Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015821 Bartonella apis strain BBC0244 chromosome, complete genome 6 crisprs cas3,csa3,cas9 0 31 5 0

Results visualization

1. NZ_CP015821
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015821_1 1940503-1941333 TypeII NA
12 spacers
cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015821_2 1941952-1942384 TypeII NA
6 spacers
cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015821_3 1943000-1943498 TypeII NA
7 spacers
cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015821_4 1946348-1947246 TypeII NA
13 spacers
cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015821_5 1947851-1948151 TypeII NA
4 spacers
cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015821_6 1965995-1966090 TypeII NA
1 spacers
cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015821_1 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940672-1940701 30 MN856038 Siphoviridae sp. isolate 311, complete genome 825-854 0 1.0
NZ_CP015821_1 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940672-1940701 30 MN855738 Bacteriophage sp. isolate 77, complete genome 18658-18687 0 1.0
NZ_CP015821_1 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940672-1940701 30 MN856066 Bacteriophage sp. isolate 479, complete genome 2864-2893 0 1.0
NZ_CP015821_1 1.5|1940804|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940804-1940833 30 MN855585 Siphoviridae sp. isolate 306, complete genome 17572-17601 0 1.0
NZ_CP015821_1 1.6|1940870|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940870-1940899 30 MN855671 Bacteriophage sp. isolate 26, complete genome 6616-6645 0 1.0
NZ_CP015821_1 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1941002-1941032 31 MN855737 Bacteriophage sp. isolate 54, complete genome 3775-3805 0 1.0
NZ_CP015821_1 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1941002-1941032 31 MN855962 Bacteriophage sp. isolate 205, complete genome 3859-3889 0 1.0
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 MN855955 Bacteriophage sp. isolate 57, complete genome 2332-2361 0 1.0
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 MN855955 Bacteriophage sp. isolate 57, complete genome 2332-2360 0 1.0
NZ_CP015821_1 1.4|1940738|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940738-1940767 30 MN855720 Siphoviridae sp. isolate 41, complete genome 48210-48239 1 0.967
NZ_CP015821_4 4.7|1946781|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946781-1946810 30 MN855739 Bacteriophage sp. isolate 86, complete genome 3052-3081 1 0.967
NZ_CP015821_4 4.7|1946781|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946781-1946810 30 MN855671 Bacteriophage sp. isolate 26, complete genome 39243-39272 1 0.967
NZ_CP015821_4 4.12|1947112|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1947112-1947142 31 MN856067 Bacteriophage sp. isolate 483, partial genome 1371-1401 1 0.968
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 MN855737 Bacteriophage sp. isolate 54, complete genome 27772-27801 1 0.967
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 MN855585 Siphoviridae sp. isolate 306, complete genome 35262-35291 1 0.967
NZ_CP015821_1 1.2|1940606|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940606-1940635 30 MN855738 Bacteriophage sp. isolate 77, complete genome 608-637 2 0.933
NZ_CP015821_1 1.2|1940606|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940606-1940635 30 MN855737 Bacteriophage sp. isolate 54, complete genome 20724-20753 2 0.933
NZ_CP015821_1 1.5|1940804|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940804-1940833 30 MN855734 Siphoviridae sp. isolate 120, complete genome 45958-45987 2 0.933
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 MN855695 Myoviridae sp. isolate 402, complete genome 5481-5510 2 0.933
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 MN856048 Siphoviridae sp. isolate 5, complete genome 1414-1443 2 0.933
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 MN856067 Bacteriophage sp. isolate 483, partial genome 4613-4642 2 0.933
NZ_CP015821_5 5.3|1948019|30|NZ_CP015821|CRISPRCasFinder,CRT 1948019-1948048 30 MN855585 Siphoviridae sp. isolate 306, complete genome 31424-31453 2 0.933
NZ_CP015821_5 5.6|1948020|28|NZ_CP015821|PILER-CR 1948020-1948047 28 MN855585 Siphoviridae sp. isolate 306, complete genome 31425-31452 2 0.929
NZ_CP015821_1 1.2|1940606|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940606-1940635 30 MN856063 Myoviridae sp. isolate 478, complete genome 1403-1432 3 0.9
NZ_CP015821_4 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946847-1946876 30 MN855737 Bacteriophage sp. isolate 54, complete genome 16159-16188 3 0.9
NZ_CP015821_4 4.10|1946979|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946979-1947008 30 MN855720 Siphoviridae sp. isolate 41, complete genome 51928-51957 3 0.9
NZ_CP015821_4 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946847-1946876 30 MN855955 Bacteriophage sp. isolate 57, complete genome 24500-24529 4 0.867
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 MN689510 Lactococcus phage CHPC1182, complete genome 662-690 5 0.828
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 105799-105828 5 0.833
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP025114 Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence 7495-7524 5 0.833
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP025114 Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence 270240-270269 5 0.833
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1567687-1567716 5 0.833
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 113588-113617 5 0.833
NZ_CP015821_5 5.5|1947954|28|NZ_CP015821|PILER-CR 1947954-1947981 28 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 348004-348031 5 0.821
NZ_CP015821_5 5.5|1947954|28|NZ_CP015821|PILER-CR 1947954-1947981 28 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 348004-348031 5 0.821
NZ_CP015821_5 5.5|1947954|28|NZ_CP015821|PILER-CR 1947954-1947981 28 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 348004-348031 5 0.821
NZ_CP015821_5 5.5|1947954|28|NZ_CP015821|PILER-CR 1947954-1947981 28 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 348004-348031 5 0.821
NZ_CP015821_5 5.5|1947954|28|NZ_CP015821|PILER-CR 1947954-1947981 28 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 348498-348525 5 0.821
NZ_CP015821_1 1.2|1940606|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940606-1940635 30 MK613346 Roseobacter phage CRP-4, complete genome 10953-10982 6 0.8
NZ_CP015821_3 3.2|1943102|30|NZ_CP015821|CRISPRCasFinder,CRT 1943102-1943131 30 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 691555-691584 6 0.8
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 MN689510 Lactococcus phage CHPC1182, complete genome 662-691 6 0.8
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 NZ_CP017387 Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence 217515-217543 6 0.793
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 NZ_CP044034 Klebsiella pneumoniae strain FDAARGOS_631 plasmid unnamed2, complete sequence 111220-111248 6 0.793
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 CP052311 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence 69913-69941 6 0.793
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 CP052281 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-1, complete sequence 76994-77022 6 0.793
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 108260-108288 6 0.793
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 NZ_MF133442 Klebsiella pneumoniae strain 11219 plasmid p11219-CTXM, complete sequence 8221-8249 6 0.793
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 CP052527 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-3, complete sequence 8101-8129 6 0.793
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 CP052352 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence 116523-116551 6 0.793
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 CP052393 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence 79949-79977 6 0.793
NZ_CP015821_3 3.10|1943367|29|NZ_CP015821|PILER-CR 1943367-1943395 29 LR134218 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 2 43194-43222 6 0.793
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 NC_049341 Escherichia phage 503458, complete genome 16970-16998 6 0.793
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 NZ_MK439959 Escherichia coli strain Ec-2Lar plasmid pC-Ec2-KPC, complete sequence 56511-56539 6 0.793
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 CP025923 Escherichia phage sp. chromosome, complete genome 18812-18840 6 0.793
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 NC_049344 Escherichia phage 520873, complete genome 18812-18840 6 0.793
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 NC_049343 Escherichia phage 500465-2, complete genome 8045-8073 6 0.793
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 KP063541 Enterobacteria phage P88, complete genome 18822-18850 6 0.793
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 NC_049391 Escherichia virus P88_4B11 genome assembly, chromosome: 1 7872-7900 6 0.793
NZ_CP015821_4 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946847-1946876 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 363574-363603 6 0.8
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 513482-513511 6 0.8
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 136768-136797 6 0.8
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 823072-823101 6 0.8
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 94115-94144 6 0.8
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 94121-94150 6 0.8
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 94116-94145 6 0.8
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP010865 Marinovum algicola DG 898 plasmid pMaD10, complete sequence 40217-40246 6 0.8
NZ_CP015821_1 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940672-1940701 30 NC_014839 Pantoea sp. At-9b plasmid pPAT9B02, complete sequence 325599-325628 7 0.767
NZ_CP015821_1 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1941002-1941032 31 MH834598 Arthrobacter phage Auxilium, complete genome 1396-1426 7 0.774
NZ_CP015821_1 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1941002-1941032 31 MH834612 Arthrobacter phage Faja, complete genome 1396-1426 7 0.774
NZ_CP015821_1 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1941002-1941032 31 MH834625 Arthrobacter phage Richie, complete genome 1396-1426 7 0.774
NZ_CP015821_1 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1941002-1941032 31 MH910041 Arthrobacter phage Seahorse, complete genome 1396-1426 7 0.774
NZ_CP015821_2 2.3|1942120|30|NZ_CP015821|CRISPRCasFinder,CRT 1942120-1942149 30 NZ_KP791968 Vibrio parahaemolyticus strain 2011VPH2 plasmid pVPH2, complete sequence 193035-193064 7 0.767
NZ_CP015821_2 2.3|1942120|30|NZ_CP015821|CRISPRCasFinder,CRT 1942120-1942149 30 KX957968 Vibrio alginolyticus plasmid pVAS19, complete sequence 105929-105958 7 0.767
NZ_CP015821_2 2.4|1942186|30|NZ_CP015821|CRISPRCasFinder,CRT 1942186-1942215 30 MH572364 Microviridae sp. isolate SD_SC_100, complete genome 2274-2303 7 0.767
NZ_CP015821_2 2.6|1942318|30|NZ_CP015821|CRISPRCasFinder,CRT 1942318-1942347 30 NZ_CP047222 Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed4, complete sequence 45252-45281 7 0.767
NZ_CP015821_2 2.9|1942121|30|NZ_CP015821|PILER-CR 1942121-1942150 30 NZ_KP791968 Vibrio parahaemolyticus strain 2011VPH2 plasmid pVPH2, complete sequence 193035-193064 7 0.767
NZ_CP015821_2 2.9|1942121|30|NZ_CP015821|PILER-CR 1942121-1942150 30 KX957968 Vibrio alginolyticus plasmid pVAS19, complete sequence 105929-105958 7 0.767
NZ_CP015821_2 2.10|1942187|30|NZ_CP015821|PILER-CR 1942187-1942216 30 MH572364 Microviridae sp. isolate SD_SC_100, complete genome 2274-2303 7 0.767
NZ_CP015821_2 2.12|1942319|30|NZ_CP015821|PILER-CR 1942319-1942348 30 NZ_CP047222 Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed4, complete sequence 45252-45281 7 0.767
NZ_CP015821_3 3.3|1943168|30|NZ_CP015821|CRISPRCasFinder,CRT 1943168-1943197 30 MN693294 Marine virus AFVG_25M46, complete genome 1204-1233 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 NZ_MF133442 Klebsiella pneumoniae strain 11219 plasmid p11219-CTXM, complete sequence 8220-8249 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 NZ_CP017387 Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence 217515-217544 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 NZ_CP044034 Klebsiella pneumoniae strain FDAARGOS_631 plasmid unnamed2, complete sequence 111220-111249 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 CP052311 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence 69913-69942 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 CP052527 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-3, complete sequence 8100-8129 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 CP052281 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-1, complete sequence 76994-77023 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 108260-108289 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 CP052352 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence 116522-116551 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 CP052393 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence 79948-79977 7 0.767
NZ_CP015821_3 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT 1943367-1943396 30 LR134218 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 2 43193-43222 7 0.767
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 NZ_MK439959 Escherichia coli strain Ec-2Lar plasmid pC-Ec2-KPC, complete sequence 56510-56539 7 0.767
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 NC_049341 Escherichia phage 503458, complete genome 16970-16999 7 0.767
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 CP025923 Escherichia phage sp. chromosome, complete genome 18811-18840 7 0.767
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 NC_049344 Escherichia phage 520873, complete genome 18811-18840 7 0.767
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 NC_049343 Escherichia phage 500465-2, complete genome 8044-8073 7 0.767
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 KP063541 Enterobacteria phage P88, complete genome 18821-18850 7 0.767
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 NC_049391 Escherichia virus P88_4B11 genome assembly, chromosome: 1 7871-7900 7 0.767
NZ_CP015821_3 3.8|1943234|29|NZ_CP015821|PILER-CR 1943234-1943262 29 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 100281-100309 7 0.759
NZ_CP015821_3 3.8|1943234|29|NZ_CP015821|PILER-CR 1943234-1943262 29 MK359343 Mycobacterium phage Pollywog, complete genome 21895-21923 7 0.759
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 NC_001706 Lactococcus phage c2, complete genome 707-735 7 0.759
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 L48605 Bacteriophage c2 complete genome 707-735 7 0.759
NZ_CP015821_4 4.7|1946781|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946781-1946810 30 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 214101-214130 7 0.767
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 232373-232402 7 0.767
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 721226-721255 7 0.767
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP015233 Epibacterium mobile F1926 plasmid unnamed3, complete sequence 39584-39613 7 0.767
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP031599 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence 434677-434706 7 0.767
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP049815 Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence 137557-137586 7 0.767
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 71254-71283 7 0.767
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP049251 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed4, complete sequence 74971-75000 7 0.767
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 528130-528159 7 0.767
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 387920-387949 7 0.767
NZ_CP015821_5 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT 1947953-1947982 30 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1245255-1245284 7 0.767
NZ_CP015821_5 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT 1947953-1947982 30 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 348003-348032 7 0.767
NZ_CP015821_5 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT 1947953-1947982 30 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 348003-348032 7 0.767
NZ_CP015821_5 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT 1947953-1947982 30 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 348003-348032 7 0.767
NZ_CP015821_5 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT 1947953-1947982 30 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 348003-348032 7 0.767
NZ_CP015821_5 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT 1947953-1947982 30 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 348497-348526 7 0.767
NZ_CP015821_5 5.5|1947954|28|NZ_CP015821|PILER-CR 1947954-1947981 28 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 213829-213856 7 0.75
NZ_CP015821_1 1.5|1940804|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940804-1940833 30 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 378574-378603 8 0.733
NZ_CP015821_2 2.6|1942318|30|NZ_CP015821|CRISPRCasFinder,CRT 1942318-1942347 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 720474-720503 8 0.733
NZ_CP015821_2 2.12|1942319|30|NZ_CP015821|PILER-CR 1942319-1942348 30 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 720474-720503 8 0.733
NZ_CP015821_3 3.4|1943234|30|NZ_CP015821|CRISPRCasFinder,CRT 1943234-1943263 30 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 100281-100310 8 0.733
NZ_CP015821_3 3.4|1943234|30|NZ_CP015821|CRISPRCasFinder,CRT 1943234-1943263 30 MK359343 Mycobacterium phage Pollywog, complete genome 21895-21924 8 0.733
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 NC_001706 Lactococcus phage c2, complete genome 707-736 8 0.733
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 L48605 Bacteriophage c2 complete genome 707-736 8 0.733
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 MN689515 Lactococcus phage CHPC134, complete genome 703-731 8 0.724
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 MN689532 Lactococcus phage PC_B3, complete genome 708-736 8 0.724
NZ_CP015821_3 3.11|1943433|29|NZ_CP015821|PILER-CR 1943433-1943461 29 MN689533 Lactococcus phage PC_S1, complete genome 710-738 8 0.724
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 330255-330284 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP048642 Streptomyces aureoverticillatus strain HN6 plasmid unnamed, complete sequence 9951-9980 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 323580-323609 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 49084-49113 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 665945-665974 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 81830-81859 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 262426-262455 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 MN657146 Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence 9851-9880 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 246729-246758 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 391819-391848 8 0.733
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 336378-336407 8 0.733
NZ_CP015821_4 4.10|1946979|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946979-1947008 30 AJ748296 Sulfolobus islandicus rudivirus 1 variant XX, complete genome 13345-13374 8 0.733
NZ_CP015821_4 4.10|1946979|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946979-1947008 30 AJ414696 Sulfolobus virus SIRV-1 complete viral genome 13105-13134 8 0.733
NZ_CP015821_4 4.10|1946979|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946979-1947008 30 NC_015386 Treponema succinifaciens DSM 2489 plasmid pTRESU01, complete sequence 32954-32983 8 0.733
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 NZ_CP020696 Sulfitobacter sp. D7 plasmid p2SUD7, complete sequence 79805-79834 8 0.733
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 NZ_CP022422 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-7, complete sequence 58477-58506 8 0.733
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 NZ_CP025961 Rhodococcus qingshengii strain djl-6-2 plasmid pDJL2, complete sequence 19169-19198 8 0.733
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 383058-383087 8 0.733
NZ_CP015821_5 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT 1947887-1947916 30 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 273666-273695 8 0.733
NZ_CP015821_5 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT 1947953-1947982 30 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 213828-213857 8 0.733
NZ_CP015821_5 5.4|1948085|30|NZ_CP015821|CRISPRCasFinder,CRT 1948085-1948114 30 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1922779-1922808 8 0.733
NZ_CP015821_5 5.4|1948085|30|NZ_CP015821|CRISPRCasFinder,CRT 1948085-1948114 30 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1716554-1716583 8 0.733
NZ_CP015821_5 5.5|1947954|28|NZ_CP015821|PILER-CR 1947954-1947981 28 NZ_MF600313 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence 156147-156174 8 0.714
NZ_CP015821_1 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940672-1940701 30 MN693117 Marine virus AFVG_25M88, complete genome 2403-2432 9 0.7
NZ_CP015821_1 1.5|1940804|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1940804-1940833 30 NZ_CP020695 Sulfitobacter sp. D7 plasmid p1SUD7, complete sequence 158371-158400 9 0.7
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 MN689515 Lactococcus phage CHPC134, complete genome 703-732 9 0.7
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 MN689532 Lactococcus phage PC_B3, complete genome 708-737 9 0.7
NZ_CP015821_3 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT 1943433-1943462 30 MN689533 Lactococcus phage PC_S1, complete genome 710-739 9 0.7
NZ_CP015821_4 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946847-1946876 30 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 857886-857915 9 0.7
NZ_CP015821_4 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946847-1946876 30 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 857885-857914 9 0.7
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 627480-627509 9 0.7
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 19323-19352 9 0.7
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP015006 Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence 85614-85643 9 0.7
NZ_CP015821_4 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR 1946913-1946942 30 NZ_CP023524 Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence 109992-110021 9 0.7
NZ_CP015821_5 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT 1947953-1947982 30 NZ_MF600313 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence 156146-156175 9 0.7

1. spacer 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN856038 (Siphoviridae sp. isolate 311, complete genome) position: , mismatch: 0, identity: 1.0 

gaaatttcgcacgttctcattgacgttttc	CRISPR spacer
gaaatttcgcacgttctcattgacgttttc	Protospacer
******************************

2. spacer 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855738 (Bacteriophage sp. isolate 77, complete genome) position: , mismatch: 0, identity: 1.0 

gaaatttcgcacgttctcattgacgttttc	CRISPR spacer
gaaatttcgcacgttctcattgacgttttc	Protospacer
******************************

3. spacer 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN856066 (Bacteriophage sp. isolate 479, complete genome) position: , mismatch: 0, identity: 1.0 

gaaatttcgcacgttctcattgacgttttc	CRISPR spacer
gaaatttcgcacgttctcattgacgttttc	Protospacer
******************************

4. spacer 1.5|1940804|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855585 (Siphoviridae sp. isolate 306, complete genome) position: , mismatch: 0, identity: 1.0 

tgttgataggcgtgtggcgcgtggcaatca	CRISPR spacer
tgttgataggcgtgtggcgcgtggcaatca	Protospacer
******************************

5. spacer 1.6|1940870|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855671 (Bacteriophage sp. isolate 26, complete genome) position: , mismatch: 0, identity: 1.0 

tagccacgagtttacagtcgggtccgtctt	CRISPR spacer
tagccacgagtttacagtcgggtccgtctt	Protospacer
******************************

6. spacer 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855737 (Bacteriophage sp. isolate 54, complete genome) position: , mismatch: 0, identity: 1.0 

aaagaatttgaagatgtcctgcgcgatgcag	CRISPR spacer
aaagaatttgaagatgtcctgcgcgatgcag	Protospacer
*******************************

7. spacer 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855962 (Bacteriophage sp. isolate 205, complete genome) position: , mismatch: 0, identity: 1.0 

aaagaatttgaagatgtcctgcgcgatgcag	CRISPR spacer
aaagaatttgaagatgtcctgcgcgatgcag	Protospacer
*******************************

8. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN855955 (Bacteriophage sp. isolate 57, complete genome) position: , mismatch: 0, identity: 1.0 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttgttttcgttttgttct	Protospacer
******************************

9. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to MN855955 (Bacteriophage sp. isolate 57, complete genome) position: , mismatch: 0, identity: 1.0 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttgttttcgttttgttc	Protospacer
*****************************

10. spacer 1.4|1940738|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855720 (Siphoviridae sp. isolate 41, complete genome) position: , mismatch: 1, identity: 0.967 

ccggttctatatccaaaagggtgtatatga	CRISPR spacer
ccgcttctatatccaaaagggtgtatatga	Protospacer
*** **************************

11. spacer 4.7|1946781|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855739 (Bacteriophage sp. isolate 86, complete genome) position: , mismatch: 1, identity: 0.967 

ctggtgttgctgcacgttcatcacgtgagg	CRISPR spacer
caggtgttgctgcacgttcatcacgtgagg	Protospacer
* ****************************

12. spacer 4.7|1946781|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855671 (Bacteriophage sp. isolate 26, complete genome) position: , mismatch: 1, identity: 0.967 

ctggtgttgctgcacgttcatcacgtgagg	CRISPR spacer
caggtgttgctgcacgttcatcacgtgagg	Protospacer
* ****************************

13. spacer 4.12|1947112|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN856067 (Bacteriophage sp. isolate 483, partial genome) position: , mismatch: 1, identity: 0.968 

ttacgtgacatattttagccctttcctttta	CRISPR spacer
tttcgtgacatattttagccctttcctttta	Protospacer
** ****************************

14. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN855737 (Bacteriophage sp. isolate 54, complete genome) position: , mismatch: 1, identity: 0.967 

acaagcccgtcatcaccaaccagcccatcg	CRISPR spacer
acaagcccgtcatcaccaaccagaccatcg	Protospacer
*********************** ******

15. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN855585 (Siphoviridae sp. isolate 306, complete genome) position: , mismatch: 1, identity: 0.967 

acaagcccgtcatcaccaaccagcccatcg	CRISPR spacer
acaagcccgtcatcacctaccagcccatcg	Protospacer
***************** ************

16. spacer 1.2|1940606|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855738 (Bacteriophage sp. isolate 77, complete genome) position: , mismatch: 2, identity: 0.933 

gcgatgtaaatatggtcacctgcttggaca	CRISPR spacer
gcgatgtaaatatggtcacctgcttgaact	Protospacer
**************************.**

17. spacer 1.2|1940606|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855737 (Bacteriophage sp. isolate 54, complete genome) position: , mismatch: 2, identity: 0.933 

gcgatgtaaatatggtcacctgcttggaca	CRISPR spacer
gcgatgtaaatatggtcacctgcctgcaca	Protospacer
***********************.** ***

18. spacer 1.5|1940804|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855734 (Siphoviridae sp. isolate 120, complete genome) position: , mismatch: 2, identity: 0.933 

tgttgataggcgtgtggcgcgtggcaatca	CRISPR spacer
tgttgataggcgtgtggcacgtggcaatga	Protospacer
******************.********* *

19. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN855695 (Myoviridae sp. isolate 402, complete genome) position: , mismatch: 2, identity: 0.933 

acaagcccgtcatcaccaaccagcccatcg	CRISPR spacer
acaagcccgtcatcaccaaccagcccgtct	Protospacer
**************************.**

20. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN856048 (Siphoviridae sp. isolate 5, complete genome) position: , mismatch: 2, identity: 0.933 

acaagcccgtcatcaccaaccagcccatcg	CRISPR spacer
acaagcccgtcatcaccaaccagcccgtct	Protospacer
**************************.**

21. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN856067 (Bacteriophage sp. isolate 483, partial genome) position: , mismatch: 2, identity: 0.933 

acaagcccgtcatcaccaaccagcccatcg	CRISPR spacer
acaagcccgtcatcaccaaccagaccatca	Protospacer
*********************** *****.

22. spacer 5.3|1948019|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN855585 (Siphoviridae sp. isolate 306, complete genome) position: , mismatch: 2, identity: 0.933 

aaaggcgtataacgtcagaggtacggtatc	CRISPR spacer
aaagacggataacgtcagaggtacggtatc	Protospacer
****.** **********************

23. spacer 5.6|1948020|28|NZ_CP015821|PILER-CR matches to MN855585 (Siphoviridae sp. isolate 306, complete genome) position: , mismatch: 2, identity: 0.929 

aaggcgtataacgtcagaggtacggtat	CRISPR spacer
aagacggataacgtcagaggtacggtat	Protospacer
***.** *********************

24. spacer 1.2|1940606|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN856063 (Myoviridae sp. isolate 478, complete genome) position: , mismatch: 3, identity: 0.9 

gcgatgtaaatatggtcacctgcttggaca	CRISPR spacer
gcgatgtaaatatggtcacctgcctgtacg	Protospacer
***********************.** **.

25. spacer 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855737 (Bacteriophage sp. isolate 54, complete genome) position: , mismatch: 3, identity: 0.9 

agttcggtcgaatgccgaccagcagctcat	CRISPR spacer
tgttcggtcgaatgccgatcagcagctcgt	Protospacer
 *****************.*********.*

26. spacer 4.10|1946979|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855720 (Siphoviridae sp. isolate 41, complete genome) position: , mismatch: 3, identity: 0.9 

aaacacgcatgatatttgcataatctttta	CRISPR spacer
aaacacgcatgatattcgcataatccttaa	Protospacer
****************.********.** *

27. spacer 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN855955 (Bacteriophage sp. isolate 57, complete genome) position: , mismatch: 4, identity: 0.867 

agttcggtcgaatgccgaccagcagctcat	CRISPR spacer
ggttcggtcgaatgccgaccagcaattgat	Protospacer
.***********************..* **

28. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to MN689510 (Lactococcus phage CHPC1182, complete genome) position: , mismatch: 5, identity: 0.828 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
cttggctttcatcttttggaaaatgttcg	Protospacer
*   ** *********** **********

29. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 5, identity: 0.833 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
ggtcacatcgacctgctgcccgccgaccag	Protospacer
 . ******************* *****.*

30. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025114 (Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
aaaagcatcgacctgctgccctacgacagg	Protospacer
 ** .**************** ***** **

31. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025114 (Bradyrhizobium sp. SK17 strain CBNU plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
aaaagcatcgacctgctgccctacgacagg	Protospacer
 ** .**************** ***** **

32. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833 

taaca-catcgacctgctgcccgacgaccgg	CRISPR spacer
-atcgccatcgaactgctgctcgacgaccgg	Protospacer
 * *. ****** *******.**********

33. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 5, identity: 0.833 

acaagcc-cgtcatcaccaaccagcccatcg	CRISPR spacer
-cattcctcgtcatcaccgaccagcccatcc	Protospacer
 **  ** **********.***********

34. spacer 5.5|1947954|28|NZ_CP015821|PILER-CR matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 5, identity: 0.821 

aaaaccgcgtcaacgacttgctcgcttt	CRISPR spacer
caatccgcgtcaacgacgtgctcggtgt	Protospacer
 ** ************* ****** * *

35. spacer 5.5|1947954|28|NZ_CP015821|PILER-CR matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 5, identity: 0.821 

aaaaccgcgtcaacgacttgctcgcttt	CRISPR spacer
caatccgcgtcaacgacgtgctcggtgt	Protospacer
 ** ************* ****** * *

36. spacer 5.5|1947954|28|NZ_CP015821|PILER-CR matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 5, identity: 0.821 

aaaaccgcgtcaacgacttgctcgcttt	CRISPR spacer
caatccgcgtcaacgacgtgctcggtgt	Protospacer
 ** ************* ****** * *

37. spacer 5.5|1947954|28|NZ_CP015821|PILER-CR matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 5, identity: 0.821 

aaaaccgcgtcaacgacttgctcgcttt	CRISPR spacer
caatccgcgtcaacgacgtgctcggtgt	Protospacer
 ** ************* ****** * *

38. spacer 5.5|1947954|28|NZ_CP015821|PILER-CR matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 5, identity: 0.821 

aaaaccgcgtcaacgacttgctcgcttt	CRISPR spacer
caatccgcgtcaacgacgtgctcggtgt	Protospacer
 ** ************* ****** * *

39. spacer 1.2|1940606|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MK613346 (Roseobacter phage CRP-4, complete genome) position: , mismatch: 6, identity: 0.8 

gcgatgtaaatatggtcacctgcttggaca---	CRISPR spacer
tcgatgtaactattgtcacctgct---acaggc	Protospacer
 ******** *** **********   ***

40. spacer 3.2|1943102|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 6, identity: 0.8 

tttctttgaaagcatggcaacaaaggttcc	CRISPR spacer
cgcctttgaaagcatggcaacgacggtttc	Protospacer
. .******************.* ****.*

41. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN689510 (Lactococcus phage CHPC1182, complete genome) position: , mismatch: 6, identity: 0.8 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
cttggctttcatcttttggaaaatgttcgt	Protospacer
*   ** *********** **********

42. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to NZ_CP017387 (Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

43. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to NZ_CP044034 (Klebsiella pneumoniae strain FDAARGOS_631 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

44. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to CP052311 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

45. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to CP052281 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-1, complete sequence) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

46. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

47. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to NZ_MF133442 (Klebsiella pneumoniae strain 11219 plasmid p11219-CTXM, complete sequence) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

48. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to CP052527 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-3, complete sequence) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

49. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to CP052352 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

50. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to CP052393 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

51. spacer 3.10|1943367|29|NZ_CP015821|PILER-CR matches to LR134218 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 2) position: , mismatch: 6, identity: 0.793 

tttatgcaacatttgttttcgttttgttc	CRISPR spacer
tttatgcaacatttattttccttttcaca	Protospacer
**************.***** ****  .

52. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to NC_049341 (Escherichia phage 503458, complete genome) position: , mismatch: 6, identity: 0.793 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
gggcgcattcatcttttgcaatatcgttg	Protospacer
 *****.************** **  *.*

53. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to NZ_MK439959 (Escherichia coli strain Ec-2Lar plasmid pC-Ec2-KPC, complete sequence) position: , mismatch: 6, identity: 0.793 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
gggcgcattcatcttttgcaatatcgttg	Protospacer
 *****.************** **  *.*

54. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to CP025923 (Escherichia phage sp. chromosome, complete genome) position: , mismatch: 6, identity: 0.793 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
gggcgcattcatcttttgcaatatcgttg	Protospacer
 *****.************** **  *.*

55. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to NC_049344 (Escherichia phage 520873, complete genome) position: , mismatch: 6, identity: 0.793 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
gggcgcattcatcttttgcaatatcgttg	Protospacer
 *****.************** **  *.*

56. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 6, identity: 0.793 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
gggcgcattcatcttttgcaatatcgttg	Protospacer
 *****.************** **  *.*

57. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to KP063541 (Enterobacteria phage P88, complete genome) position: , mismatch: 6, identity: 0.793 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
gggcgcattcatcttttgcaatatcgttg	Protospacer
 *****.************** **  *.*

58. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to NC_049391 (Escherichia virus P88_4B11 genome assembly, chromosome: 1) position: , mismatch: 6, identity: 0.793 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
gggcgcattcatcttttgcaatatcgttg	Protospacer
 *****.************** **  *.*

59. spacer 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 6, identity: 0.8 

agttcggtcgaatgccgaccagcagctcat	CRISPR spacer
cggtcgggcgattgccgaccagcagctcga	Protospacer
 * **** *** ****************.

60. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 6, identity: 0.8 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
caggacatcgacctgctggccgtcgacctg	Protospacer
.*. ************** *** ***** *

61. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.8 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
tgcaagatccacctgctggccgacgaccgg	Protospacer
*.  * *** ******** ***********

62. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.8 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
tgcaagatccacctgctggccgacgaccgg	Protospacer
*.  * *** ******** ***********

63. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 6, identity: 0.8 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
cagcgcctcgacctgctgccccacgaccga	Protospacer
.*.*.* ************** *******.

64. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 6, identity: 0.8 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
cagcgcctcgacctgctgccccacgaccga	Protospacer
.*.*.* ************** *******.

65. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 6, identity: 0.8 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
cagcgcctcgacctgctgccccacgaccga	Protospacer
.*.*.* ************** *******.

66. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 6, identity: 0.8 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
tatttcttcgacctgctgcccgatgacctg	Protospacer
** . * ****************.**** *

67. spacer 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NC_014839 (Pantoea sp. At-9b plasmid pPAT9B02, complete sequence) position: , mismatch: 7, identity: 0.767 

gaaatttcgcacgttctcattgacgttttc	CRISPR spacer
tgaaaaccgcacattgtcattgacgttttc	Protospacer
 .**  .*****.** **************

68. spacer 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MH834598 (Arthrobacter phage Auxilium, complete genome) position: , mismatch: 7, identity: 0.774 

aaagaatttgaagatgtcctgcgcgatgcag-	CRISPR spacer
gaagaacttgaagatgtccttcgc-ctgcgac	Protospacer
.*****.************* ***  ***..

69. spacer 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MH834612 (Arthrobacter phage Faja, complete genome) position: , mismatch: 7, identity: 0.774 

aaagaatttgaagatgtcctgcgcgatgcag-	CRISPR spacer
gaagaacttgaagatgtccttcgc-ctgcgac	Protospacer
.*****.************* ***  ***..

70. spacer 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MH834625 (Arthrobacter phage Richie, complete genome) position: , mismatch: 7, identity: 0.774 

aaagaatttgaagatgtcctgcgcgatgcag-	CRISPR spacer
gaagaacttgaagatgtccttcgc-ctgcgac	Protospacer
.*****.************* ***  ***..

71. spacer 1.8|1941002|31|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MH910041 (Arthrobacter phage Seahorse, complete genome) position: , mismatch: 7, identity: 0.774 

aaagaatttgaagatgtcctgcgcgatgcag-	CRISPR spacer
gaagaacttgaagatgtccttcgc-ctgcgac	Protospacer
.*****.************* ***  ***..

72. spacer 2.3|1942120|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_KP791968 (Vibrio parahaemolyticus strain 2011VPH2 plasmid pVPH2, complete sequence) position: , mismatch: 7, identity: 0.767 

ttttccaatcgccgaaattagcgaacgaat	CRISPR spacer
gattccaatcgcagaaattagagaaaaatt	Protospacer
  ********** ******** *** .* *

73. spacer 2.3|1942120|30|NZ_CP015821|CRISPRCasFinder,CRT matches to KX957968 (Vibrio alginolyticus plasmid pVAS19, complete sequence) position: , mismatch: 7, identity: 0.767 

ttttccaatcgccgaaattagcgaacgaat	CRISPR spacer
gattccaatcgcagaaattagagaaaaatt	Protospacer
  ********** ******** *** .* *

74. spacer 2.4|1942186|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MH572364 (Microviridae sp. isolate SD_SC_100, complete genome) position: , mismatch: 7, identity: 0.767 

catatccgaaaagccggtttattcacccga	CRISPR spacer
tacctgggaaaagccggtttgttcaccgga	Protospacer
.*. *  *************.****** **

75. spacer 2.6|1942318|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP047222 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767 

acctgatgggcacggcatcgggcttccgga	CRISPR spacer
tcctgatgggcagggcaacgggctttgcca	Protospacer
 *********** **** *******.   *

76. spacer 2.9|1942121|30|NZ_CP015821|PILER-CR matches to NZ_KP791968 (Vibrio parahaemolyticus strain 2011VPH2 plasmid pVPH2, complete sequence) position: , mismatch: 7, identity: 0.767 

ttttccaatcgccgaaattagcgaacgaat	CRISPR spacer
gattccaatcgcagaaattagagaaaaatt	Protospacer
  ********** ******** *** .* *

77. spacer 2.9|1942121|30|NZ_CP015821|PILER-CR matches to KX957968 (Vibrio alginolyticus plasmid pVAS19, complete sequence) position: , mismatch: 7, identity: 0.767 

ttttccaatcgccgaaattagcgaacgaat	CRISPR spacer
gattccaatcgcagaaattagagaaaaatt	Protospacer
  ********** ******** *** .* *

78. spacer 2.10|1942187|30|NZ_CP015821|PILER-CR matches to MH572364 (Microviridae sp. isolate SD_SC_100, complete genome) position: , mismatch: 7, identity: 0.767 

catatccgaaaagccggtttattcacccga	CRISPR spacer
tacctgggaaaagccggtttgttcaccgga	Protospacer
.*. *  *************.****** **

79. spacer 2.12|1942319|30|NZ_CP015821|PILER-CR matches to NZ_CP047222 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767 

acctgatgggcacggcatcgggcttccgga	CRISPR spacer
tcctgatgggcagggcaacgggctttgcca	Protospacer
 *********** **** *******.   *

80. spacer 3.3|1943168|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN693294 (Marine virus AFVG_25M46, complete genome) position: , mismatch: 7, identity: 0.767 

cttctgtgccatgtatatgggttccagaga	CRISPR spacer
cttctttgccatgtgtatgggttttcgtgt	Protospacer
***** ********.********.. * *

81. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_MF133442 (Klebsiella pneumoniae strain 11219 plasmid p11219-CTXM, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

82. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP017387 (Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

83. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP044034 (Klebsiella pneumoniae strain FDAARGOS_631 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

84. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to CP052311 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

85. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to CP052527 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-3, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

86. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to CP052281 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-1, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

87. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

88. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to CP052352 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

89. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to CP052393 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

90. spacer 3.6|1943367|30|NZ_CP015821|CRISPRCasFinder,CRT matches to LR134218 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 2) position: , mismatch: 7, identity: 0.767 

tttatgcaacatttgttttcgttttgttct	CRISPR spacer
tttatgcaacatttattttccttttcacag	Protospacer
**************.***** ****  .

91. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_MK439959 (Escherichia coli strain Ec-2Lar plasmid pC-Ec2-KPC, complete sequence) position: , mismatch: 7, identity: 0.767 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
gggcgcattcatcttttgcaatatcgttgc	Protospacer
 *****.************** **  *.*

92. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NC_049341 (Escherichia phage 503458, complete genome) position: , mismatch: 7, identity: 0.767 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
gggcgcattcatcttttgcaatatcgttgc	Protospacer
 *****.************** **  *.*

93. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to CP025923 (Escherichia phage sp. chromosome, complete genome) position: , mismatch: 7, identity: 0.767 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
gggcgcattcatcttttgcaatatcgttgc	Protospacer
 *****.************** **  *.*

94. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NC_049344 (Escherichia phage 520873, complete genome) position: , mismatch: 7, identity: 0.767 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
gggcgcattcatcttttgcaatatcgttgc	Protospacer
 *****.************** **  *.*

95. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 7, identity: 0.767 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
gggcgcattcatcttttgcaatatcgttgc	Protospacer
 *****.************** **  *.*

96. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to KP063541 (Enterobacteria phage P88, complete genome) position: , mismatch: 7, identity: 0.767 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
gggcgcattcatcttttgcaatatcgttgc	Protospacer
 *****.************** **  *.*

97. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NC_049391 (Escherichia virus P88_4B11 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.767 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
gggcgcattcatcttttgcaatatcgttgc	Protospacer
 *****.************** **  *.*

98. spacer 3.8|1943234|29|NZ_CP015821|PILER-CR matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 7, identity: 0.759 

tggcctgctacattggcgatgccaagcgc	CRISPR spacer
ccagccgcgatattggcgatgccaagcgc	Protospacer
. . *.** *.******************

99. spacer 3.8|1943234|29|NZ_CP015821|PILER-CR matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 7, identity: 0.759 

tggcctgctacattggcgatgccaagcgc	CRISPR spacer
tggcctgcaacatcggcgatgccggaacc	Protospacer
******** ****.*********...  *

100. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to NC_001706 (Lactococcus phage c2, complete genome) position: , mismatch: 7, identity: 0.759 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
cttgactttcatcttttggaaaatgttca	Protospacer
*   .* *********** *********.

101. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to L48605 (Bacteriophage c2 complete genome) position: , mismatch: 7, identity: 0.759 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
cttgactttcatcttttggaaaatgttca	Protospacer
*   .* *********** *********.

102. spacer 4.7|1946781|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 7, identity: 0.767 

ctggtgttgctgcacgttcatcacgtgagg	CRISPR spacer
ctggtgtcgctgcacggtcatcacggtgac	Protospacer
*******.******** ********  ..

103. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 7, identity: 0.767 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
ttggtcaccgccctgctgcccgacgaccgc	Protospacer
* .  **.** ******************

104. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.767 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
cagaatgtctacctgctgcccgacgaccag	Protospacer
.*. *..** ******************.*

105. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015233 (Epibacterium mobile F1926 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
aaatacatcgacctgctgcccgcctatgag	Protospacer
 **.****************** * *. .*

106. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 7, identity: 0.767 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
aaatacatcgacctgctgcccgcctatgag	Protospacer
 **.****************** * *. .*

107. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049815 (Monaibacterium sp. ALG8 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
aaatacatcgacctgctgcccgcctatgag	Protospacer
 **.****************** * *. .*

108. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 7, identity: 0.767 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
cagaatgtctacctgctgcccgacgaccag	Protospacer
.*. *..** ******************.*

109. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049251 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
tgcagcatcgacctgctgatcgacgacctg	Protospacer
*.  .************* .******** *

110. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 7, identity: 0.767 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
gaatggctggacctgctggccgacgaccgg	Protospacer
 **..  * ********* ***********

111. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767 

acaagcccgtcatcaccaaccagcccatcg	CRISPR spacer
tgcatcgcgtcaacacgaaccagcccatcg	Protospacer
   * * ***** *** *************

112. spacer 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.767 

caaaaccgcgtcaacgacttgctcgctttg	CRISPR spacer
tccagctgcttcaacgacttgctcgcgttg	Protospacer
.  *.*.** **************** ***

113. spacer 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 7, identity: 0.767 

caaaaccgcgtcaacgacttgctcgctttg	CRISPR spacer
tcaatccgcgtcaacgacgtgctcggtgtt	Protospacer
. ** ************* ****** * *

114. spacer 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 7, identity: 0.767 

caaaaccgcgtcaacgacttgctcgctttg	CRISPR spacer
tcaatccgcgtcaacgacgtgctcggtgtt	Protospacer
. ** ************* ****** * *

115. spacer 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 7, identity: 0.767 

caaaaccgcgtcaacgacttgctcgctttg	CRISPR spacer
tcaatccgcgtcaacgacgtgctcggtgtt	Protospacer
. ** ************* ****** * *

116. spacer 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 7, identity: 0.767 

caaaaccgcgtcaacgacttgctcgctttg	CRISPR spacer
tcaatccgcgtcaacgacgtgctcggtgtt	Protospacer
. ** ************* ****** * *

117. spacer 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 7, identity: 0.767 

caaaaccgcgtcaacgacttgctcgctttg	CRISPR spacer
tcaatccgcgtcaacgacgtgctcggtgtt	Protospacer
. ** ************* ****** * *

118. spacer 5.5|1947954|28|NZ_CP015821|PILER-CR matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75 

aaaaccgcgtcaacgacttgctcgcttt	CRISPR spacer
tgaaccgcgtcaacgacccgctcgcgcg	Protospacer
 .***************..****** .

119. spacer 1.5|1940804|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.733 

tgttgataggcgtgtggcgcgtggcaatca	CRISPR spacer
cggtgacagccgtgtggcgcgtggcatcgc	Protospacer
.* ***.** **************** .

120. spacer 2.6|1942318|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.733 

acctgatgggcacggcatcgggcttccgga	CRISPR spacer
cggcgccgggaacggcatcgggcttgcgga	Protospacer
   .* .*** ************** ****

121. spacer 2.12|1942319|30|NZ_CP015821|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.733 

acctgatgggcacggcatcgggcttccgga	CRISPR spacer
cggcgccgggaacggcatcgggcttgcgga	Protospacer
   .* .*** ************** ****

122. spacer 3.4|1943234|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 8, identity: 0.733 

tggcctgctacattggcgatgccaagcgca	CRISPR spacer
ccagccgcgatattggcgatgccaagcgcc	Protospacer
. . *.** *.******************

123. spacer 3.4|1943234|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.733 

tggcctgctacattggcgatgccaagcgca	CRISPR spacer
tggcctgcaacatcggcgatgccggaaccg	Protospacer
******** ****.*********...  *.

124. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NC_001706 (Lactococcus phage c2, complete genome) position: , mismatch: 8, identity: 0.733 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
cttgactttcatcttttggaaaatgttcat	Protospacer
*   .* *********** *********.

125. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to L48605 (Bacteriophage c2 complete genome) position: , mismatch: 8, identity: 0.733 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
cttgactttcatcttttggaaaatgttcat	Protospacer
*   .* *********** *********.

126. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to MN689515 (Lactococcus phage CHPC134, complete genome) position: , mismatch: 8, identity: 0.724 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
tttgactttcatcttttggaaaatgttca	Protospacer
.   .* *********** *********.

127. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to MN689532 (Lactococcus phage PC_B3, complete genome) position: , mismatch: 8, identity: 0.724 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
tttgactttcatcttttggaaaatgttca	Protospacer
.   .* *********** *********.

128. spacer 3.11|1943433|29|NZ_CP015821|PILER-CR matches to MN689533 (Lactococcus phage PC_S1, complete genome) position: , mismatch: 8, identity: 0.724 

cggcgcgttcatcttttgcaaaatgttcg	CRISPR spacer
tttgactttcatcttttggaaaatgttca	Protospacer
.   .* *********** *********.

129. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
ctggtcaccgccctgctgcccgacgaccgc	Protospacer
. .  **.** ******************

130. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048642 (Streptomyces aureoverticillatus strain HN6 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
cgcgacatcgacctgctggccgacgaggag	Protospacer
..  ************** *******  .*

131. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
ctggtcaccgccctgctgcccgacgaccgc	Protospacer
. .  **.** ******************

132. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
acatacatcgacctgctgccgggcgacgac	Protospacer
  *.**************** *.**** .

133. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
cccgacaccgacctgctgctcgacgacggc	Protospacer
.   ***.***********.******* *

134. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
gcgctcgcggagctgctgcccgacgaccgg	Protospacer
  .* *.. ** ******************

135. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
ccggtcatcgacctgctggccgacgatccg	Protospacer
. .  ************* *******.* *

136. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN657146 (Cryobacterium sp. strain ANT_H28B plasmid pA28BH2, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
agtgccttcgaccagctgcccgtcgaccgg	Protospacer
 .   * ****** ******** *******

137. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
ccggacaccgacctgctgctcgacgacggc	Protospacer
. . ***.***********.******* *

138. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
cccgacaccgacctgctgctcgacgacggc	Protospacer
.   ***.***********.******* *

139. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.733 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
cccgacaccgacctgctgctcgacgacggc	Protospacer
.   ***.***********.******* *

140. spacer 4.10|1946979|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to AJ748296 (Sulfolobus islandicus rudivirus 1 variant XX, complete genome) position: , mismatch: 8, identity: 0.733 

aaacacgcatgatatttgcataatctttta	CRISPR spacer
cattttctatcatatttgcataatctttta	Protospacer
 * . . .** *******************

141. spacer 4.10|1946979|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to AJ414696 (Sulfolobus virus SIRV-1 complete viral genome) position: , mismatch: 8, identity: 0.733 

aaacacgcatgatatttgcataatctttta	CRISPR spacer
cattttctatcatatttgcataatctttta	Protospacer
 * . . .** *******************

142. spacer 4.10|1946979|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NC_015386 (Treponema succinifaciens DSM 2489 plasmid pTRESU01, complete sequence) position: , mismatch: 8, identity: 0.733 

aaacacgcatgatatttgcataatctttta	CRISPR spacer
atttttgaatgatattttcataatcttttt	Protospacer
*  . .* ********* ***********

143. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP020696 (Sulfitobacter sp. D7 plasmid p2SUD7, complete sequence) position: , mismatch: 8, identity: 0.733 

acaagcccgtcatcaccaaccagcccatcg	CRISPR spacer
tcaagcgcgtcatcaccaaccacttcctgc	Protospacer
 ***** *************** ..* *

144. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP022422 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-7, complete sequence) position: , mismatch: 8, identity: 0.733 

acaagcccgtcatcaccaaccagcccatcg	CRISPR spacer
tcaagcgcgtcatcaccaaccacttcctgc	Protospacer
 ***** *************** ..* *

145. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP025961 (Rhodococcus qingshengii strain djl-6-2 plasmid pDJL2, complete sequence) position: , mismatch: 8, identity: 0.733 

acaagcc------cgtcatcaccaaccagcccatcg	CRISPR spacer
------catttgacgtcatagccaaccagcccatcg	Protospacer
      *      ****** .***************

146. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.733 

acaagcc-----cgtcatcaccaaccagcccatcg	CRISPR spacer
-----ctctcggcgtcatcgccaacctgcccatcg	Protospacer
     *.     *******.****** ********

147. spacer 5.1|1947887|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

acaagcccgtcatcaccaaccagcccatcg	CRISPR spacer
tggacaccgtcatcgccaaccagcccacgg	Protospacer
  .*  ********.************. *

148. spacer 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

caaaaccgcgtcaacgacttgctcgctttg	CRISPR spacer
ctgaaccgcgtcaacgacccgctcgcgcgc	Protospacer
* .***************..****** .

149. spacer 5.4|1948085|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.733 

cctcccgctcaaccgtcgtttgctgttccg	CRISPR spacer
cctcccgctcaaccgtcgcttaagcgatcg	Protospacer
******************.**.     .**

150. spacer 5.4|1948085|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.733 

cctcccgctcaaccgtcgtttgctgttccg	CRISPR spacer
cctcccgctcaaccgtcgcttaagcgatcg	Protospacer
******************.**.     .**

151. spacer 5.5|1947954|28|NZ_CP015821|PILER-CR matches to NZ_MF600313 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence) position: , mismatch: 8, identity: 0.714 

aaaaccgcgtcaacgacttgctcgcttt	CRISPR spacer
tgctgcgcgtcaacgactcgctcgctgg	Protospacer
 .   *************.*******

152. spacer 1.3|1940672|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to MN693117 (Marine virus AFVG_25M88, complete genome) position: , mismatch: 9, identity: 0.7 

gaaatttcgcacgttctcattgacgttttc	CRISPR spacer
caccgctcgcacgttctctttgacgttaag	Protospacer
 *   .************ ********

153. spacer 1.5|1940804|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020695 (Sulfitobacter sp. D7 plasmid p1SUD7, complete sequence) position: , mismatch: 9, identity: 0.7 

-----tgttgataggcgtgtggcgcgtggcaatca	CRISPR spacer
gcaaccg-----gggcgtggggcgcgtggcaatcc	Protospacer
     .*     .****** **************

154. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN689515 (Lactococcus phage CHPC134, complete genome) position: , mismatch: 9, identity: 0.7 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
tttgactttcatcttttggaaaatgttcat	Protospacer
.   .* *********** *********.

155. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN689532 (Lactococcus phage PC_B3, complete genome) position: , mismatch: 9, identity: 0.7 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
tttgactttcatcttttggaaaatgttcat	Protospacer
.   .* *********** *********.

156. spacer 3.7|1943433|30|NZ_CP015821|CRISPRCasFinder,CRT matches to MN689533 (Lactococcus phage PC_S1, complete genome) position: , mismatch: 9, identity: 0.7 

cggcgcgttcatcttttgcaaaatgttcga	CRISPR spacer
tttgactttcatcttttggaaaatgttcat	Protospacer
.   .* *********** *********.

157. spacer 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.7 

agttcggtcgaatgccgaccagcagctcat	CRISPR spacer
ggcgcggtcgattgccgaccagcaggagcc	Protospacer
.*. ******* *************    .

158. spacer 4.8|1946847|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.7 

agttcggtcgaatgccgaccagcagctcat	CRISPR spacer
ggcgcggtcgattgccgaccagcaggagcc	Protospacer
.*. ******* *************    .

159. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.7 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
gcggtcatcgacctgccgcccgacgacatc	Protospacer
  .  ***********.**********

160. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 9, identity: 0.7 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
gcggtcatcgacctgccgcccgacgacatc	Protospacer
  .  ***********.**********

161. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 9, identity: 0.7 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
gccgttttcgacctgctgcacgacgatcgg	Protospacer
     . ************ ******.***

162. spacer 4.9|1946913|30|NZ_CP015821|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7 

taacacatcgacctgctgcccgacgaccgg	CRISPR spacer
gtcggcatcggcctgctgcccgacggccaa	Protospacer
    .*****.**************.**..

163. spacer 5.2|1947953|30|NZ_CP015821|CRISPRCasFinder,CRT matches to NZ_MF600313 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_1, complete sequence) position: , mismatch: 9, identity: 0.7 

caaaaccgcgtcaacgacttgctcgctttg	CRISPR spacer
ctgctgcgcgtcaacgactcgctcgctggt	Protospacer
* .   *************.*******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 147474 : 155181 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_2 1000498 : 1009452 10 uncultured_Mediterranean_phage(85.71%) tRNA NA
DBSCAN-SWA_3 1048647 : 1119223 59 Rhizobium_phage(11.76%) protease,tRNA NA
DBSCAN-SWA_4 1545809 : 1555201 7 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_5 1996292 : 2059300 56 Ochrobactrum_phage(20.0%) portal,tail,terminase,capsid,transposase,tRNA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage