Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019697 Paenalcaligenes hominis strain microbial chromosome, complete genome 2 crisprs cas3,RT,DEDDh,csa3,c2c9_V-U4,DinG 0 1 5 0

Results visualization

1. NZ_CP019697
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019697_1 648192-648284 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019697_2 732384-732534 Orphan I-B,III-A,III-B
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019697_2 2.1|732413|32|NZ_CP019697|PILER-CR 732413-732444 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1454531-1454562 9 0.719

1. spacer 2.1|732413|32|NZ_CP019697|PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719

ccttatccccacgccaagctcgccacttcctt	CRISPR spacer
aattgtcgccacgccaagctcgccaagaccgc	Protospacer
  **.** *****************   ** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 247880 : 270125 32 Pseudomonas_phage(40.0%) capsid,terminase NA
DBSCAN-SWA_2 432526 : 439504 6 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_3 451544 : 512883 71 Pseudomonas_phage(48.48%) head,integrase,terminase,tRNA,tail attL 459593:459608|attR 502731:502746
DBSCAN-SWA_4 605963 : 613432 8 Methanothermobacter_phage(16.67%) protease NA
DBSCAN-SWA_5 1902809 : 1912599 11 Acinetobacter_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage