Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019668 Burkholderia cenocepacia strain VC7848 chromosome, complete genome 1 crisprs DinG,cas3,RT,csa3,PD-DExK,Cas14u_CAS-V,cas14j,WYL,DEDDh,c2c9_V-U4 0 1 4 0

Results visualization

1. NZ_CP019668
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019668_1 2384222-2384341 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019668_1 1.1|2384259|46|NZ_CP019668|CRISPRCasFinder 2384259-2384304 46 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 450547-450592 5 0.891

1. spacer 1.1|2384259|46|NZ_CP019668|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.891

ccccgcggggggcagcgaacgcagtgagcgtgggggtcgttttcct	CRISPR spacer
cccctcggggggcagcgaacgcagtgagcgtgggggttgtttcatt	Protospacer
**** ********************************.****. .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3874276 : 3887385 11 Bodo_saltans_virus(12.5%) NA NA
DBSCAN-SWA_2 6353142 : 6390464 51 Burkholderia_phage(95.83%) portal,plate,terminase,capsid,holin,head,tail,integrase attL 6353033:6353078|attR 6391326:6391371
DBSCAN-SWA_3 6620211 : 6658878 27 uncultured_Caudovirales_phage(60.0%) protease,tail,plate NA
DBSCAN-SWA_4 6776600 : 6859457 57 Mycobacterium_phage(16.67%) transposase,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage