Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018362 Klebsiella oxytoca strain CAV1752 chromosome, complete genome 6 crisprs DEDDh,DinG,csa3,cas3,cas14j,WYL 8 15 12 2
NZ_CP018359 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-5521, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP018358 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-4374, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP018360 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-111, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP018357 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-3851, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 0 crisprs cas3,csa3,RT 0 0 9 0

Results visualization

1. NZ_CP018362
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018362_1 2423232-2423318 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018362_2 3083408-3083498 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018362_3 3733606-3733715 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018362_4 4786973-4787082 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018362_5 5140765-5140972 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018362_6 5246397-5247445 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP018362.1 5248319-5248343 0 1.0
NZ_CP018362_5 5.1|5140793|32|NZ_CP018362|PILER-CR,CRISPRCasFinder,CRT 5140793-5140824 32 NZ_CP018362.1 1054004-1054035 1 0.969
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP018362.1 5248541-5248565 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP018362.1 5248523-5248547 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP018362.1 5248781-5248805 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP018362.1 5248925-5248949 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP018362.1 5249015-5249039 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP018362.1 5248673-5248697 1 0.96
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP018362.1 5248391-5248415 1 0.96
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP018362.1 5248409-5248433 1 0.96
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP018362.1 5248559-5248595 2 0.946
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP018362.1 5248853-5248877 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP018362.1 5249051-5249075 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP018362.1 5248337-5248361 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP018362.1 5248871-5248895 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP018362.1 5248961-5248985 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP018362.1 5248997-5249021 2 0.92
NZ_CP018362_6 6.10|5247002|19|NZ_CP018362|CRT 5247002-5247020 19 NZ_CP018362.1 5248679-5248697 2 0.895
NZ_CP018362_6 6.12|5247122|43|NZ_CP018362|CRT 5247122-5247164 43 NZ_CP018362.1 5248469-5248511 2 0.953
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP018362.1 5248505-5248529 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP018362.1 5248763-5248787 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP018362.1 5248907-5248931 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP018362.1 5249069-5249093 2 0.92

1. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to position: 5248319-5248343, mismatch: 0, identity: 1.0

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgactctgacagc	Protospacer
*************************

2. spacer 5.1|5140793|32|NZ_CP018362|PILER-CR,CRISPRCasFinder,CRT matches to position: 1054004-1054035, mismatch: 1, identity: 0.969

gtaaaaaactccctactgtgctttaccggcag	CRISPR spacer
gtaaaaaactccctactgtgctttaccgccag	Protospacer
**************************** ***

3. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to position: 5248541-5248565, mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactccgactgt	Protospacer
********************** **

4. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to position: 5248523-5248547, mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactctgacagc	Protospacer
******************.******

5. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to position: 5248781-5248805, mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ************

6. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to position: 5248925-5248949, mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ************

7. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to position: 5249015-5249039, mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ************

8. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to position: 5248673-5248697, mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgactccgactctgacagc	Protospacer
*********.***************

9. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to position: 5248391-5248415, mismatch: 1, identity: 0.96

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattcggattctgacagc	Protospacer
****************** ******

10. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to position: 5248409-5248433, mismatch: 1, identity: 0.96

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattcagacagc	Protospacer
******.******************

11. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to position: 5248559-5248595, mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgactgtgactcggattcagacagcgattcggactct	Protospacer
**** *.******************************

12. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to position: 5248853-5248877, mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.******

13. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to position: 5249051-5249075, mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.******

14. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to position: 5248337-5248361, mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ************

15. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to position: 5248871-5248895, mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagtgactcagactccgacagc	Protospacer
******.***** ************

16. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to position: 5248961-5248985, mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.******

17. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to position: 5248997-5249021, mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.******

18. spacer 6.10|5247002|19|NZ_CP018362|CRT matches to position: 5248679-5248697, mismatch: 2, identity: 0.895

tgacagcgactctgacagc	CRISPR spacer
tgactccgactctgacagc	Protospacer
****  *************

19. spacer 6.12|5247122|43|NZ_CP018362|CRT matches to position: 5248469-5248511, mismatch: 2, identity: 0.953

tgacagtgactcggattctgatagtgattccgactctgacagc	CRISPR spacer
tgacagtgactcggattctgatagtgattccgattccgacagc	Protospacer
*********************************.**.******

20. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to position: 5248505-5248529, mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattcggactctgacagc	Protospacer
******.***** ************

21. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to position: 5248763-5248787, mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattctgacagc	Protospacer
*********.******** ******

22. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to position: 5248907-5248931, mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattctgacagc	Protospacer
*********.******** ******

23. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to position: 5249069-5249093, mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattcggacagc	Protospacer
*********.********.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 7-31 0 1.0
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 43-67 0 1.0
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1792-1816 0 1.0
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2440-2464 0 1.0
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2704-2728 0 1.0
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3130-3154 0 1.0
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156331-156361 1 0.968
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153877-153913 1 0.973
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155029-155065 1 0.973
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155263-155299 1 0.973
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 7-31 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 43-67 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1792-1816 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2440-2464 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2704-2728 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1270-1294 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1576-1600 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3112-3136 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3256-3280 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3412-3436 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156619-156643 1 0.96
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157441-157465 1 0.96
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151384-151408 1 0.96
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151420-151444 1 0.96
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155059-155083 1 0.96
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155293-155317 1 0.96
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1072-1096 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 964-988 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1036-1060 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1090-1114 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2908-2932 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1432-1456 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1672-1696 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2482-2506 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2590-2614 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151251-151275 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153541-153565 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156217-156241 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156769-156793 1 0.96
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156919-156943 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3394-3418 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3706-3730 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1768-1792 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1954-1978 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3166-3190 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153253-153277 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153733-153757 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154357-154381 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154519-154543 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154789-154813 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155005-155029 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155185-155209 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155239-155263 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155419-155443 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155455-155479 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156235-156259 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154273-154297 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155485-155509 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155845-155869 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156265-156289 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156637-156661 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156787-156811 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157585-157609 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1126-1150 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 982-1006 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16748-16772 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17744-17768 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18506-18530 1 0.96
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19226-19250 1 0.96
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153853-153877 1 0.96
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156127-156151 1 0.96
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP022118 Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence 380154-380185 2 0.938
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP030176 Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.1, complete sequence 104205-104236 2 0.938
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153055-153085 2 0.935
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154639-154669 2 0.935
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156349-156379 2 0.935
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1552-1582 2 0.935
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3052-3082 2 0.935
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1624-1654 2 0.935
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3034-3064 2 0.935
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3556-3586 2 0.935
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157063-157105 2 0.953
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151390-151426 2 0.946
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151498-151534 2 0.946
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153457-153493 2 0.946
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154597-154633 2 0.946
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155617-155653 2 0.946
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155653-155689 2 0.946
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153139-153175 2 0.946
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154867-154903 2 0.946
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156793-156829 2 0.946
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2374-2410 2 0.946
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 964-988 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1036-1060 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1090-1114 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2908-2932 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1432-1456 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1672-1696 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2482-2506 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2590-2614 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1342-1366 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2080-2104 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3376-3400 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3688-3712 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151251-151275 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153541-153565 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154753-154777 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154951-154975 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155149-155173 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155383-155407 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156043-156067 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156217-156241 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156391-156415 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156769-156793 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156919-156943 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151654-151678 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151708-151732 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151912-151936 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153097-153121 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153805-153829 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153949-153973 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154219-154243 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154339-154363 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154483-154507 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155437-155461 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155743-155767 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156079-156103 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156733-156757 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156883-156907 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157063-157087 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157117-157141 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157315-157339 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157531-157555 2 0.92
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157603-157627 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153649-153673 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153667-153691 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153685-153709 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156823-156847 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156841-156865 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156991-157015 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157009-157033 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151293-151317 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151492-151516 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151600-151624 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153007-153031 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153451-153475 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154147-154171 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154627-154651 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154861-154885 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157477-157501 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1126-1150 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1504-1528 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1750-1774 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2404-2428 2 0.92
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3004-3028 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1234-1258 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1270-1294 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1306-1330 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1360-1384 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1414-1438 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1468-1492 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1522-1546 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1576-1600 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1990-2014 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2218-2242 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2572-2596 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2818-2842 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2986-3010 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3112-3136 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3256-3280 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3412-3436 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3778-3802 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1000-1024 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1090-1114 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1126-1150 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1750-1774 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1828-1852 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1864-1888 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1936-1960 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2236-2260 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2404-2428 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2782-2806 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2836-2860 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2872-2896 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3004-3028 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3604-3628 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153289-153313 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153307-153331 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153769-153793 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156619-156643 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157441-157465 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151726-151750 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152989-153013 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153415-153439 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154075-154099 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154111-154135 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154447-154471 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154771-154795 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155167-155191 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155221-155245 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155401-155425 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155953-155977 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156841-156865 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157009-157033 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157045-157069 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157225-157249 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157243-157267 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157459-157483 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16676-16700 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17018-17042 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17534-17558 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16766-16790 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16808-16832 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17642-17666 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17762-17786 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17804-17828 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18890-18914 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19244-19268 2 0.92
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19286-19310 2 0.92
NZ_CP018362_6 6.13|5247194|43|NZ_CP018362|CRT 5247194-5247236 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3526-3568 2 0.953
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1018-1042 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1054-1078 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2800-2824 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3292-3316 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1144-1168 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1540-1564 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1612-1636 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1810-1834 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2608-2632 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2632-2656 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3448-3472 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3544-3568 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154393-154417 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154465-154489 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156181-156205 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156427-156451 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157153-157177 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157621-157645 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151528-151552 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151564-151588 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151798-151822 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151876-151900 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153985-154009 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154735-154759 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154933-154957 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155131-155155 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155365-155389 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155725-155749 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156409-156433 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156517-156541 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156601-156625 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156955-156979 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157099-157123 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157261-157285 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157297-157321 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157423-157447 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157639-157663 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16076-16100 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16208-16232 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16340-16364 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17366-17390 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17516-17540 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17582-17606 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18098-18122 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18242-18266 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18680-18704 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18830-18854 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19580-19604 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19724-19748 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19784-19808 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19904-19928 2 0.92
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20090-20114 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156553-156577 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156601-156625 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151636-151660 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151690-151714 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151744-151768 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151762-151786 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151780-151804 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153025-153049 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153907-153931 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154321-154345 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154429-154453 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155827-155851 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155935-155959 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156535-156559 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157189-157213 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157351-157375 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157513-157537 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157549-157573 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21229-21253 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16454-16478 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17132-17156 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15850-15874 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1252-1276 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1486-1510 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1612-1636 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2608-2632 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3094-3118 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3358-3382 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3544-3568 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1054-1078 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1882-1906 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2062-2086 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2098-2122 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2182-2206 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2272-2296 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2668-2692 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3484-3508 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3622-3646 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9787-9811 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9931-9955 2 0.92
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1108-1132 2 0.92
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 32224-32255 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 121749-121780 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP032197 Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence 61807-61838 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_KP345882 Escherichia coli strain BK32533 plasmid pBK32533, complete sequence 15850-15881 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP043048 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence 36554-36585 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP019900 Raoultella planticola strain GODA plasmid unnamed1, complete sequence 31159-31190 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 184972-185003 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 87219-87250 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 1948-1979 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 160072-160103 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 86044-86075 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 180553-180584 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 153684-153715 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 13418-13449 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 96313-96344 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP042483 Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence 198101-198132 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 96499-96530 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP010881 Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence 110494-110525 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 63439-63470 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 83844-83875 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 98483-98514 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 30013-30044 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 150899-150930 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 123521-123552 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP009773 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence 15852-15883 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP009776 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence 15844-15875 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP006926 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence 15852-15883 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 45342-45373 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 83836-83867 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP038276 Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence 26799-26830 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 15327-15358 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP011641 Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence 129965-129996 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 34201-34232 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP011633 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence 47402-47433 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 42078-42109 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 256525-256556 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 15757-15788 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP035211 Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence 125920-125951 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 56886-56917 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 67607-67638 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 103997-104028 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP021900 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0136 plasmid tig00001437_pilon, complete sequence 18960-18991 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP021778 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence 6216-6247 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP044049 Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence 108487-108518 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_LR130540 Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2 151980-152011 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 155914-155945 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 171530-171561 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 171657-171688 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_MG462728 Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence 180671-180702 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 19828-19859 3 0.906
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 NZ_CP054255 Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence 96507-96538 3 0.906
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151888-151918 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153019-153049 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153073-153103 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154657-154687 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154873-154903 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155071-155101 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155305-155335 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156313-156343 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156547-156577 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156565-156595 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3088-3118 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1066-1096 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1606-1636 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2266-2296 3 0.903
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3538-3568 3 0.903
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157243-157285 3 0.93
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157459-157501 3 0.93
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151366-151408 3 0.93
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151654-151696 3 0.93
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151708-151750 3 0.93
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155953-155995 3 0.93
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157531-157573 3 0.93
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2986-3028 3 0.93
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1576-1618 3 0.93
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151426-151462 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153175-153211 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155581-155617 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151534-151570 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151570-151606 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151606-151642 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151936-151972 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151972-152008 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153013-153049 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153367-153403 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153421-153457 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154417-154453 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154633-154669 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154669-154705 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154885-154921 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155065-155101 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155083-155119 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155209-155245 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155299-155335 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155317-155353 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155527-155563 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155851-155887 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155977-156013 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156925-156961 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156961-156997 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157267-157303 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2032-2068 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2278-2314 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2410-2446 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2860-2896 3 0.919
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3628-3664 3 0.919
NZ_CP018362_6 6.5|5246696|43|NZ_CP018362|CRT 5246696-5246738 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156517-156559 3 0.93
NZ_CP018362_6 6.5|5246696|43|NZ_CP018362|CRT 5246696-5246738 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1810-1852 3 0.93
NZ_CP018362_6 6.6|5246768|43|NZ_CP018362|CRT 5246768-5246810 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1882-1924 3 0.93
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1234-1258 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1306-1330 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1360-1384 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1414-1438 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1468-1492 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1522-1546 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1990-2014 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2218-2242 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2572-2596 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2818-2842 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2986-3010 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3778-3802 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1000-1024 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1090-1114 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1126-1150 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1504-1528 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1750-1774 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1828-1852 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1864-1888 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1936-1960 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2116-2140 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2200-2224 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2236-2260 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2404-2428 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2782-2806 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2836-2860 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2854-2878 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2872-2896 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3004-3028 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3604-3628 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153289-153313 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153307-153331 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153769-153793 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151275-151299 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151366-151390 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151726-151750 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152989-153013 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153169-153193 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153415-153439 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154003-154027 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154057-154081 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154075-154099 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154111-154135 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154447-154471 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154771-154795 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155167-155191 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155203-155227 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155221-155245 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155401-155425 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155773-155797 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155917-155941 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155953-155977 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156145-156169 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156841-156865 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157009-157033 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157045-157069 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157225-157249 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157243-157267 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157405-157429 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157459-157483 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16676-16700 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17018-17042 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17534-17558 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16766-16790 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16808-16832 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17642-17666 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17762-17786 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17804-17828 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18890-18914 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19244-19268 3 0.88
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19286-19310 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153097-153121 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153169-153193 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154219-154243 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155743-155767 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157117-157141 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151251-151275 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151329-151353 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151528-151552 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151564-151588 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151798-151822 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151894-151918 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153133-153157 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153289-153313 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153307-153331 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153631-153655 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153769-153793 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153871-153895 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153907-153931 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153967-153991 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154003-154027 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154075-154099 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154111-154135 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154183-154207 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154237-154261 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154255-154279 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154411-154435 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154951-154975 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155575-155599 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155611-155635 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155647-155671 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156217-156241 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156769-156793 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156919-156943 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156955-156979 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157027-157051 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157135-157159 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157261-157285 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157495-157519 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157567-157591 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1018-1042 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3376-3400 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3688-3712 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1000-1024 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1396-1420 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1594-1618 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1630-1654 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1864-1888 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2236-2260 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2818-2842 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3526-3550 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3562-3586 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21247-21271 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21193-21217 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15868-15892 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15814-15838 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9805-9829 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9949-9973 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9751-9775 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9895-9919 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16790-16814 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17624-17648 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17786-17810 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18872-18896 3 0.88
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19268-19292 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1072-1096 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1108-1132 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1342-1366 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1810-1834 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1918-1942 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2080-2104 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2632-2656 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3274-3298 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3376-3400 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3448-3472 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3688-3712 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3742-3766 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3760-3784 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154753-154777 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154951-154975 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155149-155173 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155383-155407 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156043-156067 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156391-156415 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151384-151408 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151420-151444 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151528-151552 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151546-151570 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151564-151588 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151582-151606 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151600-151624 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151654-151678 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151672-151696 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151708-151732 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151858-151882 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151912-151936 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151984-152008 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152056-152080 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153097-153121 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153187-153211 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153361-153385 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153649-153673 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153667-153691 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153685-153709 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153787-153811 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153805-153829 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153949-153973 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154147-154171 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154219-154243 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154303-154327 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154339-154363 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154483-154507 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154681-154705 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154699-154723 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154717-154741 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154897-154921 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154915-154939 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155059-155083 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155095-155119 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155113-155137 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155293-155317 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155329-155353 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155347-155371 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155437-155461 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155683-155707 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155725-155749 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155743-155767 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155863-155887 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155971-155995 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155989-156013 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156061-156085 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156079-156103 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156733-156757 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156805-156829 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156823-156847 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156883-156907 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156955-156979 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156973-156997 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156991-157015 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157063-157087 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157099-157123 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157117-157141 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157279-157303 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157315-157339 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157333-157357 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157531-157555 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157603-157627 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16094-16118 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16226-16250 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16358-16382 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16634-16658 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16658-16682 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16700-16724 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16868-16892 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16946-16970 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16970-16994 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17036-17060 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17384-17408 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17438-17462 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17600-17624 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17828-17852 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17846-17870 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17870-17894 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17942-17966 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18302-18326 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18326-18350 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18350-18374 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18584-18608 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18602-18626 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18698-18722 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18752-18776 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18848-18872 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18938-18962 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19046-19070 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19070-19094 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19310-19334 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19328-19352 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19352-19376 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19424-19448 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19802-19826 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19976-20000 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21121-21145 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21283-21307 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21301-21325 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21319-21343 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21355-21379 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15760-15784 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15904-15928 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15922-15946 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9679-9703 3 0.88
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9985-10009 3 0.88
NZ_CP018362_6 6.11|5247050|43|NZ_CP018362|CRT 5247050-5247092 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1882-1924 3 0.93
NZ_CP018362_6 6.11|5247050|43|NZ_CP018362|CRT 5247050-5247092 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2062-2104 3 0.93
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1000-1024 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1594-1618 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1864-1888 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2236-2260 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2272-2296 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2668-2692 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2782-2806 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3040-3064 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3742-3766 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155521-155545 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156301-156325 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156445-156469 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151600-151624 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151636-151660 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151690-151714 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153007-153031 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153133-153157 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153325-153349 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153451-153475 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153853-153877 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153907-153931 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153967-153991 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154075-154099 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154111-154135 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154147-154171 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154183-154207 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154237-154261 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154255-154279 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154411-154435 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154447-154471 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154537-154561 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154627-154651 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154807-154831 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154861-154885 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155611-155635 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155647-155671 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156007-156031 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156127-156151 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156319-156343 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156481-156505 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156499-156523 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157027-157051 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157045-157069 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157135-157159 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157189-157213 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157351-157375 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157477-157501 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157513-157537 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157567-157591 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1144-1168 3 0.88
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1018-1042 3 0.88
NZ_CP018362_6 6.15|5247320|43|NZ_CP018362|CRT 5247320-5247362 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153985-154027 3 0.93
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153061-153085 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151456-151480 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151876-151900 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151966-151990 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153151-153175 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153205-153229 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153325-153349 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153631-153655 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154645-154669 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154663-154687 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154735-154759 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154879-154903 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154933-154957 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155077-155101 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155131-155155 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155311-155335 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155365-155389 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155485-155509 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155503-155527 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156265-156289 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156283-156307 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156319-156343 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156409-156433 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156655-156679 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157297-157321 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157423-157447 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157585-157609 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21031-21055 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16076-16100 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16208-16232 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16340-16364 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17366-17390 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17516-17540 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17582-17606 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18098-18122 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18242-18266 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18680-18704 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18830-18854 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19580-19604 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19724-19748 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19784-19808 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19904-19928 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20090-20114 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15418-15442 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15508-15532 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15634-15658 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1558-1582 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 25-49 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1072-1096 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1288-1312 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1324-1348 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1540-1564 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1768-1792 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1846-1870 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1900-1924 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1954-1978 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2254-2278 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2368-2392 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2422-2446 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2458-2482 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3040-3064 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3148-3172 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3166-3190 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3466-3490 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9553-9577 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 982-1006 3 0.88
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1144-1168 3 0.88
NZ_CP018362_5 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT 5140913-5140944 32 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 173343-173374 4 0.875
NZ_CP018362_6 6.1|5246426|43|NZ_CP018362|CRT 5246426-5246468 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3742-3784 4 0.907
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151834-151864 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153337-153367 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153607-153637 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155497-155527 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156277-156307 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157183-157213 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1246-1276 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1480-1510 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2680-2710 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3142-3172 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3352-3382 4 0.871
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1138-1168 4 0.871
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151726-151768 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153115-153157 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153433-153475 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154237-154279 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154393-154435 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154447-154489 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154609-154651 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154843-154885 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155593-155635 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155629-155671 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157099-157141 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157225-157267 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1090-1132 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1108-1150 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1792-1834 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2482-2524 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1036-1078 4 0.907
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1090-1132 4 0.907
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151462-151498 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151846-151882 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153103-153139 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154009-154045 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154153-154189 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154759-154795 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154957-154993 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155155-155191 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155389-155425 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156661-156697 4 0.892
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9955-9991 4 0.892
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1072-1096 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1108-1132 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1810-1834 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1918-1942 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2632-2656 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3274-3298 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3448-3472 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3508-3532 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3742-3766 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3760-3784 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151384-151408 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151420-151444 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151528-151552 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151546-151570 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151564-151588 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151582-151606 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151600-151624 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151672-151696 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151858-151882 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151984-152008 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152056-152080 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153187-153211 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153361-153385 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153649-153673 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153667-153691 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153685-153709 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153787-153811 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154147-154171 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154303-154327 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154681-154705 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154699-154723 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154717-154741 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154897-154921 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154915-154939 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155059-155083 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155095-155119 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155113-155137 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155293-155317 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155329-155353 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155347-155371 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155683-155707 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155725-155749 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155863-155887 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155971-155995 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155989-156013 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156061-156085 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156805-156829 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156823-156847 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156955-156979 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156973-156997 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156991-157015 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157099-157123 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157279-157303 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157333-157357 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16094-16118 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16226-16250 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16358-16382 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16634-16658 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16658-16682 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16700-16724 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16868-16892 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16946-16970 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16970-16994 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17036-17060 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17384-17408 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17438-17462 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17600-17624 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17828-17852 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17846-17870 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17870-17894 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17942-17966 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18302-18326 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18326-18350 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18350-18374 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18584-18608 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18602-18626 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18698-18722 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18752-18776 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18848-18872 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18938-18962 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19046-19070 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19070-19094 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19310-19334 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19328-19352 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19352-19376 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19424-19448 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19802-19826 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19976-20000 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21121-21145 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21283-21307 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21301-21325 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21319-21343 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21355-21379 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15760-15784 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15904-15928 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15922-15946 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9679-9703 4 0.84
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9985-10009 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154483-154507 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154537-154561 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154591-154615 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154753-154777 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154807-154831 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155023-155047 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155149-155173 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155257-155281 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155383-155407 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155503-155527 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156043-156067 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156283-156307 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156391-156415 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156619-156643 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156655-156679 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156733-156757 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156883-156907 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157081-157105 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157441-157465 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1270-1294 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2026-2050 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2650-2674 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3112-3136 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3148-3172 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3202-3226 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3466-3490 4 0.84
NZ_CP018362_6 6.8|5246894|25|NZ_CP018362|CRT 5246894-5246918 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2887826-2887850 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1168-1192 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1504-1528 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2116-2140 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2200-2224 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2854-2878 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151275-151299 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151366-151390 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153169-153193 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154003-154027 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154057-154081 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155203-155227 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155773-155797 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155917-155941 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156145-156169 4 0.84
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157405-157429 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1396-1420 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2026-2050 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2080-2104 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2116-2140 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151894-151918 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153043-153067 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153871-153895 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154003-154027 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154375-154399 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154483-154507 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154591-154615 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155023-155047 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155257-155281 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155503-155527 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156283-156307 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156463-156487 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156553-156577 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156655-156679 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156733-156757 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156883-156907 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157063-157087 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157081-157105 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157369-157393 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157387-157411 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1162-1186 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21085-21109 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15472-15496 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15580-15604 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15706-15730 4 0.84
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9643-9667 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151840-151864 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151894-151918 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151930-151954 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153613-153637 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153823-153847 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154465-154489 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156097-156121 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156337-156361 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156355-156379 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156571-156595 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21085-21109 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15472-15496 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15580-15604 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15706-15730 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1630-1654 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2650-2674 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2686-2710 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3058-3082 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3202-3226 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3562-3586 4 0.84
NZ_CP018362_6 6.16|5247392|25|NZ_CP018362|CRT 5247392-5247416 25 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9643-9667 4 0.84
NZ_CP018362_6 6.2|5246498|31|NZ_CP018362|CRT 5246498-5246528 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153919-153949 5 0.839
NZ_CP018362_6 6.3|5246558|43|NZ_CP018362|CRT 5246558-5246600 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151275-151317 5 0.884
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2506-2542 5 0.865
NZ_CP018362_6 6.5|5246696|43|NZ_CP018362|CRT 5246696-5246738 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2764-2806 5 0.884
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3586-3610 5 0.8
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1168-1192 5 0.8
NZ_CP018362_6 6.7|5246840|25|NZ_CP018362|CRT 5246840-5246864 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3340-3364 5 0.8
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3586-3610 5 0.8
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3340-3364 5 0.8
NZ_CP018362_6 6.9|5246948|25|NZ_CP018362|CRT 5246948-5246972 25 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3508-3532 5 0.8
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153235-153259 5 0.8
NZ_CP018362_6 6.14|5247266|25|NZ_CP018362|CRT 5247266-5247290 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153715-153739 5 0.8
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154831-154867 6 0.838
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155797-155833 6 0.838
NZ_CP018362_6 6.13|5247194|43|NZ_CP018362|CRT 5247194-5247236 43 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3076-3118 6 0.86
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152044-152080 7 0.811
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16808-16844 7 0.811
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17438-17474 7 0.811
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17642-17678 7 0.811
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18752-18788 7 0.811
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19802-19838 7 0.811
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18404-18440 7 0.811
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19124-19160 7 0.811
NZ_CP018362_6 6.6|5246768|43|NZ_CP018362|CRT 5246768-5246810 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154825-154867 7 0.837
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18602-18638 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16148-16184 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16280-16316 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16412-16448 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16724-16760 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16766-16802 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17090-17126 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17270-17306 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17558-17594 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17600-17636 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17720-17756 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17762-17798 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18020-18056 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18218-18254 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18482-18518 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18530-18566 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18848-18884 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18962-18998 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19202-19238 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19244-19280 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19502-19538 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19700-19736 8 0.784
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19850-19886 8 0.784
NZ_CP018362_6 6.6|5246768|43|NZ_CP018362|CRT 5246768-5246810 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155791-155833 8 0.814
NZ_CP018362_6 6.13|5247194|43|NZ_CP018362|CRT 5247194-5247236 43 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154555-154597 8 0.814
NZ_CP018362_6 6.4|5246630|37|NZ_CP018362|CRT 5246630-5246666 37 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19742-19778 9 0.757

1. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
*************************

2. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
*************************

3. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
*************************

4. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
*************************

5. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
*************************

6. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgactctgacagc	Protospacer
*************************

7. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.968

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
ggacagtgactcggattcggacagtgattcg	Protospacer
*********.*********************

8. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.973

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattcggacagcgattcggactct	Protospacer
******************.******************

9. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.973

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattctgacagcgattcggactct	Protospacer
****************** ******************

10. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.973

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattctgacagcgattcggactct	Protospacer
****************** ******************

11. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
************************.

12. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
************************.

13. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
************************.

14. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
************************.

15. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactccgacagc	Protospacer
************************.

16. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
************ ************

17. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgactccgacagt	Protospacer
************.************

18. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
************ ************

19. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgactccgacagt	Protospacer
************.************

20. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactcggacagt	Protospacer
****************** ******

21. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
************ ************

22. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
************ ************

23. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
***.*********************

24. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
***.*********************

25. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
***.*********************

26. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
***.*********************

27. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.96

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
***.*********************

28. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgactccgacagc	Protospacer
************.************

29. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactctgacagc	Protospacer
******************.******

30. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactcggacagc	Protospacer
****************** ******

31. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactctgactccgacagc	Protospacer
 ************************

32. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgactccgacagc	Protospacer
************.************

33. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactcggacagc	Protospacer
****************** ******

34. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactctgacagc	Protospacer
******************.******

35. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcagactccgacagc	Protospacer
************ ************

36. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ************

37. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgactccgacagc	Protospacer
************.************

38. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ************

39. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ************

40. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ************

41. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagtgattccgactctgacagc	Protospacer
 ************************

42. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagtgattccgactctgacagc	Protospacer
 ************************

43. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
************ ************

44. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
************ ************

45. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
************ ************

46. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

47. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

48. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

49. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

50. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

51. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

52. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

53. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

54. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

55. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

56. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

57. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgactccgactctgacagc	Protospacer
*********.***************

58. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgattctgacagc	Protospacer
***************.*********

59. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattccgactctgacagc	Protospacer
******.******************

60. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgattctgacagc	Protospacer
***************.*********

61. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgactccgactctgacagc	Protospacer
*********.***************

62. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattccgactctgacagc	Protospacer
******.******************

63. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
************ ************

64. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactctgacagc	Protospacer
.************************

65. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
************ ************

66. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactctgacagc	Protospacer
************ ************

67. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactctgacagc	Protospacer
************ ************

68. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactctgacagc	Protospacer
************ ************

69. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.96

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactctgacagc	Protospacer
************ ************

70. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattccgattcagacagc	Protospacer
************ ************

71. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.96

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattccgattcagacagc	Protospacer
************ ************

72. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP022118 (Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctcta	Protospacer
***********************.*****.**

73. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP030176 (Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.1, complete sequence) position: , mismatch: 2, identity: 0.938

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctcta	Protospacer
***********************.*****.**

74. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
ggacagtgattcggattcggacagtgactcc	Protospacer
***************************.** 

75. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
ggacagcgattcggattcggacagcgattcg	Protospacer
******.*****************.******

76. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.935

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
ggacagtgactcggattcggacagtgactcg	Protospacer
*********.*****************.***

77. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagtgattcggattccgacagtgattcg	Protospacer
 ***************** ************

78. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagtgactcggattcggacagtgattcg	Protospacer
 ********.*********************

79. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
ggacagcgattcggattccgacagtgattcg	Protospacer
******.*********** ************

80. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
ggacagtgattcggactcggacagcgattcg	Protospacer
***************.********.******

81. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.935

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
ggacagcgattcggattccgacagtgattcg	Protospacer
******.*********** ************

82. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.953

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactctgacagtgactctgactctgacagt	Protospacer
 ***********************.******************

83. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattcggacagcgattcggactcc	Protospacer
******************.*****************.

84. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattcggacagcgattcggactcg	Protospacer
******************.***************** 

85. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattcggacagcgattcggactct	Protospacer
 *****************.******************

86. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattctgacagcgattcggactct	Protospacer
.***************** ******************

87. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattctgacagcgattcggactct	Protospacer
.***************** ******************

88. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattctgacagcgattcggactct	Protospacer
.***************** ******************

89. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagtgactcggattctgacagcgattcggactct	Protospacer
******.*********** ******************

90. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgattcggattcggacagcgattcggactct	Protospacer
*********.********.******************

91. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattccgacagcgattccgactct	Protospacer
****************** *********** ******

92. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.946

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattctgacagcgattcggattct	Protospacer
****************** **************.***

93. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgactccgacagc	Protospacer
************.***********.

94. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactctgacagc	Protospacer
******************.*****.

95. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactcggacagc	Protospacer
****************** *****.

96. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactctgactccgacagc	Protospacer
 ***********************.

97. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgactccgacagc	Protospacer
************.***********.

98. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactcggacagc	Protospacer
****************** *****.

99. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactctgacagc	Protospacer
******************.*****.

100. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcagactccgacagc	Protospacer
************ ***********.

101. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgattccgacagt	Protospacer
************.**.*********

102. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattctgactctgacagt	Protospacer
*********.********.******

103. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ************

104. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ************

105. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ***********.

106. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgactccgacagc	Protospacer
************.***********.

107. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ************

108. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggactccgacagt	Protospacer
 *********** ************

109. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ************

110. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ************

111. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ************

112. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ***********.

113. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ************

114. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ***********.

115. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
************ ***********.

116. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.******

117. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.******

118. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagtgactctgactcggacagt	Protospacer
******.*********** ******

119. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ************

120. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagtgactcggactccgacagt	Protospacer
******.***** ************

121. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggattccgacagt	Protospacer
************ **.*********

122. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ************

123. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.******

124. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
*********.**.************

125. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.******

126. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ************

127. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagtgactcggactccgacagt	Protospacer
******.***** ************

128. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
*********.**.************

129. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
*********.**.************

130. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagtgactctgactctgacagt	Protospacer
******.***********.******

131. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ************

132. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgattccgacagt	Protospacer
************.**.*********

133. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.******

134. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgattccgacagt	Protospacer
************.**.*********

135. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
 **.*********************

136. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
 **.*********************

137. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
 **.*********************

138. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
 **.*********************

139. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
 **.*********************

140. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
 **.*********************

141. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
 **.*********************

142. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggatagcgattcggattctgacagc	Protospacer
***************.**.******

143. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactcggacagc	Protospacer
***.************** ******

144. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattccgactccgacagc	Protospacer
***.******** ************

145. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
***.**************.******

146. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
***.**************.******

147. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattccgactccgacagc	Protospacer
***.******** ************

148. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
***.**************.******

149. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
***.**************.******

150. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
***.**************.******

151. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
 **.*********************

152. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagt	Protospacer
***.********************.

153. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
 **.*********************

154. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
 **.*********************

155. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
 **.*********************

156. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactccgactccgacagc	Protospacer
 ***********.************

157. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
************ ***********.

158. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactctgactcggacagc	Protospacer
.***************** ******

159. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactctgactctgacagc	Protospacer
 *****************.******

160. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactctgactcggacagc	Protospacer
.***************** ******

161. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactctgactcggacagc	Protospacer
 ***************** ******

162. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactctgactcggacagc	Protospacer
 ***************** ******

163. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgactccgacagt	Protospacer
************.***********.

164. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactctgactcggacagc	Protospacer
 ***************** ******

165. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcagactccgacagc	Protospacer
.*********** ************

166. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactctgactcggacagc	Protospacer
.***************** ******

167. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
.*********** ************

168. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactctgactctgacagc	Protospacer
.*****************.******

169. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
************ ***********.

170. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgactccgacagt	Protospacer
************.***********.

171. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactcggacagt	Protospacer
****************** *****.

172. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactctgactcggacagc	Protospacer
.***************** ******

173. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.************

174. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.******

175. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ************

176. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ************

177. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgattccgacagc	Protospacer
************.**.*********

178. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.************

179. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgactcggacagc	Protospacer
************.***** ******

180. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.************

181. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ************

182. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagtgactccgactccgacagc	Protospacer
******.*****.************

183. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagtgactcggactccgacagc	Protospacer
******.***** ************

184. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.*********

185. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ************

186. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgactcggacagc	Protospacer
************.***** ******

187. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
.*********** ************

188. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
.*********** ************

189. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
.*********** ************

190. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
************ ***********.

191. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
************ ***********.

192. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.******

193. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactccgatagc	Protospacer
************ ********.***

194. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.******

195. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.************

196. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.************

197. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagtgactctgactctgacagc	Protospacer
******.***********.******

198. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.*********

199. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.*********

200. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.*********

201. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.*********

202. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.******

203. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ************

204. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ************

205. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagtgactctgactctgacagc	Protospacer
******.***********.******

206. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.******

207. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.******

208. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.******

209. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgactcagacagc	Protospacer
 ***************** ******

210. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgactcagacagc	Protospacer
 ***************** ******

211. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgactcagacagc	Protospacer
 ***************** ******

212. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgattctgacagc	Protospacer
***************.**.******

213. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** ******

214. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** ******

215. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgattctgacagc	Protospacer
***************.**.******

216. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** ******

217. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** ******

218. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgattctgacagc	Protospacer
***************.**.******

219. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** ******

220. spacer 6.13|5247194|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.953

cgacagtgattcggattcggacagcgattcggactcggatagc	CRISPR spacer
cgacagtgattcggattctgacagcgattcggactcggacagc	Protospacer
****************** ********************.***

221. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattcagactctgacagc	Protospacer
.*********** ************

222. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattcggactctgacagc	Protospacer
.*********** ************

223. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattccgactctgacagt	Protospacer
******.*****************.

224. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactccgacagc	Protospacer
.*****************.******

225. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgactcggactctgacagc	Protospacer
*********.** ************

226. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggactcggacagc	Protospacer
************ ***** ******

227. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggattctgacagc	Protospacer
************ **.*********

228. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattctgactctgacagc	Protospacer
******.*****.************

229. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggattctgacagc	Protospacer
************ **.*********

230. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgactccgactccgacagc	Protospacer
*********.********.******

231. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgactctgactctgacagc	Protospacer
*********.**.************

232. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggattctgacagc	Protospacer
************ **.*********

233. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactctgacagc	Protospacer
.*****.******************

234. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggactctgacagt	Protospacer
************ ***********.

235. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgactccgactctgacagc	Protospacer
.********.***************

236. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgactccgacagt	Protospacer
******************.*****.

237. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattccgactctgacagc	Protospacer
 *****.******************

238. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactctgacagc	Protospacer
.*****.******************

239. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
******.***********.******

240. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
******.***********.******

241. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattcggactctgacagc	Protospacer
******.***** ************

242. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
***************.** ******

243. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgactccgattctgacagc	Protospacer
*********.*****.*********

244. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
***************.** ******

245. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
***************.** ******

246. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
***************.** ******

247. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
***************.** ******

248. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgactccgactccgacagc	Protospacer
*********.********.******

249. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgattccgacagc	Protospacer
***************.**.******

250. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattccgattctgacagc	Protospacer
******.********.*********

251. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattccgattcagacagc	Protospacer
***************.** ******

252. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
******.***********.******

253. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgactctgactctgacagc	Protospacer
*********.**.************

254. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattcggactctgacagc	Protospacer
******.***** ************

255. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggactcggacagc	Protospacer
************ ***** ******

256. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcggactcggacagc	Protospacer
************ ***** ******

257. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattccgattctgacagc	Protospacer
******.********.*********

258. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

259. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

260. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

261. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

262. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

263. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

264. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

265. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

266. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

267. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

268. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

269. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

270. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

271. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

272. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
************ ***** ******

273. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattcggattctgacagt	Protospacer
****************** *****.

274. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattccgattcagacagc	Protospacer
.*********** ************

275. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
************ ***** ******

276. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
************ ***** ******

277. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagc	Protospacer
******.*********** ******

278. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagc	Protospacer
******.*********** ******

279. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagc	Protospacer
******.*********** ******

280. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattcggacagc	Protospacer
*********.********.******

281. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattcggactccgacagc	Protospacer
***************.** ******

282. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattccgacagc	Protospacer
*********.******** ******

283. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagc	Protospacer
******.*********** ******

284. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattcggacagc	Protospacer
******.***********.******

285. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattcggacagc	Protospacer
******.***********.******

286. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattccgacagc	Protospacer
*********.******** ******

287. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattccgattcggacagc	Protospacer
************ *****.******

288. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
************ ***** ******

289. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
************ ***** ******

290. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagc	Protospacer
******.*********** ******

291. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
agacagtgattcagattcagacagc	Protospacer
 ***********.************

292. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagattcagacagc	Protospacer
.***********.************

293. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagattcagacagc	Protospacer
.***********.************

294. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
agacagtgattcagattcagacagc	Protospacer
 ***********.************

295. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggattcggacagc	Protospacer
.*****************.******

296. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggattcggacagc	Protospacer
.*****************.******

297. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggattctgacagc	Protospacer
.***************** ******

298. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggattctgacagc	Protospacer
.***************** ******

299. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggattcggacagc	Protospacer
.*****************.******

300. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggattcggacagc	Protospacer
.*****************.******

301. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggattctgacagc	Protospacer
.***************** ******

302. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattcggactctgacagc	Protospacer
***************.** ******

303. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattctgacagc	Protospacer
*********.******** ******

304. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattctgacagc	Protospacer
*********.******** ******

305. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattctgacagc	Protospacer
*********.******** ******

306. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattccgacagc	Protospacer
*********.******** ******

307. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattcggactcggacagc	Protospacer
***************.**.******

308. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
************ ***** ******

309. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgactcggattctgacagc	Protospacer
*********.******** ******

310. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagc	Protospacer
******.*********** ******

311. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
agacagtgattcagattcagacagc	Protospacer
 ***********.************

312. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
agacagtgattcagattcagacagc	Protospacer
 ***********.************

313. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 2, identity: 0.92

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagc	Protospacer
******.*********** ******

314. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

315. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

316. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP032197 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

317. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_KP345882 (Escherichia coli strain BK32533 plasmid pBK32533, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

318. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP043048 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

319. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

320. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

321. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

322. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

323. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

324. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

325. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

326. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

327. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

328. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

329. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP042483 (Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

330. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

331. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP010881 (Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

332. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

333. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

334. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

335. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

336. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

337. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

338. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP009773 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

339. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP009776 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

340. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP006926 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

341. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

342. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

343. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP038276 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

344. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

345. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

346. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

347. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

348. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

349. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

350. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

351. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

352. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

353. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

354. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

355. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP021900 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0136 plasmid tig00001437_pilon, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

356. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP021778 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_3, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

357. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP044049 (Klebsiella variicola strain FDAARGOS_627 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

358. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

359. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

360. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

361. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

362. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

363. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

364. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagccaatgcgacaggttgtggctatg	Protospacer
***********************.***** *.

365. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
ggacagtgattcggactccgacagtgattcc	Protospacer
***************.** *********** 

366. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagtgactcggattcggacagcgattcg	Protospacer
 ********.**************.******

367. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagtgactccgattcggacagtgattcg	Protospacer
 ********.** ******************

368. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagcgattcggattcggacagcgattcg	Protospacer
 *****.*****************.******

369. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagcgattcggattcggacagcgattcg	Protospacer
 *****.*****************.******

370. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagcgattcggattcggacagcgattcg	Protospacer
 *****.*****************.******

371. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagcgattcggattcggacagcgattcg	Protospacer
 *****.*****************.******

372. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
ggacagtgattcggactcggacagcgattcc	Protospacer
***************.********.***** 

373. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagtgattcggattctgacagtgactcg	Protospacer
 ***************** ********.***

374. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagcgattcggattctgacagtgattcg	Protospacer
 *****.*********** ************

375. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagtgattcggattcggacagcgattcc	Protospacer
 ***********************.***** 

376. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagcgattcggattctgacagtgattcg	Protospacer
 *****.*********** ************

377. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagtgattcggattctgacagcgattcg	Protospacer
 ***************** *****.******

378. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagtgattcggactcggacagcgattcg	Protospacer
 **************.********.******

379. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.903

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagtgattcggattctgacagcgattcg	Protospacer
 ***************** *****.******

380. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
cgacagcgattcggactctgacagcgactcggactctgacagc	Protospacer
 ***************************** ***********.

381. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
ggacagcgattcggactctgacagcgactcggactctgacagc	Protospacer
.***************************** ***********.

382. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
ggacagcgattcggactccgacagcgactcggactctgacagt	Protospacer
.*****************.*********** ************

383. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
cgacagcgactcggactctgacagcgactcggactctgacagt	Protospacer
 ********.******************** ************

384. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgactcggactctgacagcgactcggactctgacagt	Protospacer
 ********.******************** ************

385. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
agacagcgactcggactctgacagcgactcggactctgacagc	Protospacer
*********.******************** ***********.

386. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggattctgacagcgactcggactctgacagt	Protospacer
 **************.************** ************

387. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.93

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactccgacagcgactctgactctgacagc	Protospacer
 *****************.***********************.

388. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.93

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactctgacagcgactccgactccgacagt	Protospacer
 *****************************.*****.******

389. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattcggacagcgattcggactcc	Protospacer
 *****************.*****************.

390. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattccgacagcgattcggactcc	Protospacer
 ***************** *****************.

391. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattctgacagcgattcggactcg	Protospacer
.***************** ***************** 

392. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattccgacagcgattccgactcc	Protospacer
****************** *********** *****.

393. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattccgacagcgattccgactcc	Protospacer
****************** *********** *****.

394. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattcggacagcgattccgactcc	Protospacer
******************.*********** *****.

395. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattcggacagcgattcggattct	Protospacer
.*****************.**************.***

396. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattccgacagcgattcggattct	Protospacer
 ***************** **************.***

397. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagtgactcggattcggacagcgattcggactct	Protospacer
.*****.***********.******************

398. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattcggacagcgactcggactct	Protospacer
.*****************.********.*********

399. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattctgacagcgactcggactct	Protospacer
.***************** ********.*********

400. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgattcggattctgacagcgattcggactct	Protospacer
.********.******** ******************

401. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgattcggattcggacagcgattcggactct	Protospacer
 ********.********.******************

402. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattccgacagcgattcggattcg	Protospacer
****************** **************.** 

403. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattccgacagcgattcggattcg	Protospacer
****************** **************.** 

404. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgattcggattcggacagcgattcggactcc	Protospacer
*********.********.*****************.

405. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattccgacagcgattcggattcg	Protospacer
****************** **************.** 

406. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattccgacagcgactcggactct	Protospacer
.***************** ********.*********

407. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgattcggattcggacagcgattcggactcc	Protospacer
*********.********.*****************.

408. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattccgacagcgattcggattcg	Protospacer
****************** **************.** 

409. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattcggacagcgattccgactct	Protospacer
 *****************.*********** ******

410. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattccgacagcgattccgactct	Protospacer
 ***************** *********** ******

411. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
agacagcgactcggactcagacagcgactcggactct	Protospacer
 **************.***********.*********

412. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattctgacagcgactcggactcc	Protospacer
****************** ********.********.

413. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattccgacagcgattccgactcc	Protospacer
****************** *********** *****.

414. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactccgattccgacagcgattcggactct	Protospacer
 *********** ***** ******************

415. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggatgctgacagcgattcggactct	Protospacer
.*************** * ******************

416. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactcggattctgacagtgattcggactcg	Protospacer
****************** *****.*********** 

417. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgattcggattctgacagcgattcggactcc	Protospacer
*********.******** *****************.

418. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattccgacagcgactcggactct	Protospacer
.***************** ********.*********

419. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.919

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattctgacagcgattcggattct	Protospacer
.***************** **************.***

420. spacer 6.5|5246696|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

tgacagtgactccgattccgacagcgattctgattctgacagt	CRISPR spacer
tgacagtgactcggattccgacagcgattccgattctgacagc	Protospacer
************ *****************.***********.

421. spacer 6.5|5246696|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.93

tgacagtgactccgattccgacagcgattctgattctgacagt	CRISPR spacer
tgacagcgactccgattccgacagcgattctgactctgacagc	Protospacer
******.**************************.********.

422. spacer 6.6|5246768|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.93

tgacagcgactcggattctgacagtgactcggattctgatagt	CRISPR spacer
tgacagcgattcggattctgacagtgactcggattctgacagc	Protospacer
*********.*****************************.**.

423. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactccgactccgacagc	Protospacer
 ***********.***********.

424. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactctgactcggacagc	Protospacer
.***************** *****.

425. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactctgactctgacagc	Protospacer
 *****************.*****.

426. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactctgactcggacagc	Protospacer
.***************** *****.

427. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactctgactcggacagc	Protospacer
 ***************** *****.

428. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactctgactcggacagc	Protospacer
 ***************** *****.

429. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactctgactcggacagc	Protospacer
 ***************** *****.

430. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcagactccgacagc	Protospacer
.*********** ***********.

431. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactctgactcggacagc	Protospacer
.***************** *****.

432. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
.*********** ***********.

433. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactctgactctgacagc	Protospacer
.*****************.*****.

434. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactctgactcggacagc	Protospacer
.***************** *****.

435. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.***********.

436. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.*****.

437. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ***********.

438. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattcggactccgacagt	Protospacer
 ********.** ************

439. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ***********.

440. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgattccgacagc	Protospacer
************.**.********.

441. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.***********.

442. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgactcggacagc	Protospacer
************.***** *****.

443. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactccgactctgacagt	Protospacer
 ***********.*****.******

444. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.******

445. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.***********.

446. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ***********.

447. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagtgactccgactccgacagc	Protospacer
******.*****.***********.

448. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagtgactcggactccgacagc	Protospacer
******.***** ***********.

449. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.******

450. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.********.

451. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ***********.

452. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactccgactcggacagc	Protospacer
************.***** *****.

453. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
.*********** ***********.

454. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
.*********** ***********.

455. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
.*********** ***********.

456. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgactctgactct	Protospacer
******************.***  *

457. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.******

458. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.*****.

459. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactccgatagc	Protospacer
************ ********.**.

460. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattcggactccgacagt	Protospacer
.********.** ************

461. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.*****.

462. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattccgactccgacagt	Protospacer
 ********.**.************

463. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagt	Protospacer
.*********** **.*********

464. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.***********.

465. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
*********.**.***********.

466. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagtgactctgactctgacagc	Protospacer
******.***********.*****.

467. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.********.

468. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.********.

469. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.******

470. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.********.

471. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggattccgacagc	Protospacer
************ **.********.

472. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattctgacgccgacagt	Protospacer
.********.****** ********

473. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggattccgacagt	Protospacer
 *********** **.*********

474. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.*****.

475. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.******

476. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ***********.

477. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgattcggactccgacagc	Protospacer
*********.** ***********.

478. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagtgactctgactctgacagc	Protospacer
******.***********.*****.

479. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.*****.

480. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.*****.

481. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggactctgacagt	Protospacer
 *********** *****.******

482. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactcggactctgacagc	Protospacer
************ *****.*****.

483. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgactcagacagc	Protospacer
 ***************** *****.

484. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgactcagacagc	Protospacer
 ***************** *****.

485. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgactcagacagc	Protospacer
 ***************** *****.

486. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgattctgacagc	Protospacer
***************.**.*****.

487. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** *****.

488. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** *****.

489. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgattctgacagc	Protospacer
***************.**.*****.

490. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** *****.

491. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** *****.

492. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgattctgacagc	Protospacer
***************.**.*****.

493. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagt	CRISPR spacer
tgacagcgactctgattcagacagc	Protospacer
***************.** *****.

494. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
 **.********************.

495. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagt	Protospacer
 **.********************.

496. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
 **.********************.

497. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
 **.********************.

498. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
 **.********************.

499. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
 **.*****.***************

500. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
ggatagcgattcggattctgacagt	Protospacer
***************.**.*****.

501. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
 **.******** ************

502. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
 **.******** ************

503. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactctgacagc	Protospacer
 **.**************.******

504. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagtgattcggactccgacagt	Protospacer
***.**.*****************.

505. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

506. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
 **.*****.***************

507. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
 **.*****.***************

508. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggattccgacagc	Protospacer
 **.***********.*********

509. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
 **.*****.***************

510. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactctgacagt	Protospacer
***.**************.*****.

511. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagtgattcggactccgacagc	Protospacer
 **.**.******************

512. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

513. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattccgactccgacagt	Protospacer
***.******** ***********.

514. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
 **.******** ************

515. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
 **.******** ************

516. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

517. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

518. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

519. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

520. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgactcggactccgacagt	Protospacer
***.*****.**************.

521. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactcggacagc	Protospacer
 **.************** ******

522. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

523. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

524. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
 **.*****.***************

525. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
 **.*****.***************

526. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagc	Protospacer
 **.*****.***************

527. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
 **.******** ************

528. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

529. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

530. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactctgacagc	Protospacer
 **.**************.******

531. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactcggacagc	Protospacer
 **.************** ******

532. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

533. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

534. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
 **.********************.

535. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
 **.********************.

536. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
 **.******** ************

537. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggactctgacagt	Protospacer
***.**************.*****.

538. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
 **.**************.******

539. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggattccgacagt	Protospacer
***.***********.********.

540. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
 **.******** ************

541. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
 **.******** ************

542. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagc	Protospacer
 **.*****.***************

543. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactcggacagc	Protospacer
 **.************** ******

544. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
ggacagcgattcggattccgacagt	Protospacer
***.***********.********.

545. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
agatagcgattcggactcagacagt	Protospacer
.***************** *****.

546. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
agatagcgattcagactcagacagc	Protospacer
.***********.***** ******

547. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
agatagcgattcggactcagacagt	Protospacer
.***************** *****.

548. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
agatagcgattcagactcagacagc	Protospacer
.***********.***** ******

549. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
agatagcgattcggactcagacagt	Protospacer
.***************** *****.

550. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
agatagcgattcggactcagacagt	Protospacer
.***************** *****.

551. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
agatagcgattcagactcagacagc	Protospacer
.***********.***** ******

552. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
agatagcgattcagactcagacagc	Protospacer
.***********.***** ******

553. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgatagcgattcagactctgacagc	Protospacer
 ***********.*****.******

554. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgatagcgattcagactctgacagc	Protospacer
 ***********.*****.******

555. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgatagcgattcagactctgacagc	Protospacer
 ***********.*****.******

556. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgatagcgattcagactctgacagc	Protospacer
 ***********.*****.******

557. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

ggatagcgattcggactccgacagc	CRISPR spacer
cgatagcgattcagactctgacagc	Protospacer
 ***********.*****.******

558. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ************

559. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.******

560. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgattccgacagt	Protospacer
************.**.********.

561. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattctgactctgacagc	Protospacer
.********.********.******

562. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggactctgacagc	Protospacer
 *********** *****.******

563. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattctgactctgacagt	Protospacer
*********.********.*****.

564. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagtgactccgactccgacagc	Protospacer
.*****.*****.************

565. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.******

566. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ***********.

567. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagtgactctgactctgacagc	Protospacer
.*****.***********.******

568. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ***********.

569. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattctgactctgacagc	Protospacer
 ********.********.******

570. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactccgactcggacagc	Protospacer
 ***********.***** ******

571. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ***********.

572. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggactccgacagt	Protospacer
 *********** ***********.

573. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ***********.

574. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ***********.

575. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ***********.

576. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
.*********** ***********.

577. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ************

578. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ************

579. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
.********.**.************

580. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.*********

581. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
.********.**.************

582. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.*********

583. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattccgactccgacagc	Protospacer
 ********.**.************

584. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.*****.

585. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.******

586. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.*****.

587. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.*********

588. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagtgactctgactcggacagt	Protospacer
******.*********** *****.

589. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.*********

590. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggactctgacagc	Protospacer
 *********** *****.******

591. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ***********.

592. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.*********

593. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggactctgacagc	Protospacer
 *********** *****.******

594. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ************

595. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ************

596. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ************

597. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagtgactcggactccgacagc	Protospacer
.*****.***** ************

598. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagtgactcggactccgacagt	Protospacer
******.***** ***********.

599. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggattccgacagt	Protospacer
************ **.********.

600. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattccgactccgacagc	Protospacer
 ********.**.************

601. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ***********.

602. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.******

603. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.*****.

604. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
*********.**.***********.

605. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.*********

606. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.*********

607. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.*********

608. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.*********

609. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.*********

610. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ************

611. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.*********

612. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.*********

613. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ************

614. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.*********

615. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.*********

616. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.*****.

617. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.******

618. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagtgactccgactccgacagc	Protospacer
.*****.*****.************

619. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ***********.

620. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.*********

621. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcggactctgacagc	Protospacer
 *********** *****.******

622. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcggactcagacagc	Protospacer
 *********** ***** ******

623. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagtgactcggactccgacagc	Protospacer
.*****.***** ************

624. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagtgactcggactccgacagt	Protospacer
******.***** ***********.

625. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
*********.**.***********.

626. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.*********

627. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ************

628. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
*********.**.***********.

629. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
.********.**.************

630. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.*********

631. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ************

632. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagtgactctgactctgacagt	Protospacer
******.***********.*****.

633. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagtgactctgactctgacagc	Protospacer
.*****.***********.******

634. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgattcggactccgacagt	Protospacer
*********.** ***********.

635. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactccgattccgacagc	Protospacer
 ***********.**.*********

636. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgattccgacagt	Protospacer
************.**.********.

637. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.******

638. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactcggactctgacagt	Protospacer
************ *****.*****.

639. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactccgattccgacagt	Protospacer
************.**.********.

640. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

641. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

642. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

643. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

644. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

645. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

646. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

647. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

648. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

649. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

650. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

651. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactctgattcagacagc	Protospacer
.**************.** ******

652. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattctgacagc	Protospacer
 **************.**.******

653. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

654. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

655. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

656. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

657. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

658. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

659. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

660. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

661. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

662. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

663. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactctgattcagacagc	Protospacer
.**************.** ******

664. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattctgacagc	Protospacer
 **************.**.******

665. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

666. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

667. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

668. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

669. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

670. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

671. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** ******

672. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** ******

673. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactctgattcagacagc	Protospacer
.**************.** ******

674. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

675. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

676. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

677. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

678. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

679. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

680. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

681. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

682. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

683. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

tgacagcgactctgactccgacagc	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** ******

684. spacer 6.11|5247050|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.93

cgacagcgattctgattctgacagtgactccgattctgacagc	CRISPR spacer
tgacagcgattcggattctgacagtgactcggattctgacagc	Protospacer
.*********** ***************** ************

685. spacer 6.11|5247050|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.93

cgacagcgattctgattctgacagtgactccgattctgacagc	CRISPR spacer
tgacagcgattctgactctgacagtgactcggattctgacagc	Protospacer
.**************.************** ************

686. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
.*****.***********.******

687. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

688. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
.*****.***********.******

689. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
.*****.***********.******

690. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattcggactcggacagc	Protospacer
.*********** ***** ******

691. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
.**************.**.******

692. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgactccgactccgacagc	Protospacer
.********.********.******

693. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagtgattcggactcggacagc	Protospacer
 *********** ***** ******

694. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattctgactctgacagc	Protospacer
 *****.*****.************

695. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattccgactctgacagt	Protospacer
 *****.*****************.

696. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattccgactctgacagt	Protospacer
 *****.*****************.

697. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgactccgacagt	Protospacer
.*****************.*****.

698. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattccgactccgacagc	Protospacer
 *****.***********.******

699. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
.**************.**.******

700. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
.**************.**.******

701. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
 *****.***** ************

702. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

703. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagtgattccgattccgacagc	Protospacer
 **************.**.******

704. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
 *****.***** ************

705. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgattcagacagc	Protospacer
.**************.** ******

706. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattcggactccgacagc	Protospacer
.*********** *****.******

707. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

708. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
.*****.***********.******

709. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactccgacagc	Protospacer
.*****.***********.******

710. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattccgactccgacagc	Protospacer
 *****.***********.******

711. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

712. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

713. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

714. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

715. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgactctgactctgacagc	Protospacer
.********.**.************

716. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattcggactctgacagt	Protospacer
******.***** ***********.

717. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
 *****.***** ************

718. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
cgacagcgattcggactctgacagt	Protospacer
******.***** ***********.

719. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
 *****.***** ************

720. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

721. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

722. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattccgactcagacagc	Protospacer
 *****.*********** ******

723. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgattcagacagc	Protospacer
.**************.** ******

724. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagtgattcggactcggacagc	Protospacer
 *********** ***** ******

725. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgattctgacagc	Protospacer
.*****.********.*********

726. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgattctgacagc	Protospacer
.*****.********.*********

727. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

728. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgactctgactctgacagc	Protospacer
.********.**.************

729. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

730. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgattcggacagc	Protospacer
.**************.** ******

731. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
.**************.**.******

732. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattcggactctgacagc	Protospacer
 *****.***** ************

733. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattccgattccgacagc	Protospacer
.**************.**.******

734. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

735. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattcggactctgacagt	Protospacer
.*********** ***********.

736. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.88

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagc	Protospacer
.*****.***** ************

737. spacer 6.15|5247320|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.93

tgacagcgattccgactccgatagtgattccgattctgacagc	CRISPR spacer
ggacagcgattccgactccgacagtgactccgattctgacagc	Protospacer
 ********************.*****.***************

738. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagtgattcggattcggacagt	Protospacer
 *****************.*****.

739. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagcgattcggattcggacagc	Protospacer
 *****.***********.******

740. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
.*********** *****.******

741. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattctgacagc	Protospacer
.*****.*********** ******

742. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgactcggattctgacagc	Protospacer
.********.******** ******

743. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattcggacagc	Protospacer
.*****.***********.******

744. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagtgattccgattccgacagc	Protospacer
 *********** ***** ******

745. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattccgacagc	Protospacer
.*****.*********** ******

746. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagcgattcggattcggacagc	Protospacer
 *****.***********.******

747. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattcggacagc	Protospacer
.*****.***********.******

748. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
.*********** *****.******

749. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattcggacagc	Protospacer
.*****.***********.******

750. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
.*********** *****.******

751. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattcggacagc	Protospacer
.*****.***********.******

752. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
.*********** *****.******

753. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattcggacagc	Protospacer
.*****.***********.******

754. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattccgattcggacagc	Protospacer
.*********** *****.******

755. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattccgattctgacagc	Protospacer
.*********** ***** ******

756. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattcggactccgacagt	Protospacer
***************.** *****.

757. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattccgattctgacagc	Protospacer
.*********** ***** ******

758. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattcggactccgacagt	Protospacer
***************.** *****.

759. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagtgattcggactcggacagc	Protospacer
 **************.**.******

760. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattccgattccgacagc	Protospacer
.*********** ***** ******

761. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattcggactccgacagt	Protospacer
***************.** *****.

762. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggactcggacagc	Protospacer
.**************.**.******

763. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggactcggacagc	Protospacer
.**************.**.******

764. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
.**************.** ******

765. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
agatagtgattccgattcagacagc	Protospacer
 **.******** ************

766. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

767. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

768. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

769. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

770. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

771. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

772. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

773. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

774. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

775. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

776. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

777. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

778. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

779. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

780. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcagactcagacagc	Protospacer
.***********.**.*********

781. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
agatagtgattcagattcagacagc	Protospacer
 **.********.************

782. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
agatagtgattccgattcagacagc	Protospacer
 **.******** ************

783. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
agatagtgattccgattcagacagc	Protospacer
 **.******** ************

784. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggattccgacagt	Protospacer
.***************** *****.

785. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattctgacagc	Protospacer
.*****.*********** ******

786. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagt	Protospacer
******.*********** *****.

787. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagcgattcggattctgacagc	Protospacer
 *****.*********** ******

788. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgactcggattccgacagc	Protospacer
.********.******** ******

789. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggactcggacagc	Protospacer
.**************.**.******

790. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
.**************.** ******

791. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattctgacagc	Protospacer
.*****.*********** ******

792. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagt	Protospacer
******.*********** *****.

793. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
.**************.** ******

794. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagcgattcggattctgacagc	Protospacer
 *****.*********** ******

795. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattctgacagt	Protospacer
******.*********** *****.

796. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattctgacagc	Protospacer
.*****.*********** ******

797. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggatgctgacagc	Protospacer
.*************** * ******

798. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagtgattcggactcggacagc	Protospacer
 **************.**.******

799. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattccgacagt	Protospacer
******.*********** *****.

800. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
.**************.** ******

801. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagcgattcggattccgacagt	Protospacer
******.*********** *****.

802. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
agatagtgattccgattcagacagc	Protospacer
 **.******** ************

803. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggactctgacagc	Protospacer
.**************.** ******

804. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.88

tgacagtgattcggattcagacagc	CRISPR spacer
tgacagtgattcggactctgacagt	Protospacer
***************.** *****.

805. spacer 5.3|5140913|32|NZ_CP018362|CRISPRCasFinder,CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 4, identity: 0.875

ctggacagccaatgcgacaggttatggcttta	CRISPR spacer
ctggacagctaatgcgacaggttgtggctatg	Protospacer
*********.*************.***** *.

806. spacer 6.1|5246426|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.907

agacagtgactccgactcggacagcgatgctgactctgacagt	CRISPR spacer
ggacagcgactccgactcggacagcgattctgactctgacagc	Protospacer
.*****.********************* *************.

807. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagcgattcggattcggacagtgactcc	Protospacer
 *****.********************.** 

808. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagcgactcggattcggacagtgattcc	Protospacer
 *****.**.******************** 

809. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagcgattcggattcggacagtgactcc	Protospacer
 *****.********************.** 

810. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagtgattcggactccgacagtgattcc	Protospacer
 **************.** *********** 

811. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagtgattcggactccgacagtgattcc	Protospacer
 **************.** *********** 

812. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagtgattccgattcggacagcgattcc	Protospacer
 *********** ***********.***** 

813. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagtgattcggattcggacagcgactcc	Protospacer
 ***********************.**.** 

814. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagtgattcggattcggacagcgactct	Protospacer
 ***********************.**.** 

815. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagcgattcggattctgacagtgattcc	Protospacer
 *****.*********** *********** 

816. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagcgattcggattccgacagtgattcc	Protospacer
 *****.*********** *********** 

817. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
cgacagtgattcggattcggacagcgactcc	Protospacer
 ***********************.**.** 

818. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.871

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgacagtgattcggactctgacagtgattcc	Protospacer
 **************.** *********** 

819. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggattctgacagcgactcggactctgacagc	Protospacer
 **************.************** ***********.

820. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactctgacagcgactccgattctgacagc	Protospacer
 *****************************.**.********.

821. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
ggacagcgattcggactctgacagcgactcggattctgacagc	Protospacer
.***************************** **.********.

822. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactctgacagcgattcggactctgacagc	Protospacer
 **************************.** ***********.

823. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactctgacagcgattccgactctgacagc	Protospacer
 **************************.**.***********.

824. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
cgacagtgattcggactctgacagtgactctgactctgacagc	Protospacer
 *****.*****************.*****************.

825. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
ggacagcgattcggactctgacagcgactcggattctgacagc	Protospacer
.***************************** **.********.

826. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
ggacagcgattcggactctgacagcgactcggattctgacagc	Protospacer
.***************************** **.********.

827. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactctgacagcgactcggattctgacagc	Protospacer
 ***************************** **.********.

828. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactctgacagcgactcggattctgacagc	Protospacer
 ***************************** **.********.

829. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactccgacagtgactctgactctgacagc	Protospacer
 *****************.*****.*****************.

830. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgactcggactctgacagcgactcggactctgacagc	Protospacer
 ********.******************** ***********.

831. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
cgacagcgactcggactctgacagcgactcggactctgacagc	Protospacer
 ********.******************** ***********.

832. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggactccgacagcgactcggactctgacagc	Protospacer
 *****************.*********** ***********.

833. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
cgacagcgattctgactctgacagcgactctgactccgacagc	Protospacer
 *********** ***********************.*****.

834. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggatgctgacagcgactctgactctgacagc	Protospacer
 **************. *************************.

835. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
cgacagcgactcggattctgacagcgactctgactctgacagc	Protospacer
 ********.*****.**************************.

836. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.907

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
tgacagcgattcggattctgacagcgactctgactcggacagc	Protospacer
 **************.******************** *****.

837. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattcggacagcgattcggattcg	Protospacer
 *****************.**************.** 

838. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattccgacagcgattcggattcg	Protospacer
 ***************** **************.** 

839. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactccgattctgacagcgattcggactcc	Protospacer
.*********** ***** *****************.

840. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattcggacagcgattccgactcc	Protospacer
 *****************.*********** *****.

841. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattcggacagcgattccgactcc	Protospacer
.*****************.*********** *****.

842. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattccgacagcgactcggactcc	Protospacer
.***************** ********.********.

843. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattcggacagcgactcggactcc	Protospacer
.*****************.********.********.

844. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattccgacagcgactcggactcc	Protospacer
.***************** ********.********.

845. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattccgacagcgactcggactcc	Protospacer
.***************** ********.********.

846. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattctgacagtgattcggactcc	Protospacer
 ***************** *****.***********.

847. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.892

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
agacagcgactccgattcagatagcgattcggactca	Protospacer
 *********** ********.************** 

848. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ***********.

849. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.*****.

850. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattctgactctgacagc	Protospacer
.********.********.*****.

851. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggactctgacagc	Protospacer
 *********** *****.*****.

852. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagtgactccgactccgacagc	Protospacer
.*****.*****.***********.

853. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.*****.

854. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagtgactctgactctgacagc	Protospacer
.*****.***********.*****.

855. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactccgactccgactct	Protospacer
 ***********.*********  *

856. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattctgactctgacagc	Protospacer
 ********.********.*****.

857. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactccgactcggacagc	Protospacer
 ***********.***** *****.

858. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ***********.

859. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ***********.

860. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
.********.**.***********.

861. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.********.

862. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
.********.**.***********.

863. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.********.

864. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattccgactccgacagc	Protospacer
 ********.**.***********.

865. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.*****.

866. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.********.

867. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.********.

868. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggactctgacagc	Protospacer
 *********** *****.*****.

869. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.********.

870. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggactctgacagc	Protospacer
 *********** *****.*****.

871. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ***********.

872. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ***********.

873. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ***********.

874. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagtgactcggactccgacagc	Protospacer
.*****.***** ***********.

875. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattccgactccgacagc	Protospacer
 ********.**.***********.

876. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.*****.

877. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.********.

878. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.********.

879. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.********.

880. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.********.

881. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.********.

882. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ***********.

883. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.********.

884. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.********.

885. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgattcggactccgacagc	Protospacer
 ********.** ***********.

886. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.********.

887. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.********.

888. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.*****.

889. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagtgactccgactccgacagc	Protospacer
.*****.*****.***********.

890. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactcggattccgacagc	Protospacer
 *********** **.********.

891. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcggactctgacagc	Protospacer
 *********** *****.*****.

892. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcggactcagacagc	Protospacer
 *********** ***** *****.

893. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagtgactcggactccgacagc	Protospacer
.*****.***** ***********.

894. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.********.

895. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ***********.

896. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattccgactccgacagc	Protospacer
.********.**.***********.

897. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggattccgacagc	Protospacer
.*********** **.********.

898. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgattcggactccgacagc	Protospacer
.********.** ***********.

899. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagtgactctgactctgacagc	Protospacer
.*****.***********.*****.

900. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactccgattccgacagc	Protospacer
 ***********.**.********.

901. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactcggactctgacagc	Protospacer
.*********** *****.*****.

902. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

903. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

904. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

905. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

906. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

907. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

908. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

909. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

910. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

911. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

912. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

913. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactctgattcagacagc	Protospacer
.**************.** *****.

914. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattctgacagc	Protospacer
 **************.**.*****.

915. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

916. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

917. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

918. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

919. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

920. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

921. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

922. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

923. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

924. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

925. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactctgattcagacagc	Protospacer
.**************.** *****.

926. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattctgacagc	Protospacer
 **************.**.*****.

927. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

928. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

929. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

930. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

931. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

932. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

933. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgatagcgactctgactcagacagc	Protospacer
.**.************** *****.

934. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactctgattcagacagc	Protospacer
 **************.** *****.

935. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
cgacagcgactctgattcagacagc	Protospacer
.**************.** *****.

936. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

937. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

938. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

939. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

940. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

941. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

942. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

943. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

944. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

945. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagt	CRISPR spacer
agacagcgactcagactcagacagc	Protospacer
 *********** ***** *****.

946. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
 **.******** ***********.

947. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactctgacagt	Protospacer
 **.**************.*****.

948. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
 **.**************.*****.

949. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
 **.*****.**************.

950. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggactctgacagt	Protospacer
 **.**************.*****.

951. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
 **.**************.*****.

952. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
 **.*****.**************.

953. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
 **.**************.*****.

954. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
 **.*****.**************.

955. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagtgattcggactccgacagt	Protospacer
 **.**.*****************.

956. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
 **.*****.**************.

957. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagtgattcggactccgacagt	Protospacer
 **.**.*****************.

958. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgactcggactccgacagt	Protospacer
 **.*****.**************.

959. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
 **.*****.**************.

960. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagtgattcggactccgacagt	Protospacer
 **.**.*****************.

961. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
 **.******** ***********.

962. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
 **.******** ***********.

963. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
 **.**************.*****.

964. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
 **.*****.**************.

965. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
 **.*****.**************.

966. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
 **.**************.*****.

967. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggattccgacagt	Protospacer
 **.***********.********.

968. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgactcggactccgacagt	Protospacer
 **.*****.**************.

969. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggattccgacagt	Protospacer
 **.***********.********.

970. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
cgacagcgattcggattccgacagt	Protospacer
 **.***********.********.

971. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
tgacagcgattcggattccgacagt	Protospacer
 **.***********.********.

972. spacer 6.8|5246894|25|NZ_CP018362|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

ggatagcgattcggactccgacagc	CRISPR spacer
gggctccgattcggactccgacagc	Protospacer
**..  *******************

973. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactccgactccgactcc	Protospacer
 ***********.*********  *

974. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattcggactccgacagt	Protospacer
 ********.** ***********.

975. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactccgactctgacagt	Protospacer
 ***********.*****.*****.

976. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.*****.

977. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.*****.

978. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
tgacagcgactctgactctgactct	Protospacer
******************.***  .

979. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.*****.

980. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattcggactccgacagt	Protospacer
.********.** ***********.

981. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgattccgactccgacagt	Protospacer
 ********.**.***********.

982. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggattccgacagt	Protospacer
.*********** **.********.

983. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.*****.

984. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgattctgacgccgacagt	Protospacer
.********.****** *******.

985. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggattccgacagt	Protospacer
 *********** **.********.

986. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
cgacagcgactcggactctgacagt	Protospacer
.*********** *****.*****.

987. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactcggactctgacagt	Protospacer
 *********** *****.*****.

988. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattcggactctgacagt	Protospacer
 *****.***** ***********.

989. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
.*****.***** ***********.

990. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattctgactctgacagt	Protospacer
.*****.*****.***********.

991. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgactccgactctgacagt	Protospacer
 *****.**.**************.

992. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagtgattcggactccgacagt	Protospacer
 *********** *****.*****.

993. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagtgactccgattctgacagt	Protospacer
 ********.*****.********.

994. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattcggactctgacagt	Protospacer
 *****.***** ***********.

995. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
ggacagcgattccgactccgacagt	Protospacer
 *****.***********.*****.

996. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgattctgacagt	Protospacer
.*****.********.********.

997. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
.*****.***********.*****.

998. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
.*****.***** ***********.

999. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
.*****.***** ***********.

1000. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
.*****.***** ***********.

1001. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattcggactccgacagt	Protospacer
.*********** *****.*****.

1002. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattcggactccgacagt	Protospacer
.*********** *****.*****.

1003. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgattctgacagt	Protospacer
.*****.********.********.

1004. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattcggattctgacagt	Protospacer
.*********** **.********.

1005. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgattcggactccgacagt	Protospacer
.*********** *****.*****.

1006. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
.*****.***********.*****.

1007. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactccgacagt	Protospacer
.*****.***********.*****.

1008. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgactctgactctgacagt	Protospacer
.********.**.***********.

1009. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattcggactctgacagt	Protospacer
.*****.***** ***********.

1010. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgactcggactctgacagt	Protospacer
.********.** ***********.

1011. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgactcggactctgacagt	Protospacer
.********.** ***********.

1012. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagtgactccgattctgacagt	Protospacer
.********.*****.********.

1013. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 *********** ***** *****.

1014. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 *********** ***** *****.

1015. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 *********** ***** *****.

1016. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 *********** ***** *****.

1017. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.84

cgacagtgattccgactctgacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 *********** ***** *****.

1018. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattcggacagt	Protospacer
.*****.***********.*****.

1019. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagtgattcggactccgacagt	Protospacer
 **************.** *****.

1020. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagcgattcggattctgacagt	Protospacer
 *****.*********** *****.

1021. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattcggacagt	Protospacer
.*****.***********.*****.

1022. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattctgacagt	Protospacer
.*****.*********** *****.

1023. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgattcggactctgacagt	Protospacer
.**************.** *****.

1024. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattctgacagt	Protospacer
.*****.*********** *****.

1025. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagtgactcggattcggacagt	Protospacer
 ********.********.*****.

1026. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagtgactcggattcggacagt	Protospacer
 ********.********.*****.

1027. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattctgacagt	Protospacer
.*****.*********** *****.

1028. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 ***********.**.********.

1029. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 ***********.**.********.

1030. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 ***********.**.********.

1031. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 ***********.**.********.

1032. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagcgattcggattccgacagt	Protospacer
 *****.*********** *****.

1033. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattccgacagt	Protospacer
.*****.*********** *****.

1034. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattctgacagt	Protospacer
.*****.*********** *****.

1035. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagtgactcggattcggacagt	Protospacer
.********.********.*****.

1036. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
cgacagcgattcggattccgacagt	Protospacer
.*****.*********** *****.

1037. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
ggacagcgattcggattccgacagt	Protospacer
 *****.*********** *****.

1038. spacer 6.16|5247392|25|NZ_CP018362|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.84

tgacagtgattcggattcagacagc	CRISPR spacer
agacagtgattcagactcagacagt	Protospacer
 ***********.**.********.

1039. spacer 6.2|5246498|31|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

ggacagtgattcggattcggacagtgattcg	CRISPR spacer
tgactccgattcggattctgacagtgattcg	Protospacer
 ***  .*********** ************

1040. spacer 6.3|5246558|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.884

agacagcgattcggactctgacagcgactctgactctgacagt	CRISPR spacer
ggatagcgattcggattctgacagcgactctgactctgactct	Protospacer
.**.***********.************************  *

1041. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.865

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggatgctgacagcgattcggatgct	Protospacer
 *************** * **************. **

1042. spacer 6.5|5246696|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.884

tgacagtgactccgattccgacagcgattctgattctgacagt	CRISPR spacer
tgacagtgactccgactccgacagcgattcggattctgactcc	Protospacer
***************.************** *********  .

1043. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.8

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactctgactccgattcg	Protospacer
 ********************.   

1044. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.8

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactccgactccgactcc	Protospacer
 ***********.*********  .

1045. spacer 6.7|5246840|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.8

tgacagcgactctgactccgacagt	CRISPR spacer
ggacagcgactccgactccgactcg	Protospacer
 ***********.*********   

1046. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.8

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactctgactccgattcg	Protospacer
 ********************.   

1047. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.8

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactccgactccgactcg	Protospacer
 ***********.*********   

1048. spacer 6.9|5246948|25|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.8

tgacagcgactctgactccgacagc	CRISPR spacer
ggacagcgactccgactccgactct	Protospacer
 ***********.*********  .

1049. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.8

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactctgactcg	Protospacer
.*****.***************   

1050. spacer 6.14|5247266|25|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.8

cgacagtgattccgactctgacagc	CRISPR spacer
tgacagcgattccgactctgactcg	Protospacer
.*****.***************   

1051. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.838

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactcggattctgacagcgattcggatagc	Protospacer
.***************** **************.  .

1052. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.838

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggattctgacagcgattcggatagc	Protospacer
 ***************** **************.  .

1053. spacer 6.13|5247194|43|NZ_CP018362|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.86

cgacagtgattcggattcggacagcgattcggactcggatagc	CRISPR spacer
cgacagtgattcggattcggacagcgattccgacagcgacagt	Protospacer
****************************** ***   **.**.

1054. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.811

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
ggacagcgactcggactctgacagcgattcggatagc	Protospacer
 **************.** **************.  .

1055. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactctgattcagacagcgatagcgattca	Protospacer
.*********** ***************   **.** 

1056. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagacagcgacagcgattca	Protospacer
************ **************.   **.** 

1057. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactctgattcagacagcgatagcgattca	Protospacer
.*********** ***************   **.** 

1058. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagacagcgacagcgattca	Protospacer
************ **************.   **.** 

1059. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
agacagcgactctgattcagacagcgatagcgattca	Protospacer
 *********** ***************   **.** 

1060. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgatagcgactctgattcagacagcgatagcgattca	Protospacer
***.******** ***************   **.** 

1061. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.811

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgatagcgactctgattcagacagcgatagcgattca	Protospacer
***.******** ***************   **.** 

1062. spacer 6.6|5246768|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.837

tgacagcgactcggattctgacagtgactcggattctgatagt	CRISPR spacer
tgacagcgactcggattctgacagcgattcggatagcgacagc	Protospacer
************************.**.******  .**.**.

1063. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
agacagcgactctgattcagacagcgacagcgattca	Protospacer
 *********** **************.   **.** 

1064. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagcgattca	Protospacer
************ ********.*****.   **.** 

1065. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagcgattca	Protospacer
************ ********.*****.   **.** 

1066. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagcgattca	Protospacer
************ ********.*****.   **.** 

1067. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagtgattca	Protospacer
************ ********.*****.   **.** 

1068. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactctgattctgacagcgatagcgattca	Protospacer
.*********** ***** *********   **.** 

1069. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagcgattca	Protospacer
************ ********.*****.   **.** 

1070. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
agatagcgactctgattcagacagcgatagcgattca	Protospacer
 **.******** ***************   **.** 

1071. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagtgattca	Protospacer
************ ********.*****.   **.** 

1072. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
agacagcgactctgattctgacagcgatagcgattca	Protospacer
 *********** ***** *********   **.** 

1073. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagtgattca	Protospacer
************ ********.*****.   **.** 

1074. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactctgattctgacagcgatagcgattca	Protospacer
.*********** ***** *********   **.** 

1075. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagcgattca	Protospacer
************ ********.*****.   **.** 

1076. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagtgattca	Protospacer
************ ********.*****.   **.** 

1077. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagtgattca	Protospacer
************ ********.*****.   **.** 

1078. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagcgattca	Protospacer
************ ********.*****.   **.** 

1079. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
agacagcgactctgattctgacagcgatagcgattca	Protospacer
 *********** ***** *********   **.** 

1080. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagcgattca	Protospacer
************ ********.*****.   **.** 

1081. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagtgattca	Protospacer
************ ********.*****.   **.** 

1082. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
tgacagcgactctgattctgacagcgatagcgattca	Protospacer
.*********** ***** *********   **.** 

1083. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagcgattca	Protospacer
************ ********.*****.   **.** 

1084. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
cgacagcgactctgattcagatagcgacagtgattca	Protospacer
************ ********.*****.   **.** 

1085. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
agatagcgactctgattcagacagcgatagcgattca	Protospacer
 **.******** ***************   **.** 

1086. spacer 6.6|5246768|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.814

tgacagcgactcggattctgacagtgactcggattctgatagt	CRISPR spacer
ggacagcgactcggattctgacagcgattcggatagcgacagc	Protospacer
 ***********************.**.******  .**.**.

1087. spacer 6.13|5247194|43|NZ_CP018362|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.814

cgacagtgattcggattcggacagcgattcggactcggatagc	CRISPR spacer
tgacagtgactctgattcggacagcgattcggatagcgacagc	Protospacer
.********.** ********************.   **.***

1088. spacer 6.4|5246630|37|NZ_CP018362|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.757

cgacagcgactcggattcagacagcgattcggactct	CRISPR spacer
agacagcgactctgattcagatagcgacagcgattca	Protospacer
 *********** ********.*****.   **.** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 144274 : 176971 39 Erwinia_phage(30.77%) head,plate,terminase,transposase NA
DBSCAN-SWA_2 430626 : 493327 67 Vibrio_phage(61.11%) plate,tail,head,protease,transposase NA
DBSCAN-SWA_3 634001 : 684629 42 Escherichia_phage(50.0%) integrase,plate,transposase attL 627822:627838|attR 651699:651715
DBSCAN-SWA_4 1005500 : 1069669 71 uncultured_Caudovirales_phage(29.41%) holin,terminase,integrase,tail,tRNA,head,transposase attL 1007391:1007408|attR 1073001:1073018
DBSCAN-SWA_5 1277245 : 1285640 8 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_6 1398349 : 1470616 53 Pseudomonas_phage(14.29%) plate,protease,transposase NA
DBSCAN-SWA_7 1806581 : 1812414 8 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_8 2580672 : 2663712 82 uncultured_Caudovirales_phage(55.0%) terminase,integrase,capsid,tail,tRNA,portal,head,protease,transposase attL 2627218:2627235|attR 2643434:2643451
DBSCAN-SWA_9 5188529 : 5267063 55 Escherichia_phage(16.67%) tRNA,protease,transposase NA
DBSCAN-SWA_10 5729200 : 5769506 58 Salmonella_phage(33.33%) holin,plate,terminase,integrase,transposase attL 5728583:5728597|attR 5733390:5733404
DBSCAN-SWA_11 5777263 : 5837226 51 Escherichia_phage(30.0%) plate,tRNA,protease,transposase NA
DBSCAN-SWA_12 5844447 : 5930133 92 Vibrio_phage(45.1%) holin,plate,tail,head,protease,transposase NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP018362.1|WP_076752319.1|1032121_1032406_-|hypothetical-protein 1032121_1032406_- 94 aa aa NA NA NA 1005500-1069669 yes
NZ_CP018362.1|WP_187420816.1|1032406_1033468_-|hypothetical-protein 1032406_1033468_- 353 aa aa NA NA NA 1005500-1069669 yes
2. NZ_CP018360
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 110699 114 Salmonella_phage(83.75%) integrase,transposase,capsid,terminase,tail,portal attL 30045:30065|attR 52523:52543
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP018361
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 12586 10 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_2 15959 : 68821 55 Bacillus_phage(10.53%) transposase NA
DBSCAN-SWA_3 74416 : 199877 105 uncultured_Caudovirales_phage(20.93%) integrase,transposase attL 66904:66963|attR 169614:170979
DBSCAN-SWA_4 224762 : 225731 1 Salmonella_phage(100.0%) transposase NA
DBSCAN-SWA_5 233513 : 234347 1 Faecalibacterium_phage(100.0%) NA NA
DBSCAN-SWA_6 241669 : 242383 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_7 245848 : 251740 6 uncultured_Caudovirales_phage(75.0%) transposase NA
DBSCAN-SWA_8 255817 : 268233 13 Macacine_betaherpesvirus(37.5%) integrase attL 248571:248584|attR 271961:271974
DBSCAN-SWA_9 275778 : 277179 1 Bacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage