1. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP021031 (Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
2. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
3. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
4. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
5. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
6. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
7. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
8. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NC_021911 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1f, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
9. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
10. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
11. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
12. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
13. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
14. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
15. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
16. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
17. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 10, identity: 0.706
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
ggcgtcaatctcatcggcatcaacagcttctggc Protospacer
* * *****.*************** ** .
18. spacer 2.5|1619947|40|NZ_CP019352|CRISPRCasFinder matches to NZ_AP019836 (Leptotrichia wadei strain JMUB3934 plasmid pJMUB3934p1, complete sequence) position: , mismatch: 10, identity: 0.75
tgttgtaaaattatttgctacaattttatttttagaagaa CRISPR spacer
tgttgtaaaattatttgcaacaattatacctgatgaaact Protospacer
****************** ****** **..* ***.
19. spacer 3.1|1932769|31|NZ_CP019352|PILER-CR matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 10, identity: 0.677
gaggtgttaccataacagttcttttaacctc CRISPR spacer
tcatatttacaattacagttcttttaaccgt Protospacer
. **** ** *************** .
20. spacer 3.1|1932769|31|NZ_CP019352|PILER-CR matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 10, identity: 0.677
gaggtgttaccataacagttcttttaacctc CRISPR spacer
tcatatttacaattacagttcttttaaccgt Protospacer
. **** ** *************** .
21. spacer 3.1|1932769|31|NZ_CP019352|PILER-CR matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 10, identity: 0.677
gaggtgttaccataacagttcttttaacctc CRISPR spacer
tcatatttacaattacagttcttttaaccgt Protospacer
. **** ** *************** .
22. spacer 3.1|1932769|31|NZ_CP019352|PILER-CR matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 10, identity: 0.677
gaggtgttaccataacagttcttttaacctc CRISPR spacer
tcatatttacaattacagttcttttaaccgt Protospacer
. **** ** *************** .
23. spacer 3.1|1932769|31|NZ_CP019352|PILER-CR matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 10, identity: 0.677
gaggtgttaccataacagttcttttaacctc CRISPR spacer
tcatatttacaattacagttcttttaaccgt Protospacer
. **** ** *************** .
24. spacer 3.1|1932769|31|NZ_CP019352|PILER-CR matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 10, identity: 0.677
gaggtgttaccataacagttcttttaacctc CRISPR spacer
tcatatttacaattacagttcttttaaccgt Protospacer
. **** ** *************** .
25. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NC_016794 (Bacillus cereus F837/76 plasmid pF837_55, complete sequence) position: , mismatch: 11, identity: 0.676
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
cgcttcaatttcatcggcttcaatattatgagag Protospacer
**************** ****.**. .*. .
26. spacer 2.4|1619890|34|NZ_CP019352|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 11, identity: 0.676
gccttcaatttcatcggcatcaacatctaaaaca CRISPR spacer
accttcaatatcaacggcatcaacaggcggctcg Protospacer
.******** *** *********** ... *.