Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017050 Burkholderia pseudomallei strain MSHR4083 chromosome 1, complete sequence 2 crisprs WYL,cas3,DEDDh,csa3,DinG 0 0 272 0
NZ_CP017051 Burkholderia pseudomallei strain MSHR4083 chromosome 2, complete sequence 3 crisprs cas3,csa3,DinG 1 0 5 0

Results visualization

1. NZ_CP017050
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017050_1 209028-209169 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017050_2 1494100-1494179 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 25552 20 Ralstonia_phage(100.0%) coat NA
DBSCAN-SWA_2 36378 : 39186 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_3 50587 : 56182 3 uncultured_phage(50.0%) NA NA
DBSCAN-SWA_4 91080 : 99854 10 Ralstonia_virus(50.0%) integrase attL 83022:83037|attR 94666:94681
DBSCAN-SWA_5 114059 : 125478 10 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_6 132224 : 133370 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_7 137655 : 144951 7 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_8 163593 : 163995 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_9 175660 : 177577 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_10 183280 : 184645 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_11 193969 : 194998 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_12 211931 : 218437 2 Virus_Rctr197k(50.0%) NA NA
DBSCAN-SWA_13 229751 : 230522 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_14 265120 : 266395 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_15 296300 : 296891 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_16 322727 : 336616 15 Micromonas_sp._RCC1109_virus(40.0%) NA NA
DBSCAN-SWA_17 340555 : 344486 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_18 351207 : 357138 4 Hokovirus(50.0%) NA NA
DBSCAN-SWA_19 371257 : 383374 18 Pseudomonas_phage(28.57%) capsid,portal,integrase,terminase attL 365049:365067|attR 378658:378676
DBSCAN-SWA_20 401032 : 401797 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_21 408439 : 418213 5 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_22 422254 : 427858 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_23 443216 : 444170 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_24 449334 : 451233 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_25 457554 : 462586 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_26 469617 : 476129 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_27 491488 : 500812 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_28 511738 : 512341 1 Ochrobactrum_phage(100.0%) NA NA
DBSCAN-SWA_29 515810 : 517151 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_30 521095 : 521821 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_31 526455 : 535571 8 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_32 547150 : 548614 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_33 562102 : 562672 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_34 566045 : 568223 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_35 579941 : 580565 1 Vibrio_virus(100.0%) NA NA
DBSCAN-SWA_36 590212 : 594177 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_37 603263 : 611522 7 Mycoplasma_phage(33.33%) transposase NA
DBSCAN-SWA_38 628312 : 632611 5 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_39 647099 : 654111 6 Prochlorococcus_phage(25.0%) tRNA NA
DBSCAN-SWA_40 657438 : 668395 10 Agrobacterium_phage(16.67%) protease NA
DBSCAN-SWA_41 671827 : 672673 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_42 687220 : 689378 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_43 698165 : 699095 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_44 702522 : 715880 12 Catovirus(16.67%) tRNA NA
DBSCAN-SWA_45 739987 : 741859 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_46 750314 : 754084 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_47 757407 : 764110 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_48 768558 : 771824 3 uncultured_Mediterranean_phage(50.0%) protease NA
DBSCAN-SWA_49 777041 : 780799 4 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_50 798772 : 799486 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_51 803793 : 807391 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_52 825107 : 826916 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_53 856435 : 857743 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_54 864073 : 870622 4 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_55 879036 : 880494 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_56 884238 : 885018 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_57 889394 : 890111 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_58 894215 : 895748 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_59 898838 : 899561 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_60 904934 : 905999 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_61 927356 : 929228 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_62 941069 : 946631 5 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_63 956204 : 957029 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_64 967454 : 968918 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_65 990524 : 992117 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_66 1001690 : 1005770 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_67 1032868 : 1034028 1 Burkholderia_virus(100.0%) transposase NA
DBSCAN-SWA_68 1037857 : 1053282 14 Burkholderia_virus(14.29%) NA NA
DBSCAN-SWA_69 1057392 : 1058286 1 Thermobifida_phage(100.0%) NA NA
DBSCAN-SWA_70 1064915 : 1069528 6 uncultured_Mediterranean_phage(66.67%) tRNA NA
DBSCAN-SWA_71 1084056 : 1087225 3 uncultured_Caudovirales_phage(33.33%) transposase NA
DBSCAN-SWA_72 1092263 : 1099918 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_73 1105004 : 1106771 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_74 1112937 : 1114506 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_75 1120359 : 1124492 4 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_76 1128121 : 1141085 10 Streptomyces_phage(25.0%) transposase NA
DBSCAN-SWA_77 1148272 : 1149880 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_78 1155044 : 1157611 4 Red_sea_bream_iridovirus(50.0%) NA NA
DBSCAN-SWA_79 1161864 : 1163637 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_80 1198957 : 1200271 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_81 1204953 : 1205796 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_82 1212910 : 1213396 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_83 1222211 : 1223291 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_84 1234915 : 1236562 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_85 1242074 : 1242752 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_86 1246655 : 1247840 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_87 1285692 : 1286628 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_88 1296841 : 1299912 2 Burkholderia_virus(50.0%) transposase NA
DBSCAN-SWA_89 1306985 : 1311798 3 Escherichia_phage(33.33%) tRNA NA
DBSCAN-SWA_90 1322140 : 1332438 8 uncultured_virus(33.33%) transposase NA
DBSCAN-SWA_91 1348740 : 1350048 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_92 1366602 : 1371588 4 Sinorhizobium_phage(50.0%) NA NA
DBSCAN-SWA_93 1379614 : 1381620 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_94 1385812 : 1387105 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_95 1409586 : 1411230 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_96 1423375 : 1491630 61 Streptococcus_phage(11.11%) transposase,tRNA,portal,protease NA
DBSCAN-SWA_97 1495943 : 1501215 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_98 1510069 : 1513952 5 Aeromonas_phage(50.0%) integrase attL 1504247:1504263|attR 1523754:1523770
DBSCAN-SWA_99 1518120 : 1525058 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_100 1545533 : 1548086 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_101 1554306 : 1556133 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_102 1559252 : 1564338 2 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_103 1569276 : 1570074 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_104 1598479 : 1601005 3 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_105 1619421 : 1622386 2 Catovirus(50.0%) holin NA
DBSCAN-SWA_106 1630895 : 1638014 6 Cedratvirus(25.0%) tRNA NA
DBSCAN-SWA_107 1647232 : 1650641 2 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_108 1662326 : 1663874 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_109 1671475 : 1673977 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_110 1693156 : 1696084 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_111 1703161 : 1718311 14 Shigella_phage(18.18%) integrase attL 1700574:1700591|attR 1717160:1717177
DBSCAN-SWA_112 1732094 : 1733243 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_113 1752361 : 1754377 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_114 1757477 : 1757873 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_115 1768982 : 1770404 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_116 1782482 : 1785016 3 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_117 1790121 : 1794488 6 Leptospira_phage(50.0%) transposase,integrase NA
DBSCAN-SWA_118 1799251 : 1802011 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_119 1806009 : 1808459 2 Gordonia_phage(50.0%) integrase attL 1794004:1794017|attR 1812992:1813005
DBSCAN-SWA_120 1823162 : 1824383 1 Burkholderia_phage(100.0%) transposase NA
DBSCAN-SWA_121 1827469 : 1828156 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_122 1853027 : 1854218 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_123 1858207 : 1874628 8 Cafeteria_roenbergensis_virus(16.67%) transposase NA
DBSCAN-SWA_124 1915748 : 1917636 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_125 1934370 : 1935189 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_126 1938868 : 1939795 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_127 1944422 : 1945493 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_128 1951765 : 1954087 2 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_129 1958633 : 1985195 29 Burkholderia_phage(44.44%) integrase,tail,protease,plate attL 1959206:1959252|attR 1974683:1974729
DBSCAN-SWA_130 1988210 : 1990880 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_131 2002018 : 2004280 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_132 2007803 : 2009960 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_133 2021466 : 2021670 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_134 2027096 : 2035543 8 Pseudomonas_phage(33.33%) tRNA NA
DBSCAN-SWA_135 2041949 : 2043413 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_136 2051328 : 2056805 6 Acinetobacter_phage(60.0%) NA NA
DBSCAN-SWA_137 2073696 : 2077585 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_138 2097874 : 2098381 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_139 2113662 : 2114760 1 Burkholderia_phage(100.0%) integrase attL 2108200:2108215|attR 2115214:2115229
DBSCAN-SWA_140 2130756 : 2135080 5 Indivirus(50.0%) NA NA
DBSCAN-SWA_141 2139356 : 2139908 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_142 2143751 : 2148318 3 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_143 2169460 : 2172965 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_144 2177255 : 2177756 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_145 2184425 : 2184842 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_146 2192249 : 2193185 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_147 2201637 : 2207367 4 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_148 2214361 : 2215750 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_149 2222990 : 2227559 5 uncultured_virus(50.0%) transposase NA
DBSCAN-SWA_150 2236269 : 2236638 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_151 2245561 : 2249929 4 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_152 2276873 : 2281869 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_153 2286194 : 2287154 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_154 2290296 : 2290785 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_155 2299094 : 2302973 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_156 2311081 : 2320296 8 Pandoravirus(25.0%) transposase,protease NA
DBSCAN-SWA_157 2334955 : 2350755 13 Hokovirus(12.5%) tRNA NA
DBSCAN-SWA_158 2353973 : 2355401 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_159 2362725 : 2363382 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_160 2369976 : 2374167 5 Synechococcus_phage(60.0%) NA NA
DBSCAN-SWA_161 2405381 : 2408952 4 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_162 2417488 : 2418736 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_163 2440861 : 2441866 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_164 2448945 : 2458224 6 Acinetobacter_phage(75.0%) NA NA
DBSCAN-SWA_165 2470752 : 2472195 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_166 2484893 : 2485901 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_167 2490269 : 2492251 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_168 2497108 : 2498140 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_169 2501736 : 2514282 11 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_170 2520603 : 2521626 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_171 2525152 : 2526571 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_172 2536082 : 2537643 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_173 2550230 : 2554535 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_174 2565327 : 2567065 2 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_175 2570481 : 2578869 9 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_176 2583677 : 2585147 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_177 2588895 : 2599439 9 Bacillus_virus(40.0%) tRNA NA
DBSCAN-SWA_178 2610900 : 2611110 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_179 2615509 : 2618893 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_180 2622541 : 2624036 2 Lake_Baikal_phage(50.0%) NA NA
DBSCAN-SWA_181 2633222 : 2634239 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_182 2646957 : 2647980 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_183 2652952 : 2656481 2 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_184 2669849 : 2674403 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_185 2680593 : 2692933 12 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_186 2712258 : 2712864 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_187 2716006 : 2718101 2 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_188 2723950 : 2724922 1 Yersinia_phage(100.0%) NA NA
DBSCAN-SWA_189 2737933 : 2742500 3 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_190 2761274 : 2845990 88 Burkholderia_virus(27.78%) head,portal,protease,tail,holin,integrase,terminase attL 2773298:2773315|attR 2796088:2796105
DBSCAN-SWA_191 2858882 : 2859677 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_192 2879161 : 2880403 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_193 2886108 : 2888031 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_194 2897334 : 2899086 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_195 2907287 : 2908748 1 Bandra_megavirus(100.0%) NA NA
DBSCAN-SWA_196 2914870 : 2916394 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_197 2938467 : 2943689 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_198 2957736 : 2959290 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_199 2968112 : 2971799 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_200 2980310 : 2982080 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_201 2991046 : 3089005 108 uncultured_Caudovirales_phage(21.28%) capsid,head,portal,tRNA,protease,tail,integrase,plate,terminase attL 3005396:3005414|attR 3063577:3063595
DBSCAN-SWA_202 3096348 : 3099495 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_203 3103721 : 3105560 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_204 3108717 : 3117657 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_205 3122152 : 3127329 5 Yellowstone_lake_phycodnavirus(33.33%) NA NA
DBSCAN-SWA_206 3130577 : 3131642 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_207 3148346 : 3152045 3 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_208 3164747 : 3166289 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_209 3176658 : 3179224 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_210 3192327 : 3194933 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_211 3204306 : 3205089 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_212 3215197 : 3215842 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_213 3221967 : 3226580 4 Hokovirus(50.0%) NA NA
DBSCAN-SWA_214 3232167 : 3236035 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_215 3240662 : 3241259 1 Pandoravirus(100.0%) tRNA NA
DBSCAN-SWA_216 3276416 : 3277142 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_217 3282157 : 3290350 12 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_218 3299283 : 3303982 3 Agrobacterium_phage(33.33%) protease NA
DBSCAN-SWA_219 3311471 : 3312188 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_220 3317463 : 3325961 7 Burkholderia_phage(66.67%) NA NA
DBSCAN-SWA_221 3330106 : 3330745 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_222 3335553 : 3341048 6 Acanthamoeba_polyphaga_lentillevirus(33.33%) NA NA
DBSCAN-SWA_223 3346202 : 3347381 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_224 3355687 : 3357463 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_225 3363853 : 3370345 5 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_226 3374293 : 3375301 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_227 3388279 : 3390877 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_228 3402171 : 3416555 14 Streptomyces_phage(14.29%) NA NA
DBSCAN-SWA_229 3430720 : 3434850 4 Powai_lake_megavirus(50.0%) NA NA
DBSCAN-SWA_230 3438682 : 3440941 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_231 3459334 : 3460030 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_232 3463107 : 3464700 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_233 3472949 : 3475036 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_234 3487022 : 3490193 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_235 3500290 : 3501268 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_236 3524781 : 3525696 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_237 3530865 : 3534389 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_238 3561983 : 3565232 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_239 3570177 : 3575226 5 Burkholderia_virus(66.67%) transposase NA
DBSCAN-SWA_240 3582099 : 3583191 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_241 3602836 : 3605128 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_242 3612953 : 3613559 1 Freshwater_phage(100.0%) NA NA
DBSCAN-SWA_243 3621585 : 3623155 2 Leptospira_phage(50.0%) transposase NA
DBSCAN-SWA_244 3632885 : 3653510 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_245 3666671 : 3667664 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_246 3676358 : 3678101 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_247 3683132 : 3687355 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_248 3714001 : 3715363 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_249 3735037 : 3752494 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_250 3757874 : 3758765 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_251 3766595 : 3768203 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_252 3773549 : 3775310 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_253 3783726 : 3790648 4 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_254 3806223 : 3827012 15 Bacillus_virus(28.57%) NA NA
DBSCAN-SWA_255 3830422 : 3834274 5 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_256 3844136 : 3848430 5 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_257 3852850 : 3853189 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_258 3862910 : 3869945 5 Rhizobium_phage(33.33%) NA NA
DBSCAN-SWA_259 3880271 : 3882044 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_260 3906343 : 3907774 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_261 3912503 : 3915558 2 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_262 3924473 : 3927401 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_263 3931458 : 3934137 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_264 3942601 : 3943786 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_265 3946989 : 3954412 7 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_266 3973712 : 3974822 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_267 3982358 : 3983330 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_268 3990232 : 4001068 6 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_269 4013184 : 4013985 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_270 4019831 : 4022917 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_271 4028075 : 4029623 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_272 4033273 : 4041063 5 Klosneuvirus(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP017051
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017051_1 28346-28510 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017051_2 1615862-1616024 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017051_3 1809862-1809947 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP017051_2 2.2|1615977|21|NZ_CP017051|CRISPRCasFinder 1615977-1615997 21 NZ_CP017051.1 1616009-1616029 0 1.0
NZ_CP017051_2 2.2|1615977|21|NZ_CP017051|CRISPRCasFinder 1615977-1615997 21 NZ_CP017051.1 1616017-1616037 0 1.0

1. spacer 2.2|1615977|21|NZ_CP017051|CRISPRCasFinder matches to position: 1616009-1616029, mismatch: 0, identity: 1.0

gacagcacgacagcacgacag	CRISPR spacer
gacagcacgacagcacgacag	Protospacer
*********************

2. spacer 2.2|1615977|21|NZ_CP017051|CRISPRCasFinder matches to position: 1616017-1616037, mismatch: 0, identity: 1.0

gacagcacgacagcacgacag	CRISPR spacer
gacagcacgacagcacgacag	Protospacer
*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66456 : 73217 8 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_2 1017704 : 1108473 52 Leptospira_phage(25.0%) transposase NA
DBSCAN-SWA_3 1509835 : 1581142 45 Planktothrix_phage(15.38%) plate,integrase,transposase attL 1504463:1504482|attR 1584741:1584760
DBSCAN-SWA_4 2479137 : 2488463 11 Burkholderia_virus(57.14%) integrase,transposase attL 2474067:2474083|attR 2500270:2500286
DBSCAN-SWA_5 2641147 : 2712663 53 Vibrio_phage(25.0%) plate,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage