Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017292 Corynebacterium pseudotuberculosis strain MEX31, complete genome 4 crisprs cas1,cas3,cas6e,cas8e,cse2gr11,cas7,cas5,DEDDh,WYL,cas4,csa3,DinG 1 8 2 0

Results visualization

1. NZ_CP017292
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017292_1 22351-22564 TypeI-E I-C,I-E,II-B
3 spacers
cas2,cas1,cas3,cas6e,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017292_2 27379-27450 TypeI-E NA
1 spacers
cas6e,cas3,cas1,cas2,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017292_3 642487-642580 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017292_4 1842798-1842887 Orphan I-C,I-E,II-B
1 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP017292_3 3.1|642518|32|NZ_CP017292|CRISPRCasFinder 642518-642549 32 NZ_CP017292.1 1060052-1060083 0 1.0

1. spacer 3.1|642518|32|NZ_CP017292|CRISPRCasFinder matches to position: 1060052-1060083, mismatch: 0, identity: 1.0

tgctggatttgtggttggtgtgtggggtgtgt	CRISPR spacer
tgctggatttgtggttggtgtgtggggtgtgt	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017292_1 1.2|22445|28|NZ_CP017292|PILER-CR 22445-22472 28 NZ_CP019064 Rahnella sp. ERMR1:05 plasmid unnamed2, complete sequence 112232-112259 6 0.786
NZ_CP017292_1 1.8|22504|31|NZ_CP017292|CRT 22504-22534 31 NZ_CP027853 Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence 223320-223350 6 0.806
NZ_CP017292_1 1.1|22384|28|NZ_CP017292|PILER-CR 22384-22411 28 KU160495 Exiguobacterium phage vB_EauS-123, complete genome 10947-10974 7 0.75
NZ_CP017292_1 1.2|22445|28|NZ_CP017292|PILER-CR 22445-22472 28 NZ_AP019800 Vibrio rotiferianus strain AM7 plasmid pAM7, complete sequence 14661-14688 7 0.75
NZ_CP017292_1 1.2|22445|28|NZ_CP017292|PILER-CR 22445-22472 28 GQ866233 Aggregatibacter phage S1249, complete sequence 27861-27888 7 0.75
NZ_CP017292_1 1.5|22503|32|NZ_CP017292|CRISPRCasFinder 22503-22534 32 NZ_CP027853 Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence 223319-223350 7 0.781
NZ_CP017292_1 1.7|22443|31|NZ_CP017292|CRT 22443-22473 31 NZ_CP019064 Rahnella sp. ERMR1:05 plasmid unnamed2, complete sequence 112232-112262 7 0.774
NZ_CP017292_1 1.7|22443|31|NZ_CP017292|CRT 22443-22473 31 NC_048639 Pseudomonas phage ZC08, complete genome 14894-14924 8 0.742
NZ_CP017292_1 1.7|22443|31|NZ_CP017292|CRT 22443-22473 31 NC_048638 Pseudomonas phage ZC03, complete genome 14836-14866 8 0.742
NZ_CP017292_1 1.4|22442|32|NZ_CP017292|CRISPRCasFinder 22442-22473 32 NC_048639 Pseudomonas phage ZC08, complete genome 14894-14925 9 0.719
NZ_CP017292_1 1.4|22442|32|NZ_CP017292|CRISPRCasFinder 22442-22473 32 NC_048638 Pseudomonas phage ZC03, complete genome 14836-14867 9 0.719
NZ_CP017292_1 1.6|22382|31|NZ_CP017292|CRT 22382-22412 31 KU160495 Exiguobacterium phage vB_EauS-123, complete genome 10947-10977 9 0.71
NZ_CP017292_1 1.7|22443|31|NZ_CP017292|CRT 22443-22473 31 GQ866233 Aggregatibacter phage S1249, complete sequence 27861-27891 9 0.71
NZ_CP017292_1 1.3|22381|32|NZ_CP017292|CRISPRCasFinder 22381-22412 32 KU160495 Exiguobacterium phage vB_EauS-123, complete genome 10946-10977 10 0.688
NZ_CP017292_1 1.4|22442|32|NZ_CP017292|CRISPRCasFinder 22442-22473 32 GQ866233 Aggregatibacter phage S1249, complete sequence 27860-27891 10 0.688

1. spacer 1.2|22445|28|NZ_CP017292|PILER-CR matches to NZ_CP019064 (Rahnella sp. ERMR1:05 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

tggtgttccaataatgcttttgctgcca	CRISPR spacer
ttatgttccaataatgcctttgctgaag	Protospacer
* .**************.*******  .

2. spacer 1.8|22504|31|NZ_CP017292|CRT matches to NZ_CP027853 (Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence) position: , mismatch: 6, identity: 0.806

gcctgattcactgtcagcccgtaaagctcac	CRISPR spacer
ggctgatttactggcagcccgtaaagcactg	Protospacer
* ******.**** ************* *  

3. spacer 1.1|22384|28|NZ_CP017292|PILER-CR matches to KU160495 (Exiguobacterium phage vB_EauS-123, complete genome) position: , mismatch: 7, identity: 0.75

cagcaacggtgagaatctttttttcgcg	CRISPR spacer
aagcaaccgtgagaatatttttttgaaa	Protospacer
 ****** ******** ******* . .

4. spacer 1.2|22445|28|NZ_CP017292|PILER-CR matches to NZ_AP019800 (Vibrio rotiferianus strain AM7 plasmid pAM7, complete sequence) position: , mismatch: 7, identity: 0.75

tggtgttccaataatgcttttgctgcca	CRISPR spacer
tctgattccaataatgctttttctgcat	Protospacer
*   .**************** ****  

5. spacer 1.2|22445|28|NZ_CP017292|PILER-CR matches to GQ866233 (Aggregatibacter phage S1249, complete sequence) position: , mismatch: 7, identity: 0.75

tggtgttccaataatgcttttgctgcca	CRISPR spacer
cggtgtctcaataatgcttttgctaatt	Protospacer
.*****..****************. . 

6. spacer 1.5|22503|32|NZ_CP017292|CRISPRCasFinder matches to NZ_CP027853 (Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence) position: , mismatch: 7, identity: 0.781

tgcctgattcactgtcagcccgtaaagctcac	CRISPR spacer
aggctgatttactggcagcccgtaaagcactg	Protospacer
 * ******.**** ************* *  

7. spacer 1.7|22443|31|NZ_CP017292|CRT matches to NZ_CP019064 (Rahnella sp. ERMR1:05 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

tggtgttccaataatgcttttgctgccaact	CRISPR spacer
ttatgttccaataatgcctttgctgaagatt	Protospacer
* .**************.*******  .*.*

8. spacer 1.7|22443|31|NZ_CP017292|CRT matches to NC_048639 (Pseudomonas phage ZC08, complete genome) position: , mismatch: 8, identity: 0.742

tggtgttccaataatgcttttgctgccaact	CRISPR spacer
aagaactccaataatgactttgctgccaacc	Protospacer
 .* ..********** .************.

9. spacer 1.7|22443|31|NZ_CP017292|CRT matches to NC_048638 (Pseudomonas phage ZC03, complete genome) position: , mismatch: 8, identity: 0.742

tggtgttccaataatgcttttgctgccaact	CRISPR spacer
aagaactccaataatgactttgctgccaacc	Protospacer
 .* ..********** .************.

10. spacer 1.4|22442|32|NZ_CP017292|CRISPRCasFinder matches to NC_048639 (Pseudomonas phage ZC08, complete genome) position: , mismatch: 9, identity: 0.719

ttggtgttccaataatgcttttgctgccaact	CRISPR spacer
gaagaactccaataatgactttgctgccaacc	Protospacer
  .* ..********** .************.

11. spacer 1.4|22442|32|NZ_CP017292|CRISPRCasFinder matches to NC_048638 (Pseudomonas phage ZC03, complete genome) position: , mismatch: 9, identity: 0.719

ttggtgttccaataatgcttttgctgccaact	CRISPR spacer
gaagaactccaataatgactttgctgccaacc	Protospacer
  .* ..********** .************.

12. spacer 1.6|22382|31|NZ_CP017292|CRT matches to KU160495 (Exiguobacterium phage vB_EauS-123, complete genome) position: , mismatch: 9, identity: 0.71

cagcaacggtgagaatctttttttcgcgacg	CRISPR spacer
aagcaaccgtgagaatatttttttgaaaatc	Protospacer
 ****** ******** ******* . .*. 

13. spacer 1.7|22443|31|NZ_CP017292|CRT matches to GQ866233 (Aggregatibacter phage S1249, complete sequence) position: , mismatch: 9, identity: 0.71

tggtgttccaataatgcttttgctgccaact	CRISPR spacer
cggtgtctcaataatgcttttgctaattccg	Protospacer
.*****..****************. .  * 

14. spacer 1.3|22381|32|NZ_CP017292|CRISPRCasFinder matches to KU160495 (Exiguobacterium phage vB_EauS-123, complete genome) position: , mismatch: 10, identity: 0.688

tcagcaacggtgagaatctttttttcgcgacg	CRISPR spacer
aaagcaaccgtgagaatatttttttgaaaatc	Protospacer
  ****** ******** ******* . .*. 

15. spacer 1.4|22442|32|NZ_CP017292|CRISPRCasFinder matches to GQ866233 (Aggregatibacter phage S1249, complete sequence) position: , mismatch: 10, identity: 0.688

ttggtgttccaataatgcttttgctgccaact	CRISPR spacer
acggtgtctcaataatgcttttgctaattccg	Protospacer
 .*****..****************. .  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1753087 : 1830501 58 Agrobacterium_phage(14.29%) tRNA,integrase,bacteriocin,protease attL 1805253:1805280|attR 1811164:1811191
DBSCAN-SWA_2 1985013 : 1993474 11 Pandoravirus(33.33%) holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage