Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014487 Bacillus cereus strain FORC021 plasmid unnamed, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP014486 Bacillus cereus strain FORC021 chromosome, complete genome 4 crisprs cas3,csa3,WYL,RT,DinG,cas14k,Cas14u_CAS-V,c2c9_V-U4,DEDDh 0 2 6 0

Results visualization

1. NZ_CP014487
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 41166 63 Bacillus_phage(48.84%) terminase,holin,tail,capsid,head,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014486
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014486_1 1086289-1086417 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014486_2 2774402-2774558 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014486_3 3223198-3223350 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014486_4 5114388-5114521 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014486_4 4.1|5114411|31|NZ_CP014486|CRISPRCasFinder 5114411-5114441 31 JX238501 Bacillus phage phiAGATE, complete genome 124559-124589 8 0.742
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812210 Flavobacterium phage vB_FspS_hemulen9-1, complete genome 22854-22887 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812215 Flavobacterium phage vB_FspS_lillamy9-4, complete genome 22191-22224 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812216 Flavobacterium phage vB_FspS_lillamy9-5, complete genome 22191-22224 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NC_048835 Flavobacterium phage vB_FspS_lillamy9-1, complete genome 22191-22224 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812213 Flavobacterium phage vB_FspS_lillamy9-2, complete genome 22191-22224 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812230 Flavobacterium phage vB_FspS_sniff9-2, complete genome 21831-21864 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812209 Flavobacterium phage vB_FspS_hemulen6-2, complete genome 22983-23016 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812218 Flavobacterium phage vB_FspS_lillamy9-7, complete genome 21454-21487 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812233 Flavobacterium phage vB_FspS_snork9-1, complete genome 22007-22040 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812219 Flavobacterium phage vB_FspS_morran9-1, complete genome 22308-22341 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812217 Flavobacterium phage vB_FspS_lillamy9-6, complete genome 21930-21963 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NC_048840 Flavobacterium phage vB_FspS_snork6-1, complete genome 22137-22170 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NC_048839 Flavobacterium phage vB_FspS_sniff9-1, complete genome 22057-22090 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NC_048842 Flavobacterium phage vB_FspS_stinky9-1, complete genome 21673-21706 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812232 Flavobacterium phage vB_FspS_snork6-2, complete genome 21655-21688 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 MN812208 Flavobacterium phage vB_FspS_hemulen6-1, complete genome 22983-23016 9 0.735
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47181-47214 11 0.676
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47565-47598 11 0.676
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47949-47982 11 0.676
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48333-48366 11 0.676
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48717-48750 11 0.676
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49101-49134 11 0.676
NZ_CP014486_4 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder 5114465-5114498 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49485-49518 11 0.676

1. spacer 4.1|5114411|31|NZ_CP014486|CRISPRCasFinder matches to JX238501 (Bacillus phage phiAGATE, complete genome) position: , mismatch: 8, identity: 0.742

ttcttcttttttgtcactagttgaaccgctt	CRISPR spacer
ctaaccttttttgccactagttaaaccgccc	Protospacer
.*  .********.********.******..

2. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812210 (Flavobacterium phage vB_FspS_hemulen9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

3. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812215 (Flavobacterium phage vB_FspS_lillamy9-4, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

4. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812216 (Flavobacterium phage vB_FspS_lillamy9-5, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

5. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NC_048835 (Flavobacterium phage vB_FspS_lillamy9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

6. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812213 (Flavobacterium phage vB_FspS_lillamy9-2, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

7. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812230 (Flavobacterium phage vB_FspS_sniff9-2, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

8. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812209 (Flavobacterium phage vB_FspS_hemulen6-2, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

9. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812218 (Flavobacterium phage vB_FspS_lillamy9-7, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

10. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812233 (Flavobacterium phage vB_FspS_snork9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

11. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812219 (Flavobacterium phage vB_FspS_morran9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

12. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812217 (Flavobacterium phage vB_FspS_lillamy9-6, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

13. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NC_048840 (Flavobacterium phage vB_FspS_snork6-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

14. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NC_048839 (Flavobacterium phage vB_FspS_sniff9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

15. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NC_048842 (Flavobacterium phage vB_FspS_stinky9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

16. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812232 (Flavobacterium phage vB_FspS_snork6-2, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

17. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to MN812208 (Flavobacterium phage vB_FspS_hemulen6-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

18. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

19. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

20. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

21. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

22. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

23. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

24. spacer 4.2|5114465|34|NZ_CP014486|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 257610 : 265559 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 311132 : 319508 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 654701 : 662659 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_4 1874989 : 1883637 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 3559738 : 3569905 14 Bacillus_phage(54.55%) bacteriocin NA
DBSCAN-SWA_6 4403052 : 4410738 10 Staphylococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage