Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019036 Massilia putida strain 6NM-7 plasmid unnamed1, complete sequence 1 crisprs csa3 0 1 1 0
NZ_CP019038 Massilia putida strain 6NM-7 chromosome, complete genome 2 crisprs csa3,DEDDh,DinG,cas3,RT,WYL,Cas9_archaeal 0 0 8 0
NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP019036
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019036_1 216-331 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019036_1 1.1|247|54|NZ_CP019036|CRISPRCasFinder 247-300 54 NZ_CP019036 Massilia putida strain 6NM-7 plasmid unnamed1, complete sequence 247-300 0 1.0

1. spacer 1.1|247|54|NZ_CP019036|CRISPRCasFinder matches to NZ_CP019036 (Massilia putida strain 6NM-7 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tatctgcaaccatcataggccggttttcggctgcccgcaacttcgttcgcatgg	CRISPR spacer
tatctgcaaccatcataggccggttttcggctgcccgcaacttcgttcgcatgg	Protospacer
******************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12484 : 70910 58 Shigella_phage(25.0%) tRNA,transposase,integrase attL 18425:18446|attR 72734:72755
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP019038
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019038_1 2148349-2148458 Orphan NA
1 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019038_2 5952176-5952254 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 21554 : 33292 17 uncultured_Caudovirales_phage(55.56%) NA NA
DBSCAN-SWA_2 57231 : 127443 60 uncultured_Caudovirales_phage(30.0%) transposase,integrase attL 83555:83572|attR 133628:133645
DBSCAN-SWA_3 1159591 : 1191349 25 Acidithiobacillus_phage(33.33%) transposase NA
DBSCAN-SWA_4 1282695 : 1287022 7 uncultured_Caudovirales_phage(83.33%) NA NA
DBSCAN-SWA_5 3038920 : 3047235 8 Bacillus_virus(33.33%) tRNA NA
DBSCAN-SWA_6 4234772 : 4286269 53 Burkholderia_virus(10.0%) holin,transposase,protease,integrase attL 4226711:4226726|attR 4260016:4260031
DBSCAN-SWA_7 4884227 : 4896360 8 Dickeya_phage(16.67%) tRNA NA
DBSCAN-SWA_8 5707568 : 5738142 37 Acidithiobacillus_phage(30.77%) plate,capsid,terminase,head,tail,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP019037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 313053 : 353526 33 Burkholderia_virus(37.5%) integrase,transposase attL 314539:314598|attR 327348:328668
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage