Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019947 Pseudomonas sp. CC6-YY-74 chromosome, complete genome 6 crisprs csa3,DinG,cas3,DEDDh 2 3 4 0

Results visualization

1. NZ_CP019947
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019947_1 500776-500876 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019947_2 2498441-2498555 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019947_3 3085397-3085945 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019947_4 3146271-3146407 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019947_5 3175485-3175602 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019947_6 3768043-3768180 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP019947_3 3.2|3085487|18|NZ_CP019947|CRT 3085487-3085504 18 NZ_CP019947.1 458733-458750 1 0.944
NZ_CP019947_3 3.4|3085604|18|NZ_CP019947|CRT 3085604-3085621 18 NZ_CP019947.1 3085379-3085396 1 0.944

1. spacer 3.2|3085487|18|NZ_CP019947|CRT matches to position: 458733-458750, mismatch: 1, identity: 0.944 

aggcgaaatcggcgacat	CRISPR spacer
aggcgaaatgggcgacat	Protospacer
********* ********

2. spacer 3.4|3085604|18|NZ_CP019947|CRT matches to position: 3085379-3085396, mismatch: 1, identity: 0.944 

gggcgaaaccggcgacat	CRISPR spacer
gggcgaaaacggcgacat	Protospacer
******** *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 304678-304704 4 0.852
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 291306-291332 4 0.852
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 303734-303760 4 0.852
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP024829 Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence 8154-8180 4 0.852
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP023732 Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence 90332-90358 4 0.852
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP047663 Escherichia coli strain LD93-1 plasmid pLD93-1-90kb, complete sequence 13733-13759 4 0.852
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 MT374852 Yersinia phage vB_YpM_3, complete genome 32003-32029 4 0.852
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 MT374856 Yersinia phage vB_YpM_23, complete genome 35905-35931 4 0.852
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KU886222 Erwinia phage vB_EamM_Special G, complete genome 255906-255932 4 0.852
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN908687 Gordonia phage Skog, complete genome 81815-81841 4 0.852
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN693163 Marine virus AFVG_25M177, complete genome 10848-10874 4 0.852
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 JF957060 Mycobacterium phage Timshel, complete genome 4194-4220 4 0.852
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_KU987452 Citrobacter freundii strain AC2901 plasmid AC2901, complete sequence 17934-17960 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP043952 Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence 183494-183520 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP021289 Escherichia coli strain PA45B plasmid pPA45B, complete sequence 1550-1576 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MT077889 Escherichia coli plasmid p77, complete sequence 10734-10760 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_LS992181 Escherichia coli isolate Escherichia coli str. TO124 plasmid 2, complete sequence 43819-43845 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP032263 Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence 79026-79052 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP027120 Escherichia coli strain 26561 plasmid unnamed2, complete sequence 10733-10759 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP029578 Escherichia coli strain DA33135 plasmid pDA33135-70, complete sequence 38710-38736 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 KU318420 Klebsiella pneumoniae strain KP04 plasmid pKP04CTXM, complete sequence 10733-10759 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP022731 Escherichia coli strain SA186 plasmid pSA186_2, complete sequence 47352-47378 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP051750 Escherichia coli strain SCU-486 plasmid pSCU-486-1, complete sequence 30828-30854 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 CP052528 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-4, complete sequence 10734-10760 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_019071 Escherichia coli plasmid pHK09, complete sequence 11529-11555 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_019072 Escherichia coli plasmid pHK08, complete sequence 11529-11555 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 KU932024 Escherichia coli plasmid pEC13, complete sequence 11382-11408 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP042879 Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_01, complete sequence 35008-35034 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 LC163971 Escherichia coli O145:NM str. 12E70 plasmid pSTEC-O145-12E70-1 DNA, complete sequence, strain: 12E70 11529-11555 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP016498 Escherichia coli strain UPEC 26-1 plasmid unnamed1, complete sequence 25234-25260 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 KU695535 Escherichia coli plasmid pMEX01, complete sequence 11529-11555 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_019057 Escherichia coli plasmid pHK01, complete sequence 11529-11555 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 CP054450 Escherichia coli strain SCU-488 plasmid pSCU-488-1, complete sequence 73611-73637 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP032205 Escherichia coli strain AR_0013 plasmid unnamed, complete sequence 17525-17551 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_016039 Escherichia coli plasmid pHK17a, complete sequence 11529-11555 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP041299 Escherichia coli O1:H42 strain CLSC36 plasmid pCys-1, complete sequence 77980-78006 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_LR740759 Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202 31772-31798 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_013727 Shigella sonnei plasmid pEG356 complete sequence 11529-11555 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP019055 Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence 29787-29813 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP029742 Escherichia coli strain AR_0085 plasmid unnamed1, complete sequence 106158-106184 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 CP049614 Escherichia coli O157:H7 strain K1516 plasmid pK1516-2 28792-28818 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_LT985274 Escherichia coli strain 723 plasmid RCS66_p, complete sequence 51147-51173 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP047637 Klebsiella pneumoniae strain K2606 plasmid unnamed4, complete sequence 10734-10760 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_MH909349 Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence 11293-11319 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_MH257956 Escherichia coli strain 104 plasmid pHXH-4, complete sequence 17707-17733 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP025329 Escherichia coli strain ExPEC XM plasmid unnamed 280354-280380 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_023327 Escherichia coli ACN001 plasmid pACN001-B, complete sequence 162043-162069 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP011065 Escherichia coli str. Sanji plasmid pSJ_82, complete sequence 11529-11555 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_009837 Escherichia coli APEC O1 plasmid pAPEC-O1-ColBM, complete sequence 89458-89484 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 KJ538722 Mycobacterium phage HH92, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 KT222940 Mycobacterium phage Kinbote, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MH727549 Mycobacterium phage Gancho, complete genome 19626-19652 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MK919482 Mycobacterium phage DeepSoil15, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MT657330 Mycobacterium phage Webster2, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MF919517 Mycobacterium phage LilHazelnut, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 EU203571 Mycobacterium phage Giles, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MK494095 Mycobacterium phage Daegal, complete genome 20196-20222 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MT818421 Mycobacterium phage Luke, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MH697577 Mycobacterium phage Amochick, complete genome 19908-19934 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MT684594 Mycobacterium phage Hadrien, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MT114159 Mycobacterium phage Ein37, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 KT246485 Mycobacterium phage OBUpride, complete genome 19896-19922 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 KT454972 Mycobacterium phage Evanesce, complete genome 19902-19928 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP026494 Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence 71907-71933 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_KP119165 Escherichia coli strain QT598 plasmid pEC598, complete sequence 80024-80050 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP049349 Escherichia coli strain 3R plasmid p3R-1, complete sequence 125734-125760 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP005931 Escherichia coli APEC IMT5155 plasmid p1ColV5155, complete sequence 188487-188513 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_LT985252 Escherichia coli strain 666 plasmid RCS51_p, complete sequence 47459-47485 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP024242 Escherichia coli O114:H49 strain 90-9280 plasmid unnamed2, complete sequence 24238-24264 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_019037 Escherichia coli plasmid pChi7122-2, complete sequence 61233-61259 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP032165 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed2, complete sequence 72215-72241 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP041358 Escherichia coli strain U1 plasmid unnamed1, complete sequence 124266-124292 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP018973 Escherichia coli strain Ecol_545 plasmid pEC545_3, complete sequence 14811-14837 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_013542 Klebsiella pneumoniae plasmid pKF3-70, complete sequence 3581-3607 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP030791 Escherichia coli strain APEC O2-211 plasmid pAPEC-O2-211A-ColV, complete sequence 66053-66079 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP031107 Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence 182661-182687 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP033633 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb2, complete sequence 81232-81258 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_007675 Escherichia coli A2363 plasmid pAPEC-O2-ColV, complete sequence 177832-177858 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP034214 Escherichia albertii strain NCTC 9362 plasmid pNCTC_9362 4247-4273 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP020338 Shigella flexneri 4c strain 1602 plasmid unnamed2, complete sequence 27118-27144 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP042245 Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence 215189-215215 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_LT985214 Escherichia coli strain 649 plasmid RCS101_p, complete sequence 20394-20420 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_LT985272 Escherichia coli strain 506 plasmid RCS62_pI, complete sequence 7973-7999 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_MH917279 Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence 21211-21237 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_MG825372 Escherichia coli strain 1106 plasmid p1106-IncFIB, complete sequence 60726-60752 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_MG825378 Escherichia coli strain 1108 plasmid p1108-IncFIB, complete sequence 159981-160007 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 420342-420368 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 43295-43321 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP017565 Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence 281707-281733 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 142719-142745 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 142873-142899 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 198508-198534 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 475870-475896 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 146220-146246 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 146002-146028 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 148682-148708 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 145272-145298 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 148428-148454 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 390574-390600 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 220712-220738 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 428460-428486 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 75888-75914 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 152277-152303 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 93603-93629 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 118408-118434 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 87062-87088 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 369018-369044 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 86666-86692 5 0.815
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 159089-159115 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH536817 Mycobacterium phage Druantia, complete genome 2317-2343 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MK359340 Mycobacterium phage Phontbonne, complete genome 2314-2340 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KT716399 Pseudomonas phage POR1, complete genome 50115-50141 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KF954506 Mycobacterium phage Nyxis, complete genome 2319-2345 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MT701593 Streptomyces phage Sycamore, complete genome 14444-14470 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX758539 Mycobacterium phage Jaan, complete genome 4873-4899 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN703408 Mycobacterium phage Phaded, complete genome 4872-4898 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 NC_031279 Mycobacterium phage Bactobuster, complete genome 4869-4895 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 NZ_CP020717 Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence 25160-25186 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 NC_041973 Erwinia phage vB_EamM_RAY, complete genome 253828-253854 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MG655267 Erwinia phage vB_EamM_Bosolaphorus, complete genome 254873-254899 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KU886223 Erwinia phage vB_EamM_Simmy50, complete genome 253734-253760 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN445183 Salmonella phage vB_SalM_SA002, complete genome 270107-270133 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX523125 Mycobacterium phage BuzzBuzz, complete genome 2326-2352 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MT553337 Mycobacterium phage DroogsArmy, complete genome 4185-4211 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KC661272 Mycobacterium phage Methuselah, complete genome 2326-2352 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 JF704114 Mycobacterium phage Vix, complete genome 2325-2351 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX557288 Rhodococcus phage ChewyVIII, complete genome 17247-17273 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX557288 Rhodococcus phage ChewyVIII, complete genome 17685-17711 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MF185729 Mycobacterium phage KADY, complete genome 2326-2352 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN234188 Mycobacterium phage Anthony, complete genome 2630-2656 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN096368 Mycobacterium phage Soshari, complete genome 2326-2352 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MT897907 Mycobacterium phage Grif, complete genome 2325-2351 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 NC_004682 Mycobacterium virus Bxz2, complete genome 2336-2362 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX670788 Mycobacterium phage Louie6, complete genome 2326-2352 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 JQ691611 Cronobacter phage CR9, complete genome 11157-11183 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH513975 Mycobacterium phage Misomonster, complete genome 2325-2351 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KC661275 Mycobacterium phage HINdeR, complete genome 4181-4207 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KP017310 Mycobacterium phage Phoxy, complete genome 2326-2352 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 NC_028757 Mycobacterium phage Tiffany, complete genome 2326-2352 5 0.815
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KP017311 Mycobacterium phage Spike509, complete genome 2326-2352 5 0.815
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 558948-558974 6 0.778
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 760011-760037 6 0.778
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 362829-362855 6 0.778
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 759560-759586 6 0.778
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NZ_CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 166125-166151 6 0.778
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 343589-343615 6 0.778
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MN445183 Salmonella phage vB_SalM_SA002, complete genome 272063-272089 6 0.778
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP006370 Aureimonas sp. AU20 plasmid pAU20c, complete sequence 54353-54379 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MK967393 Rhodococcus phage Whack, complete genome 24198-24224 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN497953 Mycobacterium phage GtownJaz, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 JQ896627 Mycobacterium phage ICleared, complete genome 2316-2342 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX585251 Mycobacterium phage Waterfoul, complete genome 19956-19982 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MG925341 Mycobacteriophage EpicPhail, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX808129 Mycobacterium phage Sabinator, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MK359341 Mycobacterium phage GingkoMaracino, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MK279913 Mycobacterium phage PotatoSplit, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MG757161 Mycobacterium phage LugYA, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KU963260 Gordonia phage Emalyn, complete genome 21484-21510 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH047633 Mycobacterium phage Pistachio, complete genome 2211-2237 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH051259 Mycobacterium phage TNguyen7, complete genome 2662-2688 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH536825 Mycobacterium phage Ollie, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KY083058 Mycobacterium phage Abdiel, complete genome 2316-2342 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH020238 Mycobacterium phage Lilith, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MT639639 Gordonia phage LittleFella, complete genome 27408-27434 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH077583 Mycobacterium phage PGHhamlin, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KY464936 Mycobacterium phage Idleandcovert, complete genome 2664-2690 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH155864 Mycobacterium phage Beauxregard13, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH727554 Mycobacterium phage MuchMore, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH338240 Mycobacterium phage Sabia, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN813699 Mycobacterium phage P28Green, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX683423 Mycobacterium phage BabyRay, complete genome 2603-2629 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KM233455 Mycobacterium phage Farber, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 NC_042036 Mycobacterium phage Rockstar, complete genome 2570-2596 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN585984 Mycobacterium phage AgronaGT15, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KU578077 Mycobacterium phage Marie, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KT381277 Mycobacterium phage Wooldri, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH576966 Mycobacterium phage Thyatira, complete genome 19935-19961 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 NC_023562 Mycobacterium phage BellusTerra, complete genome 2316-2342 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MK875800 Mycobacterium phage MoneyMay, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX664448 Mycobacterium phage Watson, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX507362 Mycobacterium phage Aglet, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN586048 Mycobacterium phage Fernando, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KU985091 Mycobacterium phage Hercules11, complete genome 2334-2360 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 NC_042310 Mycobacterium virus JHC117, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH576949 Mycobacterium phage BreSam8, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KP027202 Mycobacterium phage Taurus, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH399776 Mycobacterium phage Grum1, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN585969 Mycobacterium phage Dieselweasel, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KU255188 Mycobacterium phage JenCasNa, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX458237 Mycobacterium phage Penny1, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH536813 Mycobacterium phage AugsMagnumOpus, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MF185733 Mycobacterium phage StepMih, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MF185732 Mycobacterium phage Stagni, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MK494096 Mycobacterium phage Mainiac, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KU984914 Mycobacterium phage Malinsilva, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 JF704101 Mycobacterium virus Microwolf, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KT359365 Mycobacterium phage DaHudson, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KJ510415 Mycobacterium phage Phantastic, complete genome 2669-2695 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH651179 Mycobacterium phage MadMarie, complete genome 2326-2352 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 NC_042339 Mycobacterium virus Arturo, complete genome 2316-2342 6 0.778
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KF279418 Mycobacterium phage Anubis, complete genome 2325-2351 6 0.778
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 NC_042352 Salinibacter virus M31CR41-2, partial genome 17800-17826 7 0.741
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MF629150 Salinibacter virus SRUTV-1, partial genome 19910-19936 7 0.741
NZ_CP019947_3 3.3|3085541|27|NZ_CP019947|CRT 3085541-3085567 27 MF580962 Salinibacter virus M31CR41-3, partial genome 17201-17227 7 0.741
NZ_CP019947_3 3.7|3085766|27|NZ_CP019947|CRT 3085766-3085792 27 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 192730-192756 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 AJ304453 Uncultured bacterium plasmid pSB102 complete genome 2931-2957 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KX712236 Rhodococcus phage Yogi, complete genome 21482-21508 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KY204251 Mycobacterium phage Thanksgivukkah, complete genome 2317-2343 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 KY549153 Rhodococcus phage AngryOrchard, complete genome 21427-21453 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MN945902 Rhodococcus phage Dinger, complete genome 21478-21504 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH271296 Gordonia phage Emperor, complete genome 12963-12989 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH271296 Gordonia phage Emperor, complete genome 13035-13061 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH271291 Rhodococcus phage Alpacados, complete genome 21444-21470 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MK279903 Mycobacterium phage Zetzy, complete genome 2327-2353 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MF537628 Rhodococcus phage Bonanza, complete genome 21482-21508 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH271311 Rhodococcus phage Rasputin, complete genome 21476-21502 7 0.741
NZ_CP019947_3 3.9|3085883|27|NZ_CP019947|CRT 3085883-3085909 27 MH271315 Rhodococcus phage Takoda, complete genome 21468-21494 7 0.741

1. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 4, identity: 0.852 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgatataggcgaaatcggcgacgt	Protospacer
.*****.* ****************.*

2. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 4, identity: 0.852 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgatataggcgaaatcggcgacgt	Protospacer
.*****.* ****************.*

3. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 4, identity: 0.852 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgatataggcgaaatcggcgacgt	Protospacer
.*****.* ****************.*

4. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP024829 (Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence) position: , mismatch: 4, identity: 0.852 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
aggcgaaaacggtgatatcggcccatt	Protospacer
.******* ***************  *

5. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP023732 (Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence) position: , mismatch: 4, identity: 0.852 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
aggcgaaaacggtgatatcggcccatt	Protospacer
.******* ***************  *

6. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP047663 (Escherichia coli strain LD93-1 plasmid pLD93-1-90kb, complete sequence) position: , mismatch: 4, identity: 0.852 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
aggcgaaaacggtgatatcggcccatt	Protospacer
.******* ***************  *

7. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 4, identity: 0.852 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
aggcgaaaacggtgatatcggcccatt	Protospacer
.******* ***************  *

8. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to MT374856 (Yersinia phage vB_YpM_23, complete genome) position: , mismatch: 4, identity: 0.852 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
aggcgaaaacggtgatatcggcccatt	Protospacer
.******* ***************  *

9. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KU886222 (Erwinia phage vB_EamM_Special G, complete genome) position: , mismatch: 4, identity: 0.852 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacaccggtgctga	Protospacer
*************** ******* *.

10. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 4, identity: 0.852 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
tggcgacaagggcgaccccggtgatac	Protospacer
 **************  *********.

11. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN693163 (Marine virus AFVG_25M177, complete genome) position: , mismatch: 4, identity: 0.852 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgatactggtgatac	Protospacer
.************** **.*******.

12. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to JF957060 (Mycobacterium phage Timshel, complete genome) position: , mismatch: 4, identity: 0.852 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggagacac	Protospacer
*************** ***** **.*.

13. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_KU987452 (Citrobacter freundii strain AC2901 plasmid AC2901, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

14. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP043952 (Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

15. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP021289 (Escherichia coli strain PA45B plasmid pPA45B, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

16. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MT077889 (Escherichia coli plasmid p77, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

17. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_LS992181 (Escherichia coli isolate Escherichia coli str. TO124 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

18. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP032263 (Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

19. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP027120 (Escherichia coli strain 26561 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

20. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP029578 (Escherichia coli strain DA33135 plasmid pDA33135-70, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

21. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to KU318420 (Klebsiella pneumoniae strain KP04 plasmid pKP04CTXM, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

22. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP022731 (Escherichia coli strain SA186 plasmid pSA186_2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

23. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP051750 (Escherichia coli strain SCU-486 plasmid pSCU-486-1, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

24. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to CP052528 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-4, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

25. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_019071 (Escherichia coli plasmid pHK09, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

26. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_019072 (Escherichia coli plasmid pHK08, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

27. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to KU932024 (Escherichia coli plasmid pEC13, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

28. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP042879 (Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_01, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

29. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to LC163971 (Escherichia coli O145:NM str. 12E70 plasmid pSTEC-O145-12E70-1 DNA, complete sequence, strain: 12E70) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

30. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP016498 (Escherichia coli strain UPEC 26-1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

31. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to KU695535 (Escherichia coli plasmid pMEX01, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

32. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_019057 (Escherichia coli plasmid pHK01, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

33. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to CP054450 (Escherichia coli strain SCU-488 plasmid pSCU-488-1, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

34. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP032205 (Escherichia coli strain AR_0013 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

35. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_016039 (Escherichia coli plasmid pHK17a, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

36. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP041299 (Escherichia coli O1:H42 strain CLSC36 plasmid pCys-1, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

37. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_LR740759 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

38. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_013727 (Shigella sonnei plasmid pEG356 complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

39. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP019055 (Escherichia coli strain CRE1540 plasmid p1540-4, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

40. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP029742 (Escherichia coli strain AR_0085 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

41. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to CP049614 (Escherichia coli O157:H7 strain K1516 plasmid pK1516-2) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

42. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_LT985274 (Escherichia coli strain 723 plasmid RCS66_p, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

43. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP047637 (Klebsiella pneumoniae strain K2606 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

44. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

45. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_MH257956 (Escherichia coli strain 104 plasmid pHXH-4, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

46. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP025329 (Escherichia coli strain ExPEC XM plasmid unnamed) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

47. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_023327 (Escherichia coli ACN001 plasmid pACN001-B, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

48. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP011065 (Escherichia coli str. Sanji plasmid pSJ_82, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

49. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_009837 (Escherichia coli APEC O1 plasmid pAPEC-O1-ColBM, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

50. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to KJ538722 (Mycobacterium phage HH92, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

51. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to KT222940 (Mycobacterium phage Kinbote, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

52. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MH727549 (Mycobacterium phage Gancho, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

53. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MK919482 (Mycobacterium phage DeepSoil15, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

54. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MT657330 (Mycobacterium phage Webster2, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

55. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MF919517 (Mycobacterium phage LilHazelnut, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

56. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to EU203571 (Mycobacterium phage Giles, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

57. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

58. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MT818421 (Mycobacterium phage Luke, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

59. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MH697577 (Mycobacterium phage Amochick, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

60. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MT684594 (Mycobacterium phage Hadrien, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

61. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MT114159 (Mycobacterium phage Ein37, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

62. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to KT246485 (Mycobacterium phage OBUpride, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

63. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to KT454972 (Mycobacterium phage Evanesce, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gggcgacaaaggcgaaaagggcgaccc	Protospacer
.****************  ****** .

64. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP026494 (Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

65. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_KP119165 (Escherichia coli strain QT598 plasmid pEC598, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

66. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP049349 (Escherichia coli strain 3R plasmid p3R-1, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

67. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP005931 (Escherichia coli APEC IMT5155 plasmid p1ColV5155, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

68. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_LT985252 (Escherichia coli strain 666 plasmid RCS51_p, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

69. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP024242 (Escherichia coli O114:H49 strain 90-9280 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

70. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_019037 (Escherichia coli plasmid pChi7122-2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

71. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP032165 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

72. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP041358 (Escherichia coli strain U1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

73. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP018973 (Escherichia coli strain Ecol_545 plasmid pEC545_3, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

74. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_013542 (Klebsiella pneumoniae plasmid pKF3-70, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

75. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP030791 (Escherichia coli strain APEC O2-211 plasmid pAPEC-O2-211A-ColV, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

76. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP031107 (Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

77. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP033633 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

78. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_007675 (Escherichia coli A2363 plasmid pAPEC-O2-ColV, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

79. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP034214 (Escherichia albertii strain NCTC 9362 plasmid pNCTC_9362) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

80. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP020338 (Shigella flexneri 4c strain 1602 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

81. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP042245 (Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

82. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_LT985214 (Escherichia coli strain 649 plasmid RCS101_p, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

83. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_LT985272 (Escherichia coli strain 506 plasmid RCS62_pI, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

84. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_MH917279 (Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

85. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_MG825372 (Escherichia coli strain 1106 plasmid p1106-IncFIB, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

86. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_MG825378 (Escherichia coli strain 1108 plasmid p1108-IncFIB, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgaaggcggcgaagg	Protospacer
****************. ****** .

87. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcggcaaaggtgaaatcggcgtcga	Protospacer
*****.******.********** *.

88. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
tggcgacaaaggcgggatcggcgaaaa	Protospacer
 *************..******** *

89. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP017565 (Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
cgccgacaaggccgaaatcggcgacac	Protospacer
 * ******.* **************.

90. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

91. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

92. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

93. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

94. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

95. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

96. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

97. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

98. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

99. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

100. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

101. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

102. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

103. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

104. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

105. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

106. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

107. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

108. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

109. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 5, identity: 0.815 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
ggtcgaaaccggtgatatcggcgattc	Protospacer
** *******************  * .

110. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH536817 (Mycobacterium phage Druantia, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacaccggtgccca	Protospacer
*************** ******* .

111. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MK359340 (Mycobacterium phage Phontbonne, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacaccggtgccca	Protospacer
*************** ******* .

112. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KT716399 (Pseudomonas phage POR1, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggtgcacc	Protospacer
*************** *******   .

113. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KF954506 (Mycobacterium phage Nyxis, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacaccggtgccca	Protospacer
*************** ******* .

114. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MT701593 (Streptomyces phage Sycamore, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgataccggtgcgac	Protospacer
.************** *******  *.

115. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX758539 (Mycobacterium phage Jaan, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgataccggtgctca	Protospacer
.************** ******* *

116. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN703408 (Mycobacterium phage Phaded, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgataccggtgctca	Protospacer
.************** ******* *

117. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to NC_031279 (Mycobacterium phage Bactobuster, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgataccggtgctca	Protospacer
.************** ******* *

118. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to NZ_CP020717 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
acgcgaccagggcgaaacctgtgatga	Protospacer
* ***** *********** *****.

119. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to NC_041973 (Erwinia phage vB_EamM_RAY, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacacgggtgctga	Protospacer
*************** ** **** *.

120. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MG655267 (Erwinia phage vB_EamM_Bosolaphorus, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacacgggtgctga	Protospacer
*************** ** **** *.

121. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KU886223 (Erwinia phage vB_EamM_Simmy50, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacacgggtgctga	Protospacer
*************** ** **** *.

122. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN445183 (Salmonella phage vB_SalM_SA002, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggtgataccggtgcgac	Protospacer
************.** *******  *.

123. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX523125 (Mycobacterium phage BuzzBuzz, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

124. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MT553337 (Mycobacterium phage DroogsArmy, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgataccggagacac	Protospacer
.************** ***** **.*.

125. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KC661272 (Mycobacterium phage Methuselah, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

126. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to JF704114 (Mycobacterium phage Vix, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

127. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX557288 (Rhodococcus phage ChewyVIII, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat----	CRISPR spacer
aggcgacaagggcgataccgg----atcgca	Protospacer
*************** *****    **

128. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX557288 (Rhodococcus phage ChewyVIII, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcgcgaa	Protospacer
*************** *****.*  *

129. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MF185729 (Mycobacterium phage KADY, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

130. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN234188 (Mycobacterium phage Anthony, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggtgaaaccggggccac	Protospacer
************.******** * .*.

131. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN096368 (Mycobacterium phage Soshari, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

132. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MT897907 (Mycobacterium phage Grif, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

133. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to NC_004682 (Mycobacterium virus Bxz2, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

134. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX670788 (Mycobacterium phage Louie6, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

135. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to JQ691611 (Cronobacter phage CR9, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggggcaac	Protospacer
*************** ***** *  *.

136. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH513975 (Mycobacterium phage Misomonster, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

137. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KC661275 (Mycobacterium phage HINdeR, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgataccggagacac	Protospacer
.************** ***** **.*.

138. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KP017310 (Mycobacterium phage Phoxy, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

139. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to NC_028757 (Mycobacterium phage Tiffany, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

140. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KP017311 (Mycobacterium phage Spike509, complete genome) position: , mismatch: 5, identity: 0.815 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccaat	Protospacer
*************** *****.   **

141. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 6, identity: 0.778 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
cggcgagaaaggcgaaagcggcgagca	Protospacer
 ***** ********** ******

142. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.778 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
caaagacaatgacgaaatcggcgacat	Protospacer
 .. ***** *.***************

143. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 6, identity: 0.778 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
cggcgacaaaggcgaaatcgaagtcgg	Protospacer
 *******************. * *.

144. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.778 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
caaagacaatgacgaaatcggcgacat	Protospacer
 .. ***** *.***************

145. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 6, identity: 0.778 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
caaagacaatgacgaaatcggcgacat	Protospacer
 .. ***** *.***************

146. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 6, identity: 0.778 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
cggcgacaaaggcgaaatcgaagtcgg	Protospacer
 *******************. * *.

147. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MN445183 (Salmonella phage vB_SalM_SA002, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
aggcgacaaaggcgacaccggcgctga	Protospacer
*************** *.***** ..

148. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 6, identity: 0.778 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
gggcgaaaccgttgatctcggccgcca	Protospacer
*********** **** ****** .

149. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgataccggtgcgga	Protospacer
.************** *******  .

150. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN497953 (Mycobacterium phage GtownJaz, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

151. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to JQ896627 (Mycobacterium phage ICleared, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggagacaccggtgccca	Protospacer
************ ** ******* .

152. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX585251 (Mycobacterium phage Waterfoul, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgaaaaaggtgaccc	Protospacer
.****************  *****. .

153. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MG925341 (Mycobacteriophage EpicPhail, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

154. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX808129 (Mycobacterium phage Sabinator, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

155. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MK359341 (Mycobacterium phage GingkoMaracino, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

156. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MK279913 (Mycobacterium phage PotatoSplit, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

157. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MG757161 (Mycobacterium phage LugYA, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

158. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KU963260 (Gordonia phage Emalyn, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggagacaccggtgacga	Protospacer
.*********** ** ********..

159. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH047633 (Mycobacterium phage Pistachio, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggagacca	Protospacer
.************** ***** **.

160. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH051259 (Mycobacterium phage TNguyen7, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggagacca	Protospacer
.************** ***** **.

161. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH536825 (Mycobacterium phage Ollie, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

162. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KY083058 (Mycobacterium phage Abdiel, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggagacaccggtgccca	Protospacer
************ ** ******* .

163. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH020238 (Mycobacterium phage Lilith, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

164. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MT639639 (Gordonia phage LittleFella, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggcgagca	Protospacer
.************** *****.**

165. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH077583 (Mycobacterium phage PGHhamlin, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

166. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KY464936 (Mycobacterium phage Idleandcovert, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggagacca	Protospacer
.************** ***** **.

167. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH155864 (Mycobacterium phage Beauxregard13, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

168. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH727554 (Mycobacterium phage MuchMore, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

169. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH338240 (Mycobacterium phage Sabia, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

170. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN813699 (Mycobacterium phage P28Green, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

171. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX683423 (Mycobacterium phage BabyRay, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacaccggagccca	Protospacer
*************** ***** * .

172. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KM233455 (Mycobacterium phage Farber, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

173. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to NC_042036 (Mycobacterium phage Rockstar, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacaccggagccca	Protospacer
*************** ***** * .

174. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN585984 (Mycobacterium phage AgronaGT15, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcccgaa	Protospacer
*************** *****.   *

175. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KU578077 (Mycobacterium phage Marie, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

176. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KT381277 (Mycobacterium phage Wooldri, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

177. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH576966 (Mycobacterium phage Thyatira, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgaaaaaggtgaccc	Protospacer
.****************  *****. .

178. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to NC_023562 (Mycobacterium phage BellusTerra, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggagacaccggtgccca	Protospacer
************ ** ******* .

179. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MK875800 (Mycobacterium phage MoneyMay, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

180. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX664448 (Mycobacterium phage Watson, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

181. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX507362 (Mycobacterium phage Aglet, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

182. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN586048 (Mycobacterium phage Fernando, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

183. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KU985091 (Mycobacterium phage Hercules11, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

184. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to NC_042310 (Mycobacterium virus JHC117, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

185. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH576949 (Mycobacterium phage BreSam8, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

186. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KP027202 (Mycobacterium phage Taurus, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

187. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH399776 (Mycobacterium phage Grum1, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

188. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN585969 (Mycobacterium phage Dieselweasel, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

189. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KU255188 (Mycobacterium phage JenCasNa, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

190. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX458237 (Mycobacterium phage Penny1, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

191. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH536813 (Mycobacterium phage AugsMagnumOpus, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

192. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MF185733 (Mycobacterium phage StepMih, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

193. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MF185732 (Mycobacterium phage Stagni, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

194. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MK494096 (Mycobacterium phage Mainiac, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

195. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KU984914 (Mycobacterium phage Malinsilva, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

196. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to JF704101 (Mycobacterium virus Microwolf, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

197. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KT359365 (Mycobacterium phage DaHudson, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

198. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KJ510415 (Mycobacterium phage Phantastic, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgataccggagacca	Protospacer
.************** ***** **.

199. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH651179 (Mycobacterium phage MadMarie, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

200. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to NC_042339 (Mycobacterium virus Arturo, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacacgggtgccca	Protospacer
*************** ** **** .

201. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KF279418 (Mycobacterium phage Anubis, complete genome) position: , mismatch: 6, identity: 0.778 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcaaccc	Protospacer
*************** *****..*. .

202. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to NC_042352 (Salinibacter virus M31CR41-2, partial genome) position: , mismatch: 7, identity: 0.741 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gaccccggaaggcgaaatcggcgacat	Protospacer
.. *   .*******************

203. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MF629150 (Salinibacter virus SRUTV-1, partial genome) position: , mismatch: 7, identity: 0.741 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gaccccggaaggcgaaatcggcgacat	Protospacer
.. *   .*******************

204. spacer 3.3|3085541|27|NZ_CP019947|CRT matches to MF580962 (Salinibacter virus M31CR41-3, partial genome) position: , mismatch: 7, identity: 0.741 

aggcgacaaaggcgaaatcggcgacat	CRISPR spacer
gaccccggaaggcgaaatcggcgacat	Protospacer
.. *   .*******************

205. spacer 3.7|3085766|27|NZ_CP019947|CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 7, identity: 0.741 

gggcgaaaccggtgatatcggccctat	CRISPR spacer
aaccgagaccggtgatatcggcccgga	Protospacer
.. ***.***************** .

206. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to AJ304453 (Uncultured bacterium plasmid pSB102 complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggggacaagggcgaaaccggaagccg	Protospacer
*** ***************** ...

207. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KX712236 (Rhodococcus phage Yogi, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggtaccgc	Protospacer
.************** ******. ...

208. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KY204251 (Mycobacterium phage Thanksgivukkah, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacaccggctccca	Protospacer
*************** *****.  .

209. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to KY549153 (Rhodococcus phage AngryOrchard, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggtaccgc	Protospacer
.************** ******. ...

210. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MN945902 (Rhodococcus phage Dinger, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggtacagc	Protospacer
.************** ******.  ..

211. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacaccggacccgc	Protospacer
*************** *****   ...

212. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgacaccggccccgc	Protospacer
*************** *****.  ...

213. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH271291 (Rhodococcus phage Alpacados, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggtaccgc	Protospacer
.************** ******. ...

214. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MK279903 (Mycobacterium phage Zetzy, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
aggcgacaagggcgataccggcagccc	Protospacer
*************** *****.... .

215. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MF537628 (Rhodococcus phage Bonanza, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggtaccgc	Protospacer
.************** ******. ...

216. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH271311 (Rhodococcus phage Rasputin, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggtacagc	Protospacer
.************** ******.  ..

217. spacer 3.9|3085883|27|NZ_CP019947|CRT matches to MH271315 (Rhodococcus phage Takoda, complete genome) position: , mismatch: 7, identity: 0.741 

aggcgacaagggcgaaaccggtgatat	CRISPR spacer
gggcgacaagggcgacaccggtaccgc	Protospacer
.************** ******. ...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 382551 : 436682 56 Marinobacter_phage(12.5%) portal,terminase,protease,head,tRNA,capsid,holin NA
DBSCAN-SWA_2 1513025 : 1520308 9 uncultured_Caudovirales_phage(85.71%) tRNA NA
DBSCAN-SWA_3 1789972 : 1812119 17 Staphylococcus_prophage(40.0%) transposase NA
DBSCAN-SWA_4 3491299 : 3500155 7 Enterobacteria_phage(50.0%) integrase attL 3488441:3488454|attR 3497967:3497980

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage