Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010149 Escherichia coli strain D6 plasmid A, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP010148 Escherichia coli strain D6 chromosome, complete genome 8 crisprs DinG,DEDDh,c2c9_V-U4,cas3,csa3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 0 19 8 0

Results visualization

1. NZ_CP010149
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 87077 : 109466 20 Escherichia_phage(50.0%) transposase,protease,integrase attL 73302:73316|attR 100429:100443
DBSCAN-SWA_2 125708 : 176135 52 Escherichia_phage(35.29%) bacteriocin,transposase,integrase attL 152691:152750|attR 181875:182695

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP010148
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010148_1 194844-194935 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010148_2 752183-752279 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010148_3 1054050-1054203 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010148_4 1291425-1291557 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010148_5 2758942-2759059 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010148_6 3176904-3177603 Orphan I-E
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010148_7 3204753-3205757 TypeI-E I-E
16 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010148_8 4342014-4342137 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010148_1 1.1|194870|40|NZ_CP010148|CRISPRCasFinder 194870-194909 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP010148_4 4.1|1291442|42|NZ_CP010148|PILER-CR 1291442-1291483 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
NZ_CP010148_4 4.2|1291501|40|NZ_CP010148|PILER-CR 1291501-1291540 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 0 1.0
NZ_CP010148_8 8.1|4342057|38|NZ_CP010148|CRISPRCasFinder 4342057-4342094 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP010148_3 3.1|1054103|48|NZ_CP010148|CRISPRCasFinder 1054103-1054150 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
NZ_CP010148_3 3.1|1054103|48|NZ_CP010148|CRISPRCasFinder 1054103-1054150 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
NZ_CP010148_3 3.1|1054103|48|NZ_CP010148|CRISPRCasFinder 1054103-1054150 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
NZ_CP010148_3 3.1|1054103|48|NZ_CP010148|CRISPRCasFinder 1054103-1054150 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
NZ_CP010148_6 6.8|3177360|32|NZ_CP010148|CRISPRCasFinder,CRT 3177360-3177391 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 632328-632359 5 0.844
NZ_CP010148_7 7.11|3205392|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3205392-3205423 32 NZ_CP046573 Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence 319358-319389 6 0.812
NZ_CP010148_6 6.6|3177238|32|NZ_CP010148|CRISPRCasFinder,CRT 3177238-3177269 32 NC_024792 Bacillus phage Bobb, complete genome 57906-57937 7 0.781
NZ_CP010148_6 6.11|3177543|32|NZ_CP010148|CRISPRCasFinder,CRT 3177543-3177574 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP010148_6 6.1|3176933|32|NZ_CP010148|CRISPRCasFinder,CRT 3176933-3176964 32 MK416007 Klebsiella phage ST405-OXA48phi1.2, complete genome 5007-5038 8 0.75
NZ_CP010148_6 6.4|3177116|32|NZ_CP010148|CRISPRCasFinder,CRT 3177116-3177147 32 NC_014825 Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence 131301-131332 8 0.75
NZ_CP010148_6 6.5|3177177|32|NZ_CP010148|CRISPRCasFinder,CRT 3177177-3177208 32 CP000876 Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence 90670-90701 8 0.75
NZ_CP010148_6 6.6|3177238|32|NZ_CP010148|CRISPRCasFinder,CRT 3177238-3177269 32 NZ_CP016891 Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence 114699-114730 8 0.75
NZ_CP010148_6 6.8|3177360|32|NZ_CP010148|CRISPRCasFinder,CRT 3177360-3177391 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 460575-460606 8 0.75
NZ_CP010148_6 6.11|3177543|32|NZ_CP010148|CRISPRCasFinder,CRT 3177543-3177574 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP010148_7 7.2|3204843|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3204843-3204874 32 NZ_CP029363 Streptomyces globisporus strain TFH56 plasmid pTFSG2, complete sequence 19548-19579 8 0.75
NZ_CP010148_6 6.2|3176994|32|NZ_CP010148|CRISPRCasFinder,CRT 3176994-3177025 32 NZ_CP036355 Bacillus sp. SYJ plasmid unnamed1, complete sequence 40503-40534 9 0.719
NZ_CP010148_6 6.2|3176994|32|NZ_CP010148|CRISPRCasFinder,CRT 3176994-3177025 32 NZ_CP053290 Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence 150072-150103 9 0.719
NZ_CP010148_6 6.2|3176994|32|NZ_CP010148|CRISPRCasFinder,CRT 3176994-3177025 32 NZ_CP045534 Bacillaceae bacterium C02 plasmid unnamed1, complete sequence 2445-2476 9 0.719
NZ_CP010148_6 6.3|3177055|32|NZ_CP010148|CRISPRCasFinder,CRT 3177055-3177086 32 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 80627-80658 9 0.719
NZ_CP010148_6 6.4|3177116|32|NZ_CP010148|CRISPRCasFinder,CRT 3177116-3177147 32 NZ_CP005987 Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence 65430-65461 9 0.719
NZ_CP010148_6 6.4|3177116|32|NZ_CP010148|CRISPRCasFinder,CRT 3177116-3177147 32 MN163281 Klebsiella phage KpCHEMY26, complete genome 2153-2184 9 0.719
NZ_CP010148_6 6.8|3177360|32|NZ_CP010148|CRISPRCasFinder,CRT 3177360-3177391 32 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 91348-91379 9 0.719
NZ_CP010148_6 6.9|3177421|32|NZ_CP010148|CRISPRCasFinder,CRT 3177421-3177452 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
NZ_CP010148_6 6.11|3177543|32|NZ_CP010148|CRISPRCasFinder,CRT 3177543-3177574 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP010148_7 7.5|3205026|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3205026-3205057 32 NZ_CP025505 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence 221935-221966 9 0.719
NZ_CP010148_7 7.6|3205087|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3205087-3205118 32 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 19093-19124 9 0.719
NZ_CP010148_7 7.6|3205087|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3205087-3205118 32 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 19185-19216 9 0.719
NZ_CP010148_7 7.8|3205209|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3205209-3205240 32 MN101222 Klebsiella phage KOX9, complete genome 29938-29969 9 0.719
NZ_CP010148_7 7.11|3205392|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3205392-3205423 32 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 692129-692160 9 0.719
NZ_CP010148_6 6.11|3177543|32|NZ_CP010148|CRISPRCasFinder,CRT 3177543-3177574 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
NZ_CP010148_7 7.2|3204843|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3204843-3204874 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1150866-1150897 10 0.688
NZ_CP010148_7 7.2|3204843|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3204843-3204874 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 930894-930925 10 0.688
NZ_CP010148_7 7.6|3205087|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3205087-3205118 32 AP014295 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S26-C8, *** SEQUENCING IN PROGRESS *** 23355-23386 10 0.688
NZ_CP010148_7 7.2|3204843|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT 3204843-3204874 32 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 213372-213403 11 0.656

1. spacer 1.1|194870|40|NZ_CP010148|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 4.1|1291442|42|NZ_CP010148|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 4.2|1291501|40|NZ_CP010148|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

catggcgtagaaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
****************************************

4. spacer 8.1|4342057|38|NZ_CP010148|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 3.1|1054103|48|NZ_CP010148|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938 

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

6. spacer 3.1|1054103|48|NZ_CP010148|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938 

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

7. spacer 3.1|1054103|48|NZ_CP010148|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938 

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

8. spacer 3.1|1054103|48|NZ_CP010148|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938 

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

9. spacer 6.8|3177360|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.844 

gcgatctcgcggaatacaccgacg-aggcgggc	CRISPR spacer
acgatctcgcggaatacgtcgacgtaggccgg-	Protospacer
.****************..***** **** **

10. spacer 7.11|3205392|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 6, identity: 0.812 

gaagatatttctggcgttggcctg-cgcgtgac	CRISPR spacer
gaagctgtttctggcgttggcctgacgcccgc-	Protospacer
**** *.***************** *** .*

11. spacer 6.6|3177238|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NC_024792 (Bacillus phage Bobb, complete genome) position: , mismatch: 7, identity: 0.781 

taaaaatcatcatggaaaatcaacccggcgac	CRISPR spacer
caaaaaccatcatggaaaatctacctatcgaa	Protospacer
.*****.************** ***.. ***

12. spacer 6.11|3177543|32|NZ_CP010148|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

13. spacer 6.1|3176933|32|NZ_CP010148|CRISPRCasFinder,CRT matches to MK416007 (Klebsiella phage ST405-OXA48phi1.2, complete genome) position: , mismatch: 8, identity: 0.75 

tttctatctcccagtgggagagagatgacagt	CRISPR spacer
tcacgatctcccagtgggaaagggatgaaacc	Protospacer
*. * **************.**.***** * .

14. spacer 6.4|3177116|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NC_014825 (Ruminococcus albus 7 = DSM 20455 plasmid pRUMAL02, complete sequence) position: , mismatch: 8, identity: 0.75 

-catgaatatggacgatgaaaaaataagagagg	CRISPR spacer
ctacgca-ggggacgttgaaaaactaagagagg	Protospacer
 .*.* * . ***** ******* *********

15. spacer 6.5|3177177|32|NZ_CP010148|CRISPRCasFinder,CRT matches to CP000876 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence) position: , mismatch: 8, identity: 0.75 

ttaaaacattttccgagctttgcgatttatat	CRISPR spacer
tgcaattcctttccaagcttttcgatttatat	Protospacer
*  ** . .*****.****** **********

16. spacer 6.6|3177238|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP016891 (Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

taaaaatcatcatggaaaatcaacccggcgac	CRISPR spacer
taagaattatcatggaaaatcaaactctttac	Protospacer
***.***.*************** *.  . **

17. spacer 6.8|3177360|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgatctcgcggaatacaccgacgaggcgggc	CRISPR spacer
gcctgctggcggaatacgccgacgaggcgacg	Protospacer
**   ** *********.***********.

18. spacer 6.11|3177543|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

19. spacer 7.2|3204843|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029363 (Streptomyces globisporus strain TFH56 plasmid pTFSG2, complete sequence) position: , mismatch: 8, identity: 0.75 

caacgg--aggcccagggcgtgccggtttcgaaa	CRISPR spacer
--gcggccaggcccaggacgtgacggtttcggtg	Protospacer
  .***  *********.**** ********. .

20. spacer 6.2|3176994|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP036355 (Bacillus sp. SYJ plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gttttggcgatatcacctgatgcctgcaatcc	CRISPR spacer
tttgtggcgatagcacctgatgcccataaaat	Protospacer
 ** ******** ***********...**  .

21. spacer 6.2|3176994|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

gttttggcgatatcacctgatgcctgcaatcc	CRISPR spacer
tttgtggcgatagcacctgatgcccataaaat	Protospacer
 ** ******** ***********...**  .

22. spacer 6.2|3176994|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP045534 (Bacillaceae bacterium C02 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gttttggcgatatcacctgatgcctgcaatcc	CRISPR spacer
tttgtggcgatagcacctgatgcccataaaat	Protospacer
 ** ******** ***********...**  .

23. spacer 6.3|3177055|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.719 

gggtatcgcactgcggcagatgttccggggcc---	CRISPR spacer
catgatcgccctgccgcagatgttcc---gcctgg	Protospacer
 .  ***** **** ***********   ***

24. spacer 6.4|3177116|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP005987 (Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence) position: , mismatch: 9, identity: 0.719 

catgaatatggacgatgaaaaaataagagagg	CRISPR spacer
ggtgaataaggacgatgagaaaataatcgcaa	Protospacer
 .****** *********.*******  * ..

25. spacer 6.4|3177116|32|NZ_CP010148|CRISPRCasFinder,CRT matches to MN163281 (Klebsiella phage KpCHEMY26, complete genome) position: , mismatch: 9, identity: 0.719 

catgaatatggacgatgaaaaaataagagagg-------	CRISPR spacer
catgaatctggacgatgataaa-------aggtttctcc	Protospacer
******* ********** ***       ***

26. spacer 6.8|3177360|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgatctcgcggaatacaccgacgaggcgggc	CRISPR spacer
cgcacgtcgcggattacatcgacgaggcggta	Protospacer
   *. ******* ****.***********

27. spacer 6.9|3177421|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

taaggccgtcgccggatcagcctggctatgcc	CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc	Protospacer
...******************* * **..  *

28. spacer 6.11|3177543|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*

29. spacer 7.5|3205026|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025505 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgcttccccgctggctgtgtctcgtctcgtt	CRISPR spacer
tcgcttcctcgctggctgtgtctccggctagt	Protospacer
.*******.***************   ... *

30. spacer 7.6|3205087|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaaatgctctttgaaaatgcaatgccccgcg	CRISPR spacer
aaaaatgctctttgaaaattaaataatacggt	Protospacer
.******************  ***. . **

31. spacer 7.6|3205087|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaaatgctctttgaaaatgcaatgccccgcg	CRISPR spacer
aaaaatgctctttgaaaattaaataatacggt	Protospacer
.******************  ***. . **

32. spacer 7.8|3205209|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to MN101222 (Klebsiella phage KOX9, complete genome) position: , mismatch: 9, identity: 0.719 

ccacctttaagcgccataccatttcacatatg-	CRISPR spacer
taacctttaagcgccttgccatttc-tgcttgc	Protospacer
. ************* *.******* ... **

33. spacer 7.11|3205392|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaagatatttctggcgttggcctgcgcgtgac	CRISPR spacer
ttcgattttgctggcgttggcctgcgcggcca	Protospacer
   *** ** ******************

34. spacer 6.11|3177543|32|NZ_CP010148|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

35. spacer 7.2|3204843|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688 

caacggaggcccagggcgtgccggtttcgaaa	CRISPR spacer
ttgcttcggcgctgggcgtgccggtttcgacc	Protospacer
. .*   *** * *****************

36. spacer 7.2|3204843|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 10, identity: 0.688 

caacggaggcccagggcgtgccggtttcgaaa	CRISPR spacer
ggacggaggcccagggtgtgcgggtcggggcg	Protospacer
 .**************.**** ***.  *. .

37. spacer 7.6|3205087|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to AP014295 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S26-C8, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688 

gaaaatgctctttgaaaatgcaatgccccgcg	CRISPR spacer
agaaatgctctatgaaagtgcaatgaaaccta	Protospacer
..********* *****.*******   * ..

38. spacer 7.2|3204843|32|NZ_CP010148|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656 

caacggaggcccagggcgtgccggtttcgaaa	CRISPR spacer
gcgtcatggccttgggcgtgccggtttcgatc	Protospacer
  .. . ****. *****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 693171 : 749034 64 Enterobacteria_phage(44.44%) integrase,tRNA,head,terminase,lysis,protease,tail,portal,capsid attL 692702:692748|attR 739315:739361
DBSCAN-SWA_2 1054232 : 1101890 44 Clostridioides_phage(16.67%) plate,transposase NA
DBSCAN-SWA_3 1703641 : 1767359 63 Burkholderia_phage(24.0%) plate,tail,integrase,tRNA attL 1693689:1693703|attR 1708695:1708709
DBSCAN-SWA_4 3213182 : 3226365 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_5 3837569 : 3847010 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_6 3863283 : 3927390 71 Escherichia_phage(40.91%) integrase,tRNA,plate,head,tail,holin,terminase,lysis,capsid,portal attL 3890532:3890559|attR 3923065:3923092
DBSCAN-SWA_7 4415607 : 4479132 70 Enterobacteria_phage(40.0%) integrase,holin,terminase,lysis,protease,tail,portal attL 4427788:4427803|attR 4465364:4465379
DBSCAN-SWA_8 4700559 : 4709032 7 Enterobacteria_phage(50.0%) tail NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage