Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019952 Pseudomonas parafulva strain PRS09-11288 chromosome, complete genome 1 crisprs csa3,DEDDh,cas3,DinG,RT 0 1 5 0

Results visualization

1. NZ_CP019952
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019952_1 1780339-1780414 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019952_1 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder 1780364-1780389 26 NZ_CP041194 Weissella cibaria strain CBA3612 plasmid pCBA3612-01, complete sequence 16755-16780 4 0.846
NZ_CP019952_1 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder 1780364-1780389 26 NZ_CP012874 Weissella cibaria strain CH2 plasmid pMKC01, complete sequence 28491-28516 4 0.846
NZ_CP019952_1 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder 1780364-1780389 26 NZ_CP035268 Weissella cibaria strain SRCM103448 plasmid unnamed1, complete sequence 23938-23963 4 0.846
NZ_CP019952_1 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder 1780364-1780389 26 NZ_KY454639 Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence 64180-64205 5 0.808
NZ_CP019952_1 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder 1780364-1780389 26 NZ_CP031790 Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence 80833-80858 5 0.808
NZ_CP019952_1 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder 1780364-1780389 26 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 71042-71067 5 0.808
NZ_CP019952_1 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder 1780364-1780389 26 NZ_CP015754 Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence 82135-82160 5 0.808
NZ_CP019952_1 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder 1780364-1780389 26 NZ_CP026161 Klebsiella pneumoniae strain F93-1 plasmid pF93-1_1, complete sequence 136084-136109 5 0.808
NZ_CP019952_1 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder 1780364-1780389 26 NZ_CP016160 Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence 110023-110048 5 0.808

1. spacer 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder matches to NZ_CP041194 (Weissella cibaria strain CBA3612 plasmid pCBA3612-01, complete sequence) position: , mismatch: 4, identity: 0.846

cacctgcttttttgtcaatttatccg	CRISPR spacer
tagctgcttttttgtcaatttattgg	Protospacer
.* ********************. *

2. spacer 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder matches to NZ_CP012874 (Weissella cibaria strain CH2 plasmid pMKC01, complete sequence) position: , mismatch: 4, identity: 0.846

cacctgcttttttgtcaatttatccg	CRISPR spacer
tagctgcttttttgtcaatttattgg	Protospacer
.* ********************. *

3. spacer 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder matches to NZ_CP035268 (Weissella cibaria strain SRCM103448 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

cacctgcttttttgtcaatttatccg	CRISPR spacer
tagctgcttttttgtcaatttattgg	Protospacer
.* ********************. *

4. spacer 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder matches to NZ_KY454639 (Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence) position: , mismatch: 5, identity: 0.808

cacctgcttttttgtcaatttatccg	CRISPR spacer
cgcctgctttttggtcaatttattaa	Protospacer
*.********** **********. .

5. spacer 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder matches to NZ_CP031790 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cacctgcttttttgtcaatttatccg	CRISPR spacer
cgcctgctttttggtcaatttattaa	Protospacer
*.********** **********. .

6. spacer 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cacctgcttttttgtcaatttatccg	CRISPR spacer
cgcctgctttttggtcaatttattaa	Protospacer
*.********** **********. .

7. spacer 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder matches to NZ_CP015754 (Klebsiella pneumoniae strain W14 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cacctgcttttttgtcaatttatccg	CRISPR spacer
cgcctgctttttggtcaatttattaa	Protospacer
*.********** **********. .

8. spacer 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder matches to NZ_CP026161 (Klebsiella pneumoniae strain F93-1 plasmid pF93-1_1, complete sequence) position: , mismatch: 5, identity: 0.808

cacctgcttttttgtcaatttatccg	CRISPR spacer
cgcctgctttttggtcaatttattaa	Protospacer
*.********** **********. .

9. spacer 1.1|1780364|26|NZ_CP019952|CRISPRCasFinder matches to NZ_CP016160 (Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cacctgcttttttgtcaatttatccg	CRISPR spacer
cgcctgctttttggtcaatttattaa	Protospacer
*.********** **********. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1858355 : 1863080 7 uncultured_Caudovirales_phage(85.71%) NA NA
DBSCAN-SWA_2 1969645 : 2021780 70 uncultured_Caudovirales_phage(48.94%) coat,tail,terminase,tRNA,head,integrase attL 1977088:1977147|attR 2034004:2034068
DBSCAN-SWA_3 2265801 : 2271340 6 uncultured_Caudovirales_phage(83.33%) NA NA
DBSCAN-SWA_4 3696233 : 3704012 10 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_5 4311789 : 4361214 42 Bacteriophage(57.14%) protease,holin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage