1. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtaaca Protospacer
****** ****************. *
2. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgca Protospacer
****** *************** * *
3. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtaaca Protospacer
****** ****************. *
4. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgca Protospacer
****** *************** * *
5. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtaaca Protospacer
****** ****************. *
6. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgca Protospacer
****** *************** * *
7. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtaaca Protospacer
****** ****************. *
8. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtaaca Protospacer
****** ****************. *
9. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtaaca Protospacer
****** ****************. *
10. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgca Protospacer
****** *************** * *
11. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtaaca Protospacer
****** ****************. *
12. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 4, identity: 0.852
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgca Protospacer
****** *************** * *
13. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.821
acacgtggagagacaagaacaccggcga CRISPR spacer
caagatggagagacaagaacaccggcaa Protospacer
* .*********************.*
14. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009963 (Collimonas arenae strain Cal35 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
acacgtggagagacaagaacaccggcga CRISPR spacer
aaagctggaaagacaagaacagcggcga Protospacer
* * ****.*********** ******
15. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to MK095605 (Pantoea phage vB_PagS_MED16, complete genome) position: , mismatch: 5, identity: 0.821
acacgtggagagacaagaacaccggcga CRISPR spacer
agagctggcgtgacaagaacaccggcga Protospacer
* * *** * *****************
16. spacer 2.5|1726179|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049247 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tatcaaaaagcttcaccttctcggtgag CRISPR spacer
tcaccgaaagcttcaccttctcggtgaa Protospacer
* * .*********************.
17. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc Protospacer
****** *************** *
18. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc Protospacer
****** *************** *
19. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcaccagcggggatgctccgtacct Protospacer
***************** *****
20. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc Protospacer
****** *************** *
21. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtatcc Protospacer
****** ****************
22. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcgccagcggggataaaccgttgtc Protospacer
****.***********.****** *
23. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgttaaa Protospacer
****** *************** ..*
24. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc Protospacer
****** *************** *
25. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc Protospacer
****** *************** *
26. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcgccagcggggatgagccgtttgc Protospacer
****.*************.**** *
27. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_048780 (Corynebacterium phage StAB, complete genome) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcgccagcggggatgagccgtttgc Protospacer
****.*************.**** *
28. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcgccagcggggatgagccgtttgc Protospacer
****.*************.**** *
29. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcgccagcggggatgagccgtttgc Protospacer
****.*************.**** *
30. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_048789 (Corynebacterium phage Stiles, complete genome) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcgccagcggggatgagccgtttgt Protospacer
****.*************.**** *
31. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcgccagcggggatgagccgtttgc Protospacer
****.*************.**** *
32. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_048790 (Corynebacterium phage Lederberg, complete genome) position: , mismatch: 5, identity: 0.815
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcgccagcggggatgagccgtttgc Protospacer
****.*************.**** *
33. spacer 2.2|1725987|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020084 (Blastomonas fulva strain T2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
cgattgcctcgcgtccgcactgttcgaa CRISPR spacer
gctttgccacgcgtccgcgctgttcgat Protospacer
***** *********.********
34. spacer 2.2|1725987|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010647 (Phaeobacter piscinae strain P36 plasmid pP36_d, complete sequence) position: , mismatch: 6, identity: 0.786
cgattgcctcgcgtccgcactgttcgaa CRISPR spacer
tcattgccgcgcgtccgcactgtccgct Protospacer
. ****** **************.**
35. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.786
acacgtggagagacaagaacaccggcga CRISPR spacer
gtcggtggcgagacaagaacaccggcaa Protospacer
.. **** *****************.*
36. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.786
acacgtggagagacaagaacaccggcga CRISPR spacer
gtcggtggcgagacaagaacaccggcaa Protospacer
.. **** *****************.*
37. spacer 2.5|1726179|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to MK448408 (Streptococcus satellite phage Javan296, complete genome) position: , mismatch: 6, identity: 0.786
tatcaaaaagcttcaccttctcggtgag CRISPR spacer
actcaaaaagctccacgttctcggtcgg Protospacer
**********.*** ******** .*
38. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 6, identity: 0.778
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgttcag Protospacer
****** *************** ..
39. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 6, identity: 0.778
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgttcag Protospacer
****** *************** ..
40. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 6, identity: 0.778
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgttcag Protospacer
****** *************** ..
41. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 6, identity: 0.778
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcgccagcggggataaaccgtgttg Protospacer
****.***********.******. .
42. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 6, identity: 0.778
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgttcag Protospacer
****** *************** ..
43. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 6, identity: 0.778
ccgcaccagcggggatgaaccgtagga CRISPR spacer
ccgcacacgcggggatgaaccgttcag Protospacer
****** *************** ..