Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019018 Escherichia coli strain Ecol_244 plasmid pEC244_2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP019019 Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP019016 Escherichia coli strain Ecol_244 plasmid pEC244_4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP019017 Escherichia coli strain Ecol_244 plasmid pEC244_KPC, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP019020 Escherichia coli strain Ecol_244 chromosome, complete genome 5 crisprs csa3,cas3,DEDDh,c2c9_V-U4,DinG,RT,WYL 0 6 10 0

Results visualization

1. NZ_CP019018
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3773 : 79681 53 Enterobacteria_phage(13.64%) tRNA,transposase,integrase,protease attL 778:792|attR 38824:38838

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP019017
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 72409 60 Escherichia_phage(30.0%) integrase,transposase attL 42794:42853|attR 65223:65350

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP019020
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019020_1 1803015-1803138 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019020_2 2347925-2348038 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019020_3 2481759-2481850 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019020_4 2603498-2603580 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019020_5 3522076-3522208 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019020_2 2.1|2347948|24|NZ_CP019020|PILER-CR 2347948-2347971 24 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37675 0 1.0
NZ_CP019020_2 2.1|2347948|24|NZ_CP019020|PILER-CR 2347948-2347971 24 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37958 0 1.0
NZ_CP019020_2 2.2|2347995|25|NZ_CP019020|PILER-CR 2347995-2348019 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37628 0 1.0
NZ_CP019020_2 2.2|2347995|25|NZ_CP019020|PILER-CR 2347995-2348019 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37911 0 1.0
NZ_CP019020_2 2.1|2347948|24|NZ_CP019020|PILER-CR 2347948-2347971 24 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44595 1 0.958
NZ_CP019020_2 2.2|2347995|25|NZ_CP019020|PILER-CR 2347995-2348019 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44548 1 0.96
NZ_CP019020_5 5.1|3522093|42|NZ_CP019020|PILER-CR 3522093-3522134 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP019020_1 1.1|1803058|38|NZ_CP019020|CRISPRCasFinder 1803058-1803095 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP019020_3 3.1|2481785|40|NZ_CP019020|CRISPRCasFinder 2481785-2481824 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 2 0.95
NZ_CP019020_5 5.2|3522152|40|NZ_CP019020|PILER-CR 3522152-3522191 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
NZ_CP019020_2 2.2|2347995|25|NZ_CP019020|PILER-CR 2347995-2348019 25 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35685 4 0.84

1. spacer 2.1|2347948|24|NZ_CP019020|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0 

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

2. spacer 2.1|2347948|24|NZ_CP019020|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0 

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

3. spacer 2.2|2347995|25|NZ_CP019020|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0 

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

4. spacer 2.2|2347995|25|NZ_CP019020|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0 

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

5. spacer 2.1|2347948|24|NZ_CP019020|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.958 

cgcctttacctgatttgggtaaac	CRISPR spacer
tgcctttacctgatttgggtaaac	Protospacer
.***********************

6. spacer 2.2|2347995|25|NZ_CP019020|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.96 

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttaaggtaaactttat	Protospacer
*********** *************

7. spacer 5.1|3522093|42|NZ_CP019020|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976 

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

8. spacer 1.1|1803058|38|NZ_CP019020|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

9. spacer 3.1|2481785|40|NZ_CP019020|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 2, identity: 0.95 

gcgctgcgggtcatttttgaaattacctccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.***********.************

10. spacer 5.2|3522152|40|NZ_CP019020|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95 

catggcgtagcaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *********************.*******

11. spacer 2.2|2347995|25|NZ_CP019020|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84 

tttacctctttcaggtaaactttat	CRISPR spacer
ggtatctcattcaggtaaactttat	Protospacer
  **.*** ****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 616636 : 623776 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_2 1200324 : 1209769 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 1304932 : 1311235 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_4 1429653 : 1506975 92 Escherichia_phage(38.0%) integrase,capsid,head,terminase,tail,portal,holin,protease,transposase attL 1400824:1400839|attR 1444067:1444082
DBSCAN-SWA_5 1525219 : 1613467 105 Escherichia_phage(22.22%) tRNA,integrase,capsid,plate,terminase,tail,portal,holin,transposase attL 1525034:1525093|attR 1567646:1567770
DBSCAN-SWA_6 2026900 : 2059337 41 Salmonella_phage(46.43%) tRNA,lysis,tail,capsid NA
DBSCAN-SWA_7 2065271 : 2072009 16 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_8 2312510 : 2361008 62 Enterobacteria_phage(57.69%) tRNA,integrase,capsid,head,terminase,tail,portal,lysis attL 2305861:2305876|attR 2368358:2368373
DBSCAN-SWA_9 3165592 : 3245021 59 Staphylococcus_phage(20.0%) transposase,integrase,holin attL 3191186:3191202|attR 3256336:3256352
DBSCAN-SWA_10 3369378 : 3436684 60 uncultured_Mediterranean_phage(10.0%) tRNA,protease,transposase,bacteriocin NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage