663-238696 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 37880-37913 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 22155-22188 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 28203-28236 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 18380-18413 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 118004-118037 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 151970-152003 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 243053-243086 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 241163-241196 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP025558 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence 11939-11972 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 90443-90476 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 43726-43759 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 48918-48951 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 33352-33385 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 58347-58380 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 61256-61289 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 61256-61289 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 27964-27997 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 61256-61289 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 43736-43769 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 80789-80822 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT219822 Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence 38970-39003 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 73817-73850 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 18865-18898 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 14942-14975 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP016575 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence 296-329 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 30572-30605 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032994 Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence 10049-10082 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MN783746 Escherichia coli plasmid pIncX1_p1, complete sequence 5290-5323 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 40397-40430 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_KU254580 Escherichia coli strain YD786 plasmid pYD786-3, complete sequence 25507-25540 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 38916-38949 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 67739-67772 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 35028-35061 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 69102-69135 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP037995 Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281 7255-7288 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 9971-10004 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP016580 Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence 23703-23736 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 49989-50022 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 56470-56503 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP029182 Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence 2302-2335 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 90173-90206 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP053047 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence 9874-9907 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP014974 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence 295-328 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 220331-220364 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 12757-12790 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP044182 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence 25543-25576 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP042608 Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence 7171-7204 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 45261-45294 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_019046 Escherichia coli plasmid pNMEC31_31, complete sequence 31361-31394 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 89191-89224 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 30748-30781 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 28493-28526 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 5878-5911 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_024961 Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence 905-938 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_021842 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence 4017-4050 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_LT985261 Escherichia coli strain 657 plasmid RCS50_p, complete sequence 42585-42618 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_AP019678 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence 49115-49148 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP009074 Escherichia coli ATCC 25922 plasmid unnamed, complete sequence 21137-21170 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 25682-25715 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_010378 Escherichia coli plasmid pOLA52, complete sequence 34562-34595 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 23704-23737 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP016529 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence 23704-23737 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP016518 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence 23705-23738 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 50710-50743 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 23885-23918 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP012922 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence 23704-23737 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP033093 Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence 19532-19565 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 37369-37402 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP023360 Escherichia coli strain 1943 plasmid p54, complete sequence 52726-52759 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 37807-37840 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP039600 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence 32872-32905 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 49947-49980 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 70648-70681 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_017624 Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence 23689-23722 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 15569-15602 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP024290 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence 33653-33686 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 1446-1479 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 4799-4832 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050773 Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence 30707-30740 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 38005-38038 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 24566-24599 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050765 Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence 6593-6626 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 59434-59467 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050759 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence 5734-5767 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_AP022652 Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence 295-328 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP024136 Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence 79478-79511 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_LT985315 Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence 47119-47152 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MN436006 Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence 27492-27525 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MN436007 Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence 27131-27164 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 44664-44697 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 48284-48317 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 12454-12487 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 43402-43435 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT197111 Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence 12897-12930 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 59284-59317 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 118931-118964 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 MT219821 Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence 3734-3767 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 29004-29037 0 1.0
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 159-192 1 0.971
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 78450-78483 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP050780 Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence 203947-203980 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP022061 Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence 1711-1744 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 CP048927 Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence 45611-45644 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP029841 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence 98434-98467 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP028313 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence 41569-41602 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP018662 Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence 41992-42025 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 CP049987 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence 41386-41419 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 CP049982 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence 42740-42773 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NC_010421 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence 27662-27695 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_MK625201 Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence 41824-41857 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP023476 Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence 33473-33506 2 0.941
NZ_CP010127_1 1.1|33248|34|NZ_CP010127|CRISPRCasFinder 33248-33281 34 NZ_CP044292 Escherichia coli strain P43A plasmid pP43A-1, complete sequence 44259-44292 4 0.882

1. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

2. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

3. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

4. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

5. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP010164 (Escherichia coli strain H2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

6. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

7. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP022964 (Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

8. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP024467 (Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

9. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

10. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

11. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

12. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

13. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

14. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

15. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

16. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

17. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

18. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

19. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032389 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

20. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_LT904873 (Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

21. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_KT754163 (Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

22. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

23. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP020836 (Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

24. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

25. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP043216 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

26. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

27. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP031361 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

28. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

29. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

30. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP033386 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

31. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

32. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

33. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

34. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP047339 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

35. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_010860 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

36. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP022453 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

37. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

38. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

39. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP005994 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

40. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

41. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

42. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

43. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP029061 (Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

44. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

45. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

46. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

47. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

48. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

49. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

50. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

51. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

52. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

53. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

54. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP010127 (Escherichia coli strain C8 plasmid B, complete genome) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

55. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

56. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP022072 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

57. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

58. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

59. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

60. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032394 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

61. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

62. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

63. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

64. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

65. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

66. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

67. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

68. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

69. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

70. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

71. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

72. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

73. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

74. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

75. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

76. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

77. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP025558 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

78. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

79. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

80. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

81. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

82. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

83. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

84. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

85. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

86. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

87. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

88. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

89. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT219822 (Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

90. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

91. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

92. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

93. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP016575 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

94. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

95. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032994 (Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

96. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MN783746 (Escherichia coli plasmid pIncX1_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

97. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

98. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_KU254580 (Escherichia coli strain YD786 plasmid pYD786-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

99. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

100. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

101. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

102. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

103. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP037995 (Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

104. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP053740 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

105. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP016580 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

106. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

107. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

108. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP029182 (Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

109. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

110. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

111. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP014974 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

112. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

113. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

114. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP044182 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

115. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP042608 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

116. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

117. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_019046 (Escherichia coli plasmid pNMEC31_31, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

118. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

119. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

120. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP035315 (Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

121. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050748 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

122. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_024961 (Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

123. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_021842 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

124. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_LT985261 (Escherichia coli strain 657 plasmid RCS50_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

125. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_AP019678 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

126. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP009074 (Escherichia coli ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

127. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

128. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_010378 (Escherichia coli plasmid pOLA52, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

129. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to CP016512 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

130. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP016529 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

131. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP016518 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

132. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

133. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

134. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP012922 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

135. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP033093 (Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

136. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP012926 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

137. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP023360 (Escherichia coli strain 1943 plasmid p54, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

138. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

139. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP039600 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

140. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

141. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

142. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_017624 (Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

143. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

144. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP024290 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

145. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

146. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

147. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050773 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

148. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

149. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

150. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050765 (Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

151. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

152. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050759 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

153. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_AP022652 (Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

154. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP024136 (Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

155. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_LT985315 (Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

156. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

157. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

158. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

159. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

160. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

161. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

162. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

163. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

164. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

165. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

166. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaattacag	Protospacer
**********************************

167. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP030195 (Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence) position: , mismatch: 1, identity: 0.971

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgcagccatccacctttcatgaaaatcacag	Protospacer
*****************************.****

168. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gcccgcagccatccacctttcatgaaaattacag	Protospacer
*. *******************************

169. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gcccgcagccatccacctttcatgaaaattacag	Protospacer
*. *******************************

170. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP022061 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

171. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to CP048927 (Salmonella enterica subsp. enterica serovar Saintpaul strain NY-N14748 plasmid pN14748, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

172. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP029841 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081A, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

173. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP028313 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-2, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

174. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP018662 (Salmonella enterica subsp. enterica serovar Enteritidis strain 95-0621 plasmid pSE95-0621-1, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

175. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to CP049987 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N16S133 plasmid pN16S133, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

176. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to CP049982 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N52030 plasmid pN52030, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

177. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NC_010421 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1114, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

178. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_MK625201 (Salmonella enterica subsp. enterica serovar Pullorum strain S9804 plasmid pSPUR, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

179. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP023476 (Salmonella enterica subsp. enterica serovar Enteritidis strain FORC_075 plasmid pFORC75_2, complete sequence) position: , mismatch: 2, identity: 0.941

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
gtgcgtacccatccacctttcatgaaaattacag	Protospacer
*****.* **************************

180. spacer 1.1|33248|34|NZ_CP010127|CRISPRCasFinder matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 4, identity: 0.882

gtgcgcagccatccacctttcatgaaaattacag	CRISPR spacer
tcgaacagccatccacctttcatgaaaattacag	Protospacer
 .* .*****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP010126
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9095 : 70406 49 Stx2-converting_phage(27.27%) holin,integrase,transposase,bacteriocin attL 15438:15460|attR 75994:76016
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP010125
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010125_1 481177-481292 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010125_2 751245-751398 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010125_3 2253793-2253924 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010125_4 3499231-3499625 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010125_5 3525323-3525839 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010125_6 3967598-3967737 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010125_2 2.1|751298|48|NZ_CP010125|CRISPRCasFinder 751298-751345 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
NZ_CP010125_2 2.1|751298|48|NZ_CP010125|CRISPRCasFinder 751298-751345 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
NZ_CP010125_2 2.1|751298|48|NZ_CP010125|CRISPRCasFinder 751298-751345 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
NZ_CP010125_2 2.1|751298|48|NZ_CP010125|CRISPRCasFinder 751298-751345 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
NZ_CP010125_4 4.1|3499258|34|NZ_CP010125|CRT 3499258-3499291 34 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246970 3 0.912
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
NZ_CP010125_5 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT 3525413-3525444 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
NZ_CP010125_5 5.10|3525414|32|NZ_CP010125|PILER-CR 3525414-3525445 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
NZ_CP010125_6 6.1|3967647|42|NZ_CP010125|CRISPRCasFinder 3967647-3967688 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
NZ_CP010125_4 4.8|3499382|32|NZ_CP010125|PILER-CR 3499382-3499413 32 MK448454 Streptococcus satellite phage Javan361, complete genome 9192-9223 8 0.75
NZ_CP010125_4 4.11|3499565|32|NZ_CP010125|PILER-CR 3499565-3499596 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18008 8 0.75
NZ_CP010125_4 4.11|3499565|32|NZ_CP010125|PILER-CR 3499565-3499596 32 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97497-97528 8 0.75
NZ_CP010125_5 5.3|3525474|32|NZ_CP010125|CRISPRCasFinder,CRT 3525474-3525505 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
NZ_CP010125_5 5.11|3525475|32|NZ_CP010125|PILER-CR 3525475-3525506 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
NZ_CP010125_6 6.1|3967647|42|NZ_CP010125|CRISPRCasFinder 3967647-3967688 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
NZ_CP010125_4 4.6|3499563|34|NZ_CP010125|CRT,CRISPRCasFinder 3499563-3499596 34 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18010 9 0.735
NZ_CP010125_4 4.11|3499565|32|NZ_CP010125|PILER-CR 3499565-3499596 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405906 9 0.719
NZ_CP010125_6 6.1|3967647|42|NZ_CP010125|CRISPRCasFinder 3967647-3967688 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
NZ_CP010125_4 4.11|3499565|32|NZ_CP010125|PILER-CR 3499565-3499596 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248362-2248393 10 0.688
NZ_CP010125_5 5.8|3525779|32|NZ_CP010125|CRISPRCasFinder,CRT 3525779-3525810 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
NZ_CP010125_5 5.16|3525780|32|NZ_CP010125|PILER-CR 3525780-3525811 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
NZ_CP010125_4 4.1|3499258|34|NZ_CP010125|CRT 3499258-3499291 34 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141276-141309 11 0.676

1. spacer 2.1|751298|48|NZ_CP010125|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

2. spacer 2.1|751298|48|NZ_CP010125|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

3. spacer 2.1|751298|48|NZ_CP010125|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

4. spacer 2.1|751298|48|NZ_CP010125|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

5. spacer 4.1|3499258|34|NZ_CP010125|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.912

tctaagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
tccaagtgatgtccatcatcgcatccagtgcgtc	Protospacer
**.*******.*********************.*

6. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

7. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

8. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

9. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

10. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

11. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

12. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

13. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

14. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

15. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

16. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

17. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

18. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

19. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

20. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

21. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

22. spacer 5.2|3525413|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

23. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

24. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

25. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

26. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

27. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

28. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

29. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

30. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

31. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

32. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

33. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

34. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

35. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

36. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

37. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

38. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

39. spacer 5.10|3525414|32|NZ_CP010125|PILER-CR matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

40. spacer 6.1|3967647|42|NZ_CP010125|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
gcgtaggccagataaggcgtttacgccgcatccggcatttgt	Protospacer
.******.*********.****************.*  .***

41. spacer 4.8|3499382|32|NZ_CP010125|PILER-CR matches to MK448454 (Streptococcus satellite phage Javan361, complete genome) position: , mismatch: 8, identity: 0.75

tgaagcatcaaacatttggtggaccaaacgga	CRISPR spacer
tgaagaatcaaaaatttggtggattgataaga	Protospacer
***** ****** **********...*  .**

42. spacer 4.11|3499565|32|NZ_CP010125|PILER-CR matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
agttggtagcggccctgcgcgtcggtgacgct	Protospacer
   .******* * ****************  

43. spacer 4.11|3499565|32|NZ_CP010125|PILER-CR matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
ttgaagaagcgcgactgcgcgtcggtgacgtc	Protospacer
*.. .* ***** *****************  

44. spacer 5.3|3525474|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggttcactcacgcaacgtctgagcgcgttga	CRISPR spacer
cggggtaatcacgcaacgtccgaccgcgttgt	Protospacer
.**  .* ************.** ******* 

45. spacer 5.11|3525475|32|NZ_CP010125|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggttcactcacgcaacgtctgagcgcgttga	CRISPR spacer
cggggtaatcacgcaacgtccgaccgcgttgt	Protospacer
.**  .* ************.** ******* 

46. spacer 6.1|3967647|42|NZ_CP010125|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaat	Protospacer
 .*******.*******.******************  * .*

47. spacer 4.6|3499563|34|NZ_CP010125|CRT,CRISPRCasFinder matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

actcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
gcagttggtagcggccctgcgcgtcggtgacgct	Protospacer
.*   .******* * ****************  

48. spacer 4.11|3499565|32|NZ_CP010125|PILER-CR matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
ttgaagaagcgcgactgcgcgtcagtgacgtc	Protospacer
*.. .* ***** **********.******  

49. spacer 6.1|3967647|42|NZ_CP010125|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaac	Protospacer
 .*******.*******.******************  * ..

50. spacer 4.11|3499565|32|NZ_CP010125|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

tcacggtagcgccactgcgcgtcggtgacggg	CRISPR spacer
gggacgtcgcgccactgggcgtcggtgatgtc	Protospacer
  .  ** ********* **********.*  

51. spacer 5.8|3525779|32|NZ_CP010125|CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

actaaacttaatgatggccgttacagcgtgga	CRISPR spacer
gagtaacttaatgatgggcgtcacagcagcgg	Protospacer
.   ************* ***.*****.  *.

52. spacer 5.16|3525780|32|NZ_CP010125|PILER-CR matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

actaaacttaatgatggccgttacagcgtgga	CRISPR spacer
gagtaacttaatgatgggcgtcacagcagcgg	Protospacer
.   ************* ***.*****.  *.

53. spacer 4.1|3499258|34|NZ_CP010125|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 11, identity: 0.676

tctaagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
gactcatcgcatccatcatcggttccagtgcgcc	Protospacer
  .  .* ..***********  ***********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1027208 : 1094145 78 Enterobacteria_phage(59.32%) tRNA,lysis,terminase,integrase,transposase,capsid,portal,tail,head,protease attL 1037369:1037415|attR 1085619:1085665
DBSCAN-SWA_2 1798898 : 1861677 73 Enterobacteria_phage(27.91%) terminase,integrase,capsid,portal,tail,head,protease,plate,holin attL 1795642:1795655|attR 1829806:1829819
DBSCAN-SWA_3 1938085 : 1991083 58 Escherichia_phage(54.35%) tRNA,terminase,integrase,tail,holin attL 1932469:1932485|attR 1972611:1972627
DBSCAN-SWA_4 2554646 : 2663650 104 Escherichia_phage(39.22%) terminase,integrase,transposase,capsid,portal,tail,head,protease,holin attL 2555451:2555466|attR 2672137:2672152
DBSCAN-SWA_5 2873169 : 2882610 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_6 3478683 : 3491866 12 Escherichia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage