Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018347 Streptococcus pneumoniae strain SWU02 chromosome, complete genome 3 crisprs DEDDh,cas3,DinG 0 1 9 0

Results visualization

1. NZ_CP018347
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018347_1 1447454-1447557 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018347_2 1799977-1800109 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018347_3 2026197-2026281 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018347_1 1.1|1447487|38|NZ_CP018347|CRISPRCasFinder 1447487-1447524 38 KY065475 Streptococcus phage IPP35, complete genome 23044-23081 4 0.895
NZ_CP018347_1 1.1|1447487|38|NZ_CP018347|CRISPRCasFinder 1447487-1447524 38 MK448453 Streptococcus satellite phage Javan360, complete genome 13985-14022 5 0.868

1. spacer 1.1|1447487|38|NZ_CP018347|CRISPRCasFinder matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 4, identity: 0.895

agatattatggagcctattttattgtagaaaaaaaggg	CRISPR spacer
agatattatggagcctatttttgtgtagaaaaaaagtc	Protospacer
*********************  *************  

2. spacer 1.1|1447487|38|NZ_CP018347|CRISPRCasFinder matches to MK448453 (Streptococcus satellite phage Javan360, complete genome) position: , mismatch: 5, identity: 0.868

agatattatggagcctattttattgtagaaaaaaaggg	CRISPR spacer
gaatattatggagcctattttgttgtagaaaaaaagtc	Protospacer
..*******************.**************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 84147 : 113568 36 Streptococcus_phage(89.66%) transposase,bacteriocin NA
DBSCAN-SWA_2 505964 : 547241 45 Streptococcus_phage(50.0%) transposase,tRNA,bacteriocin NA
DBSCAN-SWA_3 592236 : 600062 12 Streptococcus_phage(75.0%) NA NA
DBSCAN-SWA_4 730616 : 787546 46 Streptococcus_phage(28.57%) protease,transposase,holin NA
DBSCAN-SWA_5 867935 : 930822 56 Planktothrix_phage(10.0%) protease,transposase,tRNA,bacteriocin NA
DBSCAN-SWA_6 1161075 : 1168081 10 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_7 1591008 : 1601404 11 Streptococcus_phage(70.0%) NA NA
DBSCAN-SWA_8 1824003 : 1830762 9 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_9 2084072 : 2091445 10 uncultured_Mediterranean_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage