Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018331 Corynebacterium diphtheriae strain B-D-16-78 chromosome, complete genome 2 crisprs DEDDh,cas3,WYL,cas4,csa3,DinG,cas9,cas1,cas2 0 4 1 0

Results visualization

1. NZ_CP018331
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018331_1 698018-698130 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018331_2 1725887-1726369 TypeII NA
7 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017130 Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence 124188-124214 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017130 Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence 124066-124092 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017134 Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence 124212-124238 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017134 Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence 124090-124116 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017101 Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence 124196-124222 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017101 Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence 124074-124100 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NZ_CP021924 Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2 170385-170411 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NZ_CP021924 Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2 171117-171143 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_013210 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence 124568-124594 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_013210 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence 124446-124472 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017136 Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence 124180-124206 4 0.852
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017136 Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence 124058-124084 4 0.852
NZ_CP018331_2 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT 1726115-1726142 28 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 256060-256087 5 0.821
NZ_CP018331_2 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT 1726115-1726142 28 NZ_CP009963 Collimonas arenae strain Cal35 plasmid unnamed, complete sequence 2770-2797 5 0.821
NZ_CP018331_2 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT 1726115-1726142 28 MK095605 Pantoea phage vB_PagS_MED16, complete genome 24076-24103 5 0.821
NZ_CP018331_2 2.5|1726179|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT 1726179-1726206 28 NZ_CP049247 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed1, complete sequence 22887-22914 5 0.821
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017130 Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence 123517-123543 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017134 Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence 123541-123567 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 80081-80107 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017101 Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence 123525-123551 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 88022-88048 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246793-246819 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NZ_CP021924 Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2 170263-170289 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_013210 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence 123897-123923 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017136 Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence 123509-123535 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 MK977714 Corynebacterium phage Bran, complete genome 22540-22566 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_048780 Corynebacterium phage StAB, complete genome 22546-22572 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 MK977706 Corynebacterium phage Dina, complete genome 22371-22397 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 MH926061 Corynebacterium phage Troy, complete genome 22111-22137 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_048789 Corynebacterium phage Stiles, complete genome 22038-22064 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_048069 Corynebacterium phage SamW, complete genome 22111-22137 5 0.815
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_048790 Corynebacterium phage Lederberg, complete genome 22496-22522 5 0.815
NZ_CP018331_2 2.2|1725987|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT 1725987-1726014 28 NZ_CP020084 Blastomonas fulva strain T2 plasmid unnamed, complete sequence 54083-54110 6 0.786
NZ_CP018331_2 2.2|1725987|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT 1725987-1726014 28 NZ_CP010647 Phaeobacter piscinae strain P36 plasmid pP36_d, complete sequence 4651-4678 6 0.786
NZ_CP018331_2 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT 1726115-1726142 28 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 30327-30354 6 0.786
NZ_CP018331_2 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT 1726115-1726142 28 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 30332-30359 6 0.786
NZ_CP018331_2 2.5|1726179|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT 1726179-1726206 28 MK448408 Streptococcus satellite phage Javan296, complete genome 4452-4479 6 0.786
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017130 Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence 123395-123421 6 0.778
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017134 Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence 123419-123445 6 0.778
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017101 Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence 123403-123429 6 0.778
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246732-246758 6 0.778
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_013210 Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence 123775-123801 6 0.778
NZ_CP018331_2 2.7|1726307|27|NZ_CP018331|CRT 1726307-1726333 27 NC_017136 Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence 123387-123413 6 0.778

1. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

2. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

3. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

4. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

5. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

6. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

7. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

8. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

9. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

10. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

11. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtaaca	Protospacer
******  ****************. *

12. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 4, identity: 0.852

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgca	Protospacer
******  *************** * *

13. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.821

acacgtggagagacaagaacaccggcga	CRISPR spacer
caagatggagagacaagaacaccggcaa	Protospacer
  * .*********************.*

14. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009963 (Collimonas arenae strain Cal35 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

acacgtggagagacaagaacaccggcga	CRISPR spacer
aaagctggaaagacaagaacagcggcga	Protospacer
* *  ****.*********** ******

15. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to MK095605 (Pantoea phage vB_PagS_MED16, complete genome) position: , mismatch: 5, identity: 0.821

acacgtggagagacaagaacaccggcga	CRISPR spacer
agagctggcgtgacaagaacaccggcga	Protospacer
* *  *** * *****************

16. spacer 2.5|1726179|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049247 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tatcaaaaagcttcaccttctcggtgag	CRISPR spacer
tcaccgaaagcttcaccttctcggtgaa	Protospacer
*  * .*********************.

17. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

18. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

19. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcaccagcggggatgctccgtacct	Protospacer
*****************  *****   

20. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

21. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtatcc	Protospacer
******  ****************   

22. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggataaaccgttgtc	Protospacer
****.***********.****** *  

23. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NZ_CP021924 (Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttaaa	Protospacer
******  *************** ..*

24. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

25. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgtcgcc	Protospacer
******  *************** *  

26. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

27. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_048780 (Corynebacterium phage StAB, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

28. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

29. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

30. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_048789 (Corynebacterium phage Stiles, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgt	Protospacer
****.*************.****  * 

31. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

32. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_048790 (Corynebacterium phage Lederberg, complete genome) position: , mismatch: 5, identity: 0.815

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggatgagccgtttgc	Protospacer
****.*************.****  * 

33. spacer 2.2|1725987|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020084 (Blastomonas fulva strain T2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

cgattgcctcgcgtccgcactgttcgaa	CRISPR spacer
gctttgccacgcgtccgcgctgttcgat	Protospacer
   ***** *********.******** 

34. spacer 2.2|1725987|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010647 (Phaeobacter piscinae strain P36 plasmid pP36_d, complete sequence) position: , mismatch: 6, identity: 0.786

cgattgcctcgcgtccgcactgttcgaa	CRISPR spacer
tcattgccgcgcgtccgcactgtccgct	Protospacer
. ****** **************.**  

35. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.786

acacgtggagagacaagaacaccggcga	CRISPR spacer
gtcggtggcgagacaagaacaccggcaa	Protospacer
..  **** *****************.*

36. spacer 2.4|1726115|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.786

acacgtggagagacaagaacaccggcga	CRISPR spacer
gtcggtggcgagacaagaacaccggcaa	Protospacer
..  **** *****************.*

37. spacer 2.5|1726179|28|NZ_CP018331|PILER-CR,CRISPRCasFinder,CRT matches to MK448408 (Streptococcus satellite phage Javan296, complete genome) position: , mismatch: 6, identity: 0.786

tatcaaaaagcttcaccttctcggtgag	CRISPR spacer
actcaaaaagctccacgttctcggtcgg	Protospacer
  **********.*** ******** .*

38. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017130 (Acetobacter pasteurianus IFO 3283-26 plasmid pAPA26-013, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

39. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017134 (Acetobacter pasteurianus IFO 3283-32 plasmid pAPA32-012, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

40. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017101 (Acetobacter pasteurianus IFO 3283-03 plasmid pAPA03-010, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

41. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcgccagcggggataaaccgtgttg	Protospacer
****.***********.******.  .

42. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_013210 (Acetobacter pasteurianus IFO 3283-01 plasmid pAPA01-011, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

43. spacer 2.7|1726307|27|NZ_CP018331|CRT matches to NC_017136 (Acetobacter pasteurianus IFO 3283-12 plasmid pAPA12-014, complete sequence) position: , mismatch: 6, identity: 0.778

ccgcaccagcggggatgaaccgtagga	CRISPR spacer
ccgcacacgcggggatgaaccgttcag	Protospacer
******  ***************  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1837718 : 1874398 40 Corynebacterium_phage(50.0%) integrase,tail,portal attL 1829492:1829508|attR 1880401:1880417
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage